ID: 976079149

View in Genome Browser
Species Human (GRCh38)
Location 4:81335411-81335433
Sequence TAGGGTCTAAAAAATGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976079149_976079152 10 Left 976079149 4:81335411-81335433 CCTTGCTCATTTTTTAGACCCTA No data
Right 976079152 4:81335444-81335466 ATTGTTTTAATTAACATTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976079149 Original CRISPR TAGGGTCTAAAAAATGAGCA AGG (reversed) Intergenic
No off target data available for this crispr