ID: 976088416

View in Genome Browser
Species Human (GRCh38)
Location 4:81429871-81429893
Sequence TAAGTGGCCTGCCAGTGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 1, 2: 3, 3: 30, 4: 240}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976088416_976088423 5 Left 976088416 4:81429871-81429893 CCAGCACACTGGCAGGCCACTTA 0: 1
1: 1
2: 3
3: 30
4: 240
Right 976088423 4:81429899-81429921 GGGACGAGGCGAAGTTTGGCAGG No data
976088416_976088420 -9 Left 976088416 4:81429871-81429893 CCAGCACACTGGCAGGCCACTTA 0: 1
1: 1
2: 3
3: 30
4: 240
Right 976088420 4:81429885-81429907 GGCCACTTACTGGCGGGACGAGG 0: 1
1: 0
2: 0
3: 9
4: 60
976088416_976088425 17 Left 976088416 4:81429871-81429893 CCAGCACACTGGCAGGCCACTTA 0: 1
1: 1
2: 3
3: 30
4: 240
Right 976088425 4:81429911-81429933 AGTTTGGCAGGCGCAGTCGGAGG 0: 1
1: 0
2: 25
3: 104
4: 353
976088416_976088427 27 Left 976088416 4:81429871-81429893 CCAGCACACTGGCAGGCCACTTA 0: 1
1: 1
2: 3
3: 30
4: 240
Right 976088427 4:81429921-81429943 GCGCAGTCGGAGGAGAGCCTGGG 0: 1
1: 7
2: 38
3: 93
4: 220
976088416_976088424 14 Left 976088416 4:81429871-81429893 CCAGCACACTGGCAGGCCACTTA 0: 1
1: 1
2: 3
3: 30
4: 240
Right 976088424 4:81429908-81429930 CGAAGTTTGGCAGGCGCAGTCGG 0: 1
1: 0
2: 0
3: 24
4: 139
976088416_976088422 1 Left 976088416 4:81429871-81429893 CCAGCACACTGGCAGGCCACTTA 0: 1
1: 1
2: 3
3: 30
4: 240
Right 976088422 4:81429895-81429917 TGGCGGGACGAGGCGAAGTTTGG 0: 1
1: 0
2: 3
3: 10
4: 90
976088416_976088426 26 Left 976088416 4:81429871-81429893 CCAGCACACTGGCAGGCCACTTA 0: 1
1: 1
2: 3
3: 30
4: 240
Right 976088426 4:81429920-81429942 GGCGCAGTCGGAGGAGAGCCTGG 0: 1
1: 10
2: 45
3: 118
4: 408

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976088416 Original CRISPR TAAGTGGCCTGCCAGTGTGC TGG (reversed) Intronic
900469896 1:2848554-2848576 TATGTGAGCTGCCAGTGTGGAGG + Intergenic
901136187 1:6997906-6997928 TCCTTGGCCTCCCAGTGTGCTGG + Intronic
904657388 1:32059315-32059337 TTAATGGCTTGCCAGAGTGCTGG - Intronic
905503818 1:38460399-38460421 TAAGAGGCCAGACAGTATGCTGG - Intergenic
905558732 1:38909050-38909072 TCAGTGGCCTGCTGGCGTGCTGG + Intronic
910310081 1:85813479-85813501 TAAGTCACCTGCCAGAGTCCTGG - Intronic
911791092 1:102015778-102015800 CAAGTGGCCTCCCAAAGTGCTGG - Intergenic
915960533 1:160262771-160262793 GAAGTGGCCTGCCAATCCGCTGG - Intergenic
918813336 1:189149851-189149873 TGGATGGCCTGCCAGTGTGCAGG - Intergenic
920076932 1:203344090-203344112 TAAGTGGCCTCTGAGTGAGCAGG + Intronic
922182095 1:223243381-223243403 TGAGTCCCCTGCCAGTGCGCAGG - Intronic
923109951 1:230882635-230882657 TCAGTGGCCTGCCGGCCTGCCGG + Intergenic
923125145 1:231028110-231028132 GAAGTGGCCTGGCAGTGGGGTGG + Intronic
924589667 1:245391540-245391562 AAATTGGCCTGCCAAAGTGCTGG - Intronic
1063357766 10:5417157-5417179 CAGCTGGCCTGCCAGCGTGCTGG + Intronic
1064056569 10:12102867-12102889 TATTTGGCCTCCCAGAGTGCTGG + Intronic
1064220579 10:13437216-13437238 TCAGTGTCCAGCCAGTGTCCGGG + Intergenic
1065119759 10:22516882-22516904 AAAGTGGCTTGAAAGTGTGCAGG + Intergenic
1065421963 10:25554944-25554966 TCAGTGGCTTGCCAGTGAGGTGG - Intronic
1065795970 10:29308677-29308699 TAAGTGGCCAGGCACAGTGCTGG + Intronic
1067226578 10:44380387-44380409 TAACTGGCCTGCCAGTTTCGGGG - Intronic
1067741989 10:48902377-48902399 TAAGTGGCCTTCCAGAGAACTGG - Intronic
1070826162 10:79391662-79391684 TAAGTGGCCTGGGAGGGAGCAGG - Intronic
1071272255 10:84019065-84019087 TCAGTGGCCTCCCAAAGTGCTGG - Intergenic
1071953004 10:90726577-90726599 TAAGTGATCTGCTAGGGTGCTGG + Intergenic
1073583546 10:104688253-104688275 TGAGTGGCCAGTCAGGGTGCAGG - Intronic
1073639728 10:105239624-105239646 TAAGGGGCCTCCCTGTGGGCTGG + Intronic
1075656376 10:124164075-124164097 TAAGTGTTCTCCCAGTGTGTTGG + Intergenic
1076645737 10:131952948-131952970 TCAGTGACTTGCGAGTGTGCGGG + Intronic
1076645872 10:131953757-131953779 TTAGTGACTTGCGAGTGTGCGGG + Intronic
1077226827 11:1442239-1442261 GAAGGAGCCTGCCAGGGTGCAGG + Intronic
1077340663 11:2024963-2024985 TAGCTGGCCTGCCAGAGTGTGGG - Intergenic
1080667445 11:34348323-34348345 TAAGAAGCCTGCCAGAGTACAGG - Intronic
1081061329 11:38481599-38481621 TAGGTGGCCTGCTGGTGCGCTGG - Intergenic
1081133214 11:39405565-39405587 AAAATGGCCTGCCATTGTGTAGG + Intergenic
1081253927 11:40869667-40869689 GCAGTGGCCTGCTAGTGTGTGGG - Intronic
1081352078 11:42066301-42066323 TCAACGGCCTGCCAGCGTGCTGG - Intergenic
1081979583 11:47258015-47258037 TCGGTGGCCAGCCAGTGAGCTGG - Exonic
1084623183 11:70287893-70287915 TACTTGGCCTCCCAGAGTGCTGG + Intronic
1084918667 11:72451013-72451035 TAATTGGCCTCCCAAAGTGCTGG - Intergenic
1084927069 11:72522380-72522402 TCAGTGGCCTGCCATCGTGCTGG + Intergenic
1088091513 11:106045844-106045866 GAATTGGCCTGCCAGTTTGTTGG - Intergenic
1089227275 11:116936023-116936045 TTCTTGGCCTCCCAGTGTGCTGG - Intronic
1202823648 11_KI270721v1_random:80152-80174 TAGCTGGCCTGCCAGAGTGTGGG - Intergenic
1092569972 12:9710745-9710767 TCAGTGGCCTACCAGCATGCTGG - Intergenic
1093509013 12:19904033-19904055 TCAGTGGCCTGCTTGCGTGCTGG - Intergenic
1098386272 12:69922108-69922130 TAGATTGCCTGCCAGTGAGCAGG + Intronic
1100973757 12:100099509-100099531 CAAGTGGCCTCCCAAAGTGCTGG - Intronic
1103735149 12:123056466-123056488 TATGTGGACGGCCACTGTGCTGG + Intronic
1103789051 12:123456324-123456346 AACTTGGCCTCCCAGTGTGCTGG + Intergenic
1103875196 12:124121707-124121729 AAAGTGGTCTTCCAGGGTGCAGG - Intronic
1105337481 13:19487178-19487200 TAGTTGGCCTGACAGTCTGCTGG + Intronic
1105614576 13:22000382-22000404 TCAGTGGCCTGCCAGCATGCCGG - Intergenic
1107046538 13:35999003-35999025 TCAGTGGCCTCCCAAAGTGCTGG - Intronic
1112941383 13:104866442-104866464 TAAATGGCCTGCCTATGTGCTGG - Intergenic
1115308872 14:31959217-31959239 AGAGTGGCCTCCCAGAGTGCTGG + Intergenic
1116345397 14:43786564-43786586 TTGATGGCCTGCCAGCGTGCTGG + Intergenic
1119697686 14:76726631-76726653 TCAGTGGCCTGCCGGCATGCTGG + Intergenic
1120545160 14:85802025-85802047 TATGTGGGCTTCCACTGTGCTGG + Intergenic
1121095831 14:91217404-91217426 CAAGTCCCCTGCCAGTGGGCAGG + Intronic
1121237657 14:92404481-92404503 TACATCTCCTGCCAGTGTGCTGG - Intronic
1121255164 14:92525574-92525596 TAGGAGGCCTGCCAGGGTGGAGG + Intronic
1121313016 14:92945341-92945363 AAAGTGCCCAGCCAGTGTGTGGG + Intronic
1121795984 14:96735707-96735729 TAATTGCCCTGGCAGTGTCCTGG + Intergenic
1126537896 15:49786943-49786965 TAAGTGGCATTCCATTGTGTGGG + Intergenic
1130960366 15:88654924-88654946 TAAGAGGCCTGCGAGGGTGGGGG - Intronic
1131775111 15:95786741-95786763 AAAGTGGCCTCCCAAAGTGCTGG - Intergenic
1132323048 15:100941529-100941551 TCGGTGGCCTGCCTGTGTGCTGG + Intronic
1135569890 16:23541063-23541085 CAAGTGGCCTCCCAAAGTGCTGG - Intronic
1136314265 16:29441727-29441749 GACGTGGCCTCCCAGAGTGCTGG + Intergenic
1136327704 16:29543492-29543514 GACGTGGCCTCCCAGAGTGCTGG + Intergenic
1136442392 16:30283493-30283515 GACGTGGCCTCCCAGAGTGCTGG + Intergenic
1139224570 16:65221931-65221953 TAGCTGGCCTGCCAGTCTGGAGG + Intergenic
1139538360 16:67594157-67594179 CAAGTGGCCTCCCAAAGTGCTGG - Intronic
1139678842 16:68544139-68544161 AAAGAGGCCAGCCAGTGTGGTGG - Intronic
1140801508 16:78492418-78492440 AAACTGACCTCCCAGTGTGCTGG + Intronic
1141154514 16:81587869-81587891 TGTGTGGACAGCCAGTGTGCGGG + Intronic
1141648448 16:85379675-85379697 TCAGTGGCCTGGCAGGGAGCAGG - Intergenic
1142162244 16:88563902-88563924 GACTTGGCCTCCCAGTGTGCTGG - Intergenic
1142468791 17:150815-150837 TAAGTGGTCTTCCATTGTGTGGG - Intronic
1142712096 17:1728993-1729015 TAGGTGCTCTGCCAGTGTGCAGG - Intronic
1142740756 17:1930643-1930665 TAAGTGGCATTTCAGTGGGCTGG - Intergenic
1143290265 17:5822890-5822912 TCAATGGCCGGCCAGGGTGCTGG + Intronic
1143656129 17:8294772-8294794 TGAGTGGCCTGGCAGCCTGCGGG - Exonic
1145783526 17:27579329-27579351 TAAGTGGCCGAGCAGAGTGCTGG - Intronic
1146432803 17:32814018-32814040 AAAGTGACCTGCCAGAGTTCAGG + Intronic
1146845919 17:36182152-36182174 TACATGTCCTGCCAGTGTGTAGG + Intronic
1146963136 17:37001950-37001972 CACTTGGCCTCCCAGTGTGCTGG - Intronic
1148032223 17:44629144-44629166 TCAGTGGCCTGCCAGCATGCCGG - Intergenic
1150667158 17:67151944-67151966 TATGTGATCTGCCTGTGTGCTGG - Intronic
1151070459 17:71204567-71204589 GAAGTGGCCTCCCAAAGTGCTGG - Intergenic
1154950310 18:21203251-21203273 AAGTTGGCCTCCCAGTGTGCTGG + Intergenic
1155332306 18:24730737-24730759 TAACTGCCTTGCCAGAGTGCTGG + Intergenic
1157830636 18:50854234-50854256 TGACTGCCCTGCCAGTGTGGTGG + Intergenic
1158478260 18:57799459-57799481 AAAGTGGCCTCCCAAAGTGCTGG - Intronic
1159328071 18:66949597-66949619 CCAATGGCCTGCCAGCGTGCAGG + Intergenic
1159345793 18:67201324-67201346 TCAGTGGACTGCCAGTGTGACGG + Intergenic
1159721692 18:71899117-71899139 TGGGTGGCCTGCCAGTATGCTGG + Intergenic
1162671103 19:12258578-12258600 GCTGTGGCCTCCCAGTGTGCTGG - Intronic
1162756771 19:12865483-12865505 TACGTGGCTTGGCAGTGTACAGG + Intronic
1162942704 19:14022926-14022948 TCCTTGGCCTCCCAGTGTGCTGG + Intergenic
1163110177 19:15155630-15155652 TCCTTGGCCTGCCAATGTGCCGG - Intergenic
1164743336 19:30593341-30593363 TAAGAGGCCATCCACTGTGCTGG + Intronic
1166145547 19:40832289-40832311 TCCTTGGCCTCCCAGTGTGCTGG - Intronic
1166247045 19:41536728-41536750 TCGGTGGCCTGCCAGAGTGCTGG - Intergenic
1166815033 19:45539347-45539369 TGAGTAGCCTCCCAGAGTGCTGG - Intronic
1168579176 19:57539439-57539461 TATGTGCTCTGCCAGTGTGAAGG + Exonic
925424738 2:3739536-3739558 TCGGCGGCCTGCCGGTGTGCCGG - Intronic
925989349 2:9241487-9241509 TCTTTGGCCTCCCAGTGTGCTGG - Intronic
926139248 2:10358662-10358684 TCAGTGGCCTGCCAGCGTGCCGG - Intronic
926641811 2:15245266-15245288 GAAGTGGCCTGAGAGTGTGAAGG - Intronic
931470189 2:62531771-62531793 TTGGTGGCCTGCCGGCGTGCTGG + Intergenic
935230753 2:101093943-101093965 TATGTGGCCTCCCAAAGTGCTGG + Intronic
936746453 2:115582211-115582233 ACAGTGGCCTGCCAGCGTGTCGG + Intronic
937523208 2:122736421-122736443 TCAGTGGCCTGCCAGCATGTGGG - Intergenic
939818861 2:146930863-146930885 TTGGTGGCCTGCCAGTGTGCTGG - Intergenic
941186213 2:162324450-162324472 ATGGTGGCCTGCCAGTGTGCTGG + Intronic
941974377 2:171386901-171386923 TGGGTGGCCTGCTGGTGTGCTGG - Intronic
945721871 2:213428176-213428198 TAAGTGGGCAGCCTGTGTGGTGG + Intronic
945813884 2:214580109-214580131 GCTGTGGCCTCCCAGTGTGCTGG + Intergenic
1169754430 20:9028547-9028569 TAAGAGGCCTGTCAGGCTGCTGG + Intergenic
1172027585 20:31959578-31959600 TCTATGGCCTGCCAGTGTGGTGG + Intergenic
1175571347 20:60025075-60025097 TTTTTGGCCTGCCAGTGTGAGGG - Intronic
1177644777 21:23887317-23887339 TCAGTGGCCTGCTGGTGTCCGGG - Intergenic
1177912458 21:27049626-27049648 TCGGTGGCCTGCCAGTGTATCGG - Intergenic
1180120131 21:45740304-45740326 GAAGTGACCTGCCAGTGAGGCGG - Intronic
1180839635 22:18953250-18953272 TCAGTGGCCTGCCAGCATGCCGG + Intergenic
1181062269 22:20287229-20287251 TCAGTGGCCTGCCAGCATGCCGG - Intergenic
1182588712 22:31362614-31362636 GCAGTGGCCTGCCAAAGTGCTGG + Intergenic
1182894533 22:33848443-33848465 TCAGTGGCCTGCAGGGGTGCAGG - Intronic
1182990982 22:34767422-34767444 TATGTGGCTTGCCAGTGTTGGGG + Intergenic
1183533058 22:38374657-38374679 TAGCTGGCCTGACAGTCTGCTGG + Intronic
1183759878 22:39806396-39806418 TTAGAGGACTCCCAGTGTGCTGG + Intronic
1183971450 22:41480543-41480565 AACGTGGCCTGCCTGTGTACTGG - Intronic
1184835585 22:47019166-47019188 CGAGTGGCCTCCCAGTGCGCTGG + Intronic
1185280887 22:49969402-49969424 TGAGTGTCCTGCCAGGGTCCGGG + Intergenic
949715786 3:6929769-6929791 TAAGTGGCCTGGAGGTGTGTAGG + Intronic
950168678 3:10820892-10820914 GAAGTGGCCTGCCATCGTGAGGG + Intronic
954922484 3:54203705-54203727 TCAGTGGCCTGCCTGTGTGCTGG + Intronic
955377078 3:58406510-58406532 CAAGTGGCCTCCCAAAGTGCTGG + Intronic
955455437 3:59116020-59116042 TAAGTGGCATGCCAGACAGCTGG + Intergenic
955480557 3:59385324-59385346 TCGATGGCCTGCCAGTGTGCTGG - Intergenic
959726708 3:109551437-109551459 TAAGTTGCCTGGCACAGTGCAGG + Intergenic
960062847 3:113340997-113341019 TCAATGGCCTGCCGGCGTGCTGG + Intronic
961116619 3:124335211-124335233 CACGTGGCCTGCCAGAGTGAAGG + Intronic
961134938 3:124501667-124501689 CTAGTGGCCTCCCAGTGTGCAGG - Intronic
965320994 3:167251051-167251073 TCAGTGGTCTGCTGGTGTGCTGG - Intronic
966803210 3:183784133-183784155 GAAGTGGCCTCCCAAAGTGCTGG + Intronic
970792157 4:19870971-19870993 TATGGTTCCTGCCAGTGTGCTGG + Intergenic
972436438 4:39040016-39040038 GGAGTGGCCTGACAGTGGGCCGG + Intergenic
975860308 4:78670162-78670184 TAATTGGCCTGCCAGTGAATGGG + Intergenic
976070655 4:81236182-81236204 TCAATGGCCTGCCAGCGTGCTGG + Intergenic
976088416 4:81429871-81429893 TAAGTGGCCTGCCAGTGTGCTGG - Intronic
978614926 4:110584832-110584854 TCATTGGCCTCCCAGAGTGCTGG - Intergenic
978848736 4:113307650-113307672 TACTTGGCCTGCCAAAGTGCTGG + Intronic
979088946 4:116453305-116453327 TGGATGGCCTGCCAGCGTGCTGG + Intergenic
984261235 4:177445239-177445261 TCAATGGCCTGCCAGCATGCCGG - Intergenic
984761590 4:183367034-183367056 TCAGTGGCCTGCCTGGGTGCAGG - Intergenic
985252985 4:188042069-188042091 TCAATGGCCTGTCCGTGTGCCGG - Intergenic
985352241 4:189077252-189077274 AAAGTGGCAAGTCAGTGTGCTGG - Intergenic
985577143 5:678700-678722 GGAGGGGACTGCCAGTGTGCAGG + Intronic
985592061 5:770753-770775 GGAGGGGACTGCCAGTGTGCAGG + Intergenic
985642429 5:1070009-1070031 TAAGTGTGATGCCCGTGTGCTGG - Intronic
985642443 5:1070062-1070084 TAAGTGTGATGCCCGTGTGCTGG - Intronic
985642453 5:1070104-1070126 TAAGTGTGATGCCCGTGTGCTGG - Intronic
985642463 5:1070146-1070168 TAAGTGTGATGCCCGTGTGCTGG - Intronic
985642477 5:1070199-1070221 TAAGTGTGATGCCCGTGTGCTGG - Intronic
985642487 5:1070241-1070263 TAAGTGTGATGCCCGTGTGCTGG - Intronic
985642505 5:1070323-1070345 TAAGTGTGATGCCCGTGTGCTGG - Intronic
985642523 5:1070405-1070427 TAAGTGTGATGCCCGTGTGCTGG - Intronic
985642532 5:1070446-1070468 TAAGTGTGATGCCCGTGTGCTGG - Intronic
985642541 5:1070487-1070509 TAAGTGTGATGCCCGTGTGCTGG - Intronic
985642564 5:1070581-1070603 TAAGTGTGATGCCCGTGTGCTGG - Intronic
985642574 5:1070623-1070645 TAAGTGTGATGCCCGTGTGCTGG - Intronic
985642600 5:1070745-1070767 TAAGTGTGATGCCCGTGTGCTGG - Intronic
985642632 5:1070880-1070902 TAAGTGTGATGCCCGTGTGCTGG - Intronic
985642662 5:1071006-1071028 TAAGTGTGATGCCCGTGTGCTGG - Intronic
985642671 5:1071047-1071069 TAAGTGTGATGCCCGTGTGCTGG - Intronic
985642697 5:1071169-1071191 TAAGTGTGATGCCCGTGTGCTGG - Intronic
985642755 5:1071426-1071448 TAAGTGTGATGCCCGTGTGCTGG - Intronic
985642764 5:1071467-1071489 TAAGTGTGATGCCCGTGTGCTGG - Intronic
985642791 5:1071590-1071612 TAAGTGTGATGCCCGTGTGCTGG - Intronic
985642801 5:1071632-1071654 TAAGTGTGATGCCCGTGTGCTGG - Intronic
985642811 5:1071674-1071696 TAAGTGTGATGCCCGTGTGCTGG - Intronic
985642820 5:1071715-1071737 TAAGTGTGATGCCCGTGTGCTGG - Intronic
985642847 5:1071838-1071860 TAAGTGTGATGCCCGTGTGCTGG - Intronic
985642857 5:1071880-1071902 TAAGTGTGATGCCCGTGTGCTGG - Intronic
985642867 5:1071922-1071944 TAAGTGTGATGCCCGTGTGCTGG - Intronic
985642877 5:1071964-1071986 TAAGTGTGATGCCCGTGTGCTGG - Intronic
985642899 5:1072057-1072079 TAAGTGTGATGCCCGTGTGCTGG - Intronic
985642909 5:1072099-1072121 TAAGTGTGATGCCCGTGTGCTGG - Intronic
985642932 5:1072193-1072215 TAAGTGTGATGCCCGTGTGCTGG - Intronic
985642946 5:1072246-1072268 TAAGTGTGATGCCCGTGTGCTGG - Intronic
985642955 5:1072287-1072309 TAAGTGTGATGCCCGTGTGCTGG - Intronic
985642968 5:1072340-1072362 TAAGTGTGATGCCAGTGTGCTGG - Intronic
985642987 5:1072423-1072445 TAAGTGTGATGCCCGTGTGCTGG - Intronic
985643001 5:1072476-1072498 TAAGTGTGATGCCCGTGTGCTGG - Intronic
985643015 5:1072529-1072551 TAAGTGTGATGCCCGTGTGCTGG - Intronic
985643037 5:1072622-1072644 TAAGTGTGATGCCCGTGTGCTGG - Intronic
985643050 5:1072675-1072697 TAAGTGTGATGCCAGTGTGCTGG - Intronic
985643073 5:1072769-1072791 TAAGTGTGATGCCCGTGTGCTGG - Intronic
985643096 5:1072863-1072885 TAAGTGTGATGCCCGTGTGCTGG - Intronic
985643106 5:1072905-1072927 TAAGTGTGATGCCCGTGTGCTGG - Intronic
985643120 5:1072958-1072980 TAAGTGTGATGCCCGTGTGCTGG - Intronic
985643130 5:1073000-1073022 TAAGTGTGATGCCCGTGTGCTGG - Intronic
985643140 5:1073042-1073064 TAAGTGTGATGCCCGTGTGCTGG - Intronic
985643154 5:1073095-1073117 TAAGTGTGATGCCCGTGTGCTGG - Intronic
985643164 5:1073137-1073159 TAAGTGTGATGCCCGTGTGCTGG - Intronic
985643178 5:1073190-1073212 TAAGTGTGATGCCCGTGTGCTGG - Intronic
985643188 5:1073232-1073254 TAAGTGTGATGCCCGTGTGCTGG - Intronic
985643198 5:1073274-1073296 TAAGTGTGATGCCCGTGTGCTGG - Intronic
989137481 5:38169281-38169303 TAAGTAGACTATCAGTGTGCTGG - Intergenic
990665139 5:58063448-58063470 TATGTGGCTTGCAAGGGTGCTGG - Intergenic
993207393 5:84900101-84900123 CAAGTGGCCTCCCAATGTGCTGG - Intergenic
994495099 5:100502024-100502046 TAAGTTGCCTGTCAGGGTGTTGG + Intergenic
998417809 5:141958310-141958332 TAAGTGGCCTGCCGCTGAGGAGG + Exonic
999375093 5:151081075-151081097 CGAGTGGCCTGCCAGTCTCCGGG - Intronic
999927275 5:156392824-156392846 TCGGTGGCCTGCCAGCATGCTGG + Intronic
1000532804 5:162444627-162444649 TCGGTGGCCTGCCATGGTGCAGG - Intergenic
1002477011 5:179472768-179472790 TCAATGGCCTGCCGGCGTGCCGG + Intergenic
1002962204 6:1925969-1925991 TCTGTGGCCTGCCGGTGTGCTGG - Intronic
1002973241 6:2046708-2046730 TGCCTGGCCTCCCAGTGTGCTGG + Intronic
1003809920 6:9768094-9768116 TCAGTGGCCTGCCAGCCTGTTGG + Intronic
1007307557 6:40918809-40918831 TCAGTGGCCTGCTGGTGTGCCGG - Intergenic
1008546009 6:52584217-52584239 TCCTTGGCCTCCCAGTGTGCTGG - Intergenic
1008766809 6:54926980-54927002 AAAGTGGCCTCCCAAAGTGCTGG + Intronic
1010995120 6:82523801-82523823 TCACTGGCCTGCCAGCATGCCGG - Intergenic
1013961752 6:115909175-115909197 TAAGTGACTTGCAAGTGGGCAGG - Intergenic
1014727995 6:124996193-124996215 TAAGTGTTTTGCCAGTCTGCAGG + Intronic
1015260311 6:131229605-131229627 AAAGTGGCCTCCCAAAGTGCTGG + Intronic
1016109563 6:140205965-140205987 TCAGTAGCCTGCCAGCATGCGGG - Intergenic
1016710723 6:147168606-147168628 GAAGGGTCCTGCCTGTGTGCTGG + Intergenic
1020430326 7:8111426-8111448 TAAGTGGCCTGCGTGCCTGCGGG - Intergenic
1022501818 7:30886611-30886633 TAAGTGACCTTCCAATGGGCTGG - Intronic
1022605861 7:31813338-31813360 GAAGCAGCCTGCCAGGGTGCTGG + Intronic
1024119394 7:46221730-46221752 AAAGAGGCTTTCCAGTGTGCGGG + Intergenic
1024203087 7:47126147-47126169 TTGATGGCCTGCCAGTCTGCTGG + Intergenic
1025599426 7:62976825-62976847 AAAGTCTACTGCCAGTGTGCAGG + Intergenic
1026463674 7:70635608-70635630 TAGGTGGCCTGGCAGTGGGAAGG + Intronic
1031179351 7:118394610-118394632 TCGATGGCCTGCCAGCGTGCAGG + Intergenic
1031219420 7:118945818-118945840 TCAGTGGCCTGCTGGTGTGCCGG - Intergenic
1032907467 7:136387024-136387046 GACTTGGCCTGCCAGTGGGCAGG + Intergenic
1042924829 8:73956149-73956171 TGATTGGCCTGCCAAAGTGCTGG - Intronic
1043017314 8:74955842-74955864 TCAGTGGCCTCCCAAAGTGCTGG + Intergenic
1043522338 8:81059774-81059796 TAATTGGCCTCCCAAAGTGCTGG - Intronic
1044625219 8:94230110-94230132 GACTTGGCCTCCCAGTGTGCTGG - Intergenic
1044748288 8:95392551-95392573 GAATTGGCCTGACAGTCTGCTGG - Intergenic
1045861502 8:106819134-106819156 TCAGTGGCCTGCCGGCCTGCTGG - Intergenic
1046277458 8:111982324-111982346 TGAATGGCCTGCCGGTGTGCTGG + Intergenic
1047204359 8:122791405-122791427 TAAGTGACCTGCCCGTGCCCAGG - Intronic
1048223642 8:132565228-132565250 TGAGTGGCCTGCAAATGTCCAGG - Intergenic
1049720006 8:144111372-144111394 TGGGTGGCATGCCAGTGGGCTGG - Intronic
1049726959 8:144151401-144151423 TCGATGGCCTGCCAGAGTGCTGG - Intronic
1050202177 9:3157143-3157165 TTGATGGCCTGCCAGTGTGCCGG + Intergenic
1050588813 9:7141406-7141428 TAACTGGCCTCCCAGTATTCAGG - Intergenic
1051887028 9:21904145-21904167 TCAGTGGCCTGCCAGTGTGCTGG + Intronic
1053106394 9:35412527-35412549 CAAGTGGCCTCCCAAAGTGCTGG + Intergenic
1059205133 9:112457399-112457421 TGATTGGCCTCCCAGAGTGCTGG - Intronic
1185942888 X:4340905-4340927 TCAATGGCCTGCCCGTGTGCTGG + Intergenic
1187292657 X:17970015-17970037 TAAGAGGCCTTCCATTGTGCAGG - Intergenic
1188748370 X:33874550-33874572 TAAGTGGCTTTCAAGTGTTCAGG + Intergenic
1191920475 X:66251130-66251152 ACTGTGGCCTCCCAGTGTGCTGG + Intronic
1193614048 X:83666779-83666801 TCCGTGCCCTGCCAGTGTGCAGG - Intergenic
1194425674 X:93734455-93734477 GACTTGGCCTGCCAGAGTGCTGG + Intergenic
1195367308 X:104138811-104138833 TCAATGGCCTGCCGGCGTGCTGG + Intronic
1196261421 X:113586488-113586510 TCAGTGGCCTGCCAGCATGCTGG + Intergenic
1197650999 X:129063599-129063621 TTGGTTGCTTGCCAGTGTGCTGG + Intergenic
1198085487 X:133278427-133278449 TCTTTGGCCTCCCAGTGTGCTGG - Intergenic
1198278713 X:135121427-135121449 TGAGTGGGCAGCCAGTGTGGAGG - Intergenic
1198292248 X:135251089-135251111 TGAGTGGGCAGCCAGTGTGGAGG + Intronic
1198298172 X:135307355-135307377 TGAGTGGGCAGCCAGTGTGCAGG + Intronic
1198306987 X:135393263-135393285 TGAGTGGGCAGCCAGTGTGTAGG + Intergenic
1198661864 X:138978148-138978170 GAAGTGGCCTGGCAGTGTTATGG - Intronic
1198683417 X:139204571-139204593 AAAGCAGCCTGCCAGTGCGCGGG - Intronic
1202594380 Y:26521364-26521386 TAGTTGGCCTGACAGTCTGCTGG - Intergenic