ID: 976089026

View in Genome Browser
Species Human (GRCh38)
Location 4:81435899-81435921
Sequence CTGTAGTCCCAGGTATAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1862
Summary {0: 1, 1: 1, 2: 25, 3: 226, 4: 1609}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976089026_976089035 27 Left 976089026 4:81435899-81435921 CCCTCCTATACCTGGGACTACAG 0: 1
1: 1
2: 25
3: 226
4: 1609
Right 976089035 4:81435949-81435971 TTAAAAATTTTGTGTAGAGATGG 0: 6
1: 146
2: 1099
3: 3797
4: 9473

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976089026 Original CRISPR CTGTAGTCCCAGGTATAGGA GGG (reversed) Intronic
900081583 1:862574-862596 CTGCAGACCCAGGTCTAGGGAGG - Intergenic
900249130 1:1657774-1657796 CTGTATTCCTAGCTACAGGAAGG + Intronic
900260076 1:1723107-1723129 CTGTATTCCTAGCTACAGGAAGG + Intronic
900776579 1:4590270-4590292 CTGTAGTTCCAGCTATCGGGAGG - Intergenic
901071099 1:6518963-6518985 CTGTAGTCCCAGCTCTCGGGAGG - Intronic
901399848 1:9008201-9008223 CTGTAGTCACAGTTATGAGACGG + Intronic
901588257 1:10316621-10316643 CTGTAGTCCCAGCTACTAGAGGG - Intronic
901604507 1:10448795-10448817 CTGTAGTCCCAGGTACTTGGAGG + Intronic
901607859 1:10473531-10473553 CTGTAGTCCCAGCTCTTGGGAGG + Intronic
901609258 1:10484148-10484170 CTGTAATCCCAGCTACTGGAAGG - Intronic
901625202 1:10620357-10620379 CTGTAGTCCCAGCTATACTCGGG + Intronic
901724456 1:11229852-11229874 CTGTAGTCCCAGCTACTTGAGGG + Intronic
901802766 1:11718588-11718610 CTGTAGTCCCAACTATAGGAAGG - Intronic
901893233 1:12286198-12286220 CTGTAGTCCCAGCTACTCGAGGG - Intronic
901899412 1:12345979-12346001 CTGTAGTCCCAGTGGTTGGAGGG + Intronic
902046123 1:13525923-13525945 CTGTAGTCCCAGCTACCGGGAGG - Intergenic
902061388 1:13646278-13646300 CTGTAGTCCCAGCTACTGGGGGG + Intergenic
902066042 1:13688734-13688756 CTGTAGTCCCAGCTACTGGAAGG + Intergenic
902105863 1:14035590-14035612 CTGTAGTCCCAGCTACTTGAGGG - Intergenic
902140878 1:14353344-14353366 CTGTAGTCCCAGCTATTGGGAGG - Intergenic
902309671 1:15572305-15572327 CTGTAATCCCAGGCCTAGGCGGG - Intronic
902312806 1:15594577-15594599 CTGTAGTCCCAGCTATTTGGGGG + Intergenic
902519527 1:17008262-17008284 CTGTAGTCCCAGCTATTTGGAGG - Intronic
902523185 1:17034267-17034289 CTGTAGTCCCAGCTACTGGGGGG - Intronic
902590753 1:17472699-17472721 CTGTAGTCCCAGCTACATGGGGG - Intergenic
903089309 1:20896312-20896334 CTGTAGTCCCAGCTATCAGGTGG + Intronic
903110291 1:21127111-21127133 CTGTAGTCCCAGCTACTGGGTGG - Intronic
903206729 1:21787962-21787984 CTGTAATCCCAGCTATCGGGAGG + Intergenic
903237730 1:21961188-21961210 CTGTAGTCTCAGCTATTGGGAGG + Intergenic
903247773 1:22028773-22028795 CTGTAGTCCCAGCTACTGGGAGG - Intergenic
903363040 1:22789009-22789031 CTGTAATCCCAGCTTTAGGGAGG - Intronic
903442355 1:23397657-23397679 CTCTAGTCCCAGGTACAAGCAGG - Intronic
903454053 1:23474703-23474725 CTGTAGTCCCAGCTATTCGGAGG - Intronic
903501907 1:23805123-23805145 CTGTAGGCCCAGATGTAGGCAGG - Intronic
903570214 1:24298584-24298606 CTGTAGTCCCAGGCTGAGGCAGG + Intergenic
903591939 1:24463064-24463086 CTGTAATCCCAGGTACTGGGGGG + Intronic
903737485 1:25539357-25539379 CTGTAGTCCCACCTACAGGCTGG - Intergenic
903972328 1:27127121-27127143 CTGTAGTCCCAGTTACATGGGGG - Intronic
904024576 1:27494291-27494313 CTGTAGTCCCAGCTATTTGGGGG - Intergenic
904135922 1:28312586-28312608 CTGTAGTCCCAGCTATTTGGGGG - Intergenic
904150724 1:28437350-28437372 CAGTAGTCCCAGCTACTGGAGGG - Intronic
904160834 1:28520955-28520977 CTGTAGTCCCAGCACTAGGGAGG + Intronic
904394774 1:30212614-30212636 CTATAGTCCCCGTTCTAGGAGGG + Intergenic
904529484 1:31158868-31158890 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
904597983 1:31658656-31658678 CTGTAGTCCCTGGCACACGATGG - Intronic
904628186 1:31820554-31820576 CTGTAGTCCCAGTTATTGGGAGG + Intergenic
904716148 1:32469072-32469094 CTGTAGTCCTAGGTCTTGGGAGG + Intronic
904984706 1:34535512-34535534 CTGTAGTCCCAGCTATTTGGGGG - Intergenic
905268534 1:36771491-36771513 CTGTGGACCCAGGCATGGGAGGG + Intergenic
905437520 1:37967554-37967576 CTGTAGTCCCAGCTACCGGGAGG + Intronic
905575134 1:39038010-39038032 CTGTAATCCCAGCTACAGGGAGG - Intergenic
905589240 1:39147639-39147661 CTGTAGGCCCAGCTACATGAGGG - Intronic
905713882 1:40131633-40131655 CTGTAATCCCAGCTACAGGCTGG - Intergenic
905766318 1:40604571-40604593 CTGTAATCCCAGGTCAAGGCAGG - Intergenic
905788483 1:40776621-40776643 CTGGAGTCTCAGGGATTGGAGGG - Intergenic
905991756 1:42343400-42343422 CTGTAGTCCCAGCTACAAGGTGG + Intergenic
906174324 1:43757025-43757047 CTGTAGTCCCAGGTACTTGGGGG - Intronic
906230555 1:44159269-44159291 CTGTAGTCCCAGTTATCAGGAGG - Intergenic
906284778 1:44579906-44579928 CTGTAGTCCCAGCTACTGGGAGG + Intronic
906339596 1:44967322-44967344 CTGTAGTCCCAGCTACTTGAGGG + Intronic
906425950 1:45712734-45712756 CTGCAGTCCCAGCTACTGGAAGG + Intronic
906434396 1:45782531-45782553 CTGTAATCCCAGCTATATGGGGG + Intergenic
906838626 1:49111233-49111255 CTGTACTCCCAGCTATTGGGAGG - Intronic
907018750 1:51044151-51044173 CTGTAGTCCCAGCTCTTTGAAGG - Intergenic
907044085 1:51289098-51289120 CTGGAGCCCAAGGTACAGGATGG - Intronic
907078880 1:51603031-51603053 CTGTAGTCCCAGTTATAGGGTGG + Intronic
907082802 1:51639944-51639966 CTATAGTCCCAGCTACTGGAGGG - Intronic
907183042 1:52587550-52587572 CTGTAGTCCCAGGTACTCGGAGG - Intergenic
907186145 1:52610715-52610737 CTGTAGTCCCAGCTATCAGGAGG + Intergenic
907191557 1:52653336-52653358 CTGTAGTCCCAGCTACTGGGAGG + Intronic
907193858 1:52670448-52670470 CTGTAATCCCAGCTATTGGGAGG + Intergenic
907339240 1:53722709-53722731 CTGCAGTCCCAGCTACTGGAAGG + Intronic
907351257 1:53833280-53833302 CTGTAATCCCAGCTACTGGAAGG - Intronic
907717673 1:56942580-56942602 CTGTAGTCCCAGCTTTTGGGAGG + Intronic
907723236 1:56993715-56993737 CTGTAGTCCCAGCTATTTGGAGG + Intergenic
908183825 1:61632576-61632598 CTGTAGTCCCAGTTACTTGAAGG - Intergenic
908274875 1:62459976-62459998 CTGTAGTCCCAGCTACTGGGAGG + Intronic
908545927 1:65162126-65162148 CTGTAGTCCCAGCTACTGGGAGG + Intronic
908574742 1:65447653-65447675 CTGTAGTCCCAGGTACTCAAGGG - Intronic
908835698 1:68227293-68227315 CTGTAATCCCAGCTATCGGGAGG + Intronic
909124727 1:71652739-71652761 CTGTAGTCCAAGCTACATGAAGG + Intronic
909192009 1:72565379-72565401 CTGTAATCCCAGCTACTGGAGGG - Intergenic
909255135 1:73410576-73410598 CTGTAGTCCCAGCTATTTGAGGG + Intergenic
909378053 1:74962673-74962695 CTGTATTCCCAAGTATTGGGAGG - Intergenic
909389618 1:75105034-75105056 CTGCAGTCCCAGCTACTGGAAGG + Intergenic
909404144 1:75267670-75267692 CTGTAGTCCCAGCTATCAGGAGG - Intronic
909696585 1:78474245-78474267 CTGTGGTCCCAGCTACATGAGGG + Intronic
910175070 1:84420966-84420988 CTGTAGTCCCAGCTACTAGAGGG + Intergenic
910185001 1:84529697-84529719 CTGTAATTCCAGCTATCGGAAGG - Intergenic
910193144 1:84614513-84614535 CTGTATTCCAGGCTATAGGATGG + Intergenic
910195731 1:84637849-84637871 CTGTAGTCCCAGTACTAGGGAGG + Intergenic
910614636 1:89183755-89183777 CTGTAGTCCCAGCTATGTGGGGG + Exonic
910853779 1:91673533-91673555 CTGTAGTCCCAGCTACTTGAGGG + Intergenic
910924438 1:92384078-92384100 CTGTAGTCCCAGCTACAGGGAGG - Intronic
910992418 1:93069727-93069749 CTGTAGTCCCAGCTACTCGAAGG + Intergenic
911116321 1:94249627-94249649 CTGTAGTCCCAGCTCTTGGGAGG + Intronic
911342753 1:96658814-96658836 CTGTAGTCCTAGCTACTGGAAGG - Intergenic
911628765 1:100158557-100158579 CTGTAGTCCCAGCTACCGGGAGG - Intronic
911774442 1:101790164-101790186 CTCTAGACCCAGGTGTATGAGGG + Intergenic
911860325 1:102939445-102939467 CTGTAATCCCAGGTTTTGGGAGG + Intronic
912140068 1:106713808-106713830 CTGTAGTCCCAGCTATTTGGGGG - Intergenic
912183241 1:107243673-107243695 CTGTAGTCCCAGCTACTGGAAGG - Intronic
912186270 1:107279918-107279940 CTCTAGTCCCAGCTACAGGTAGG - Intronic
912349231 1:108996175-108996197 CTGTTGTCCCAGGTATGTGTGGG - Intronic
912403010 1:109411745-109411767 CTGTAGTCCCAGCTACTTGAAGG - Intronic
912551870 1:110490032-110490054 CTGTGGTCCTAGGTGTAGGCAGG + Intergenic
912835855 1:112995798-112995820 CTGTAATCCCAGCTACAGGGAGG + Intergenic
913005630 1:114628192-114628214 CTGTAGTCCCAGCTACAAGCTGG + Intronic
913249443 1:116900316-116900338 CTGTAGTCCCAGCTACATGGGGG - Intergenic
913298394 1:117344445-117344467 CTGTAGTCCCAGGTACTTGGGGG + Intergenic
914005355 1:143728263-143728285 CTGTAGTCCCAGCTACTGGTAGG + Intergenic
914097835 1:144559513-144559535 CTGTAGTCCCAGCTACTGGTAGG + Intergenic
914692133 1:150039497-150039519 CTGTAGTCCCAGCTACTGGGAGG - Intergenic
914708744 1:150193793-150193815 CTGTAGTCCCAGCTACTGGGAGG - Intergenic
914719739 1:150280099-150280121 CTGCAGTCCCAGCTATTGGGGGG + Intronic
914727300 1:150338635-150338657 CTGTAGTCCCAGCTACTTGAGGG - Intronic
914761407 1:150601786-150601808 TTGTAGTCCCAGCTACAGGGAGG - Intronic
914774759 1:150726523-150726545 CTCTAGTCCCAGCTACTGGAGGG + Intergenic
914777665 1:150752974-150752996 CTGTAGTCCCAGCTACTTGAGGG - Intronic
914795927 1:150920312-150920334 CTGTAGTCCCAGCTATCAGGAGG + Intergenic
915132073 1:153702405-153702427 CTGTAGTCCCAGCTACTCGAGGG - Intergenic
915257535 1:154645925-154645947 CTGTAGTCCCAGCTATTTGGAGG - Intergenic
915959308 1:160251593-160251615 CTGTAGTCCCAGCTACTGGAGGG - Intronic
916067746 1:161150201-161150223 CTGTAGTCCCAGCTACCGGGAGG - Intergenic
916093147 1:161325083-161325105 CTATAGTCCCAGCTATGGGGAGG + Intronic
916557569 1:165906487-165906509 CTGTAGTCCCAGCTACCGGGAGG - Intronic
917174195 1:172213704-172213726 CTGTAATCCCAGCTATCGGGAGG + Intronic
917296210 1:173522103-173522125 CTGTAGTCCCAGCTACAGGCTGG + Intronic
917521559 1:175752121-175752143 CTGTAGTCCCAGCTACAGGTGGG + Intergenic
918872719 1:189997290-189997312 CTGTAGTCCCAGCTACTCGAGGG + Intergenic
918890716 1:190263709-190263731 CTGTAGTCCCAGCTACTGGGAGG - Intronic
919238204 1:194873961-194873983 CTGTAGTCCCAGCTACTGGGAGG - Intergenic
919908509 1:202095140-202095162 CTGTGGTCCCAGCTACTGGAGGG + Intergenic
920067007 1:203276261-203276283 CTGTAGTCCCAGCTACCGGGAGG + Intergenic
920322594 1:205136003-205136025 CTGTGGTCCCAGCTACAGGGAGG - Intergenic
920325371 1:205159210-205159232 CTGTAGTCCCAGCTACTTGAGGG - Intronic
920506226 1:206517350-206517372 CTGTAGTCCCAGCTACATGCTGG + Intronic
920568603 1:206998166-206998188 CTGTAGTCCCAGCTATTCGGAGG - Intergenic
921115438 1:212086510-212086532 CTGTAGTCCCAGCTATTGGGAGG - Intronic
921700494 1:218263596-218263618 CTGTAGTCCCAGCTACTGGGGGG + Intergenic
921859388 1:220025915-220025937 CTGTAGTCCCAGCTATTTGGGGG - Intronic
921911133 1:220550473-220550495 CTGTAGTCCCAGCTACTTGAGGG - Intronic
922138859 1:222860760-222860782 CTGTAGTCCCAGCTACCTGAGGG + Intergenic
922230383 1:223680568-223680590 CTGTAATCCCAGCTATTGGGAGG - Intergenic
922846186 1:228686860-228686882 CTGTAATCCCAGCTATTGGGAGG - Intergenic
922895977 1:229100732-229100754 CTGTAATTCCAGCTACAGGAAGG - Intergenic
923193869 1:231645450-231645472 CTGATGTCCCAGGGTTAGGAGGG + Intronic
923599849 1:235392892-235392914 CTGTAGTCCCAGCTACTGGGAGG + Intronic
923609234 1:235475118-235475140 CTGTAGTCCCAGCTACCAGAAGG - Intronic
923634553 1:235682186-235682208 CTGTAGCCCCAGCTATTGGTAGG + Intronic
924148964 1:241108179-241108201 CTGTAATCCCAGCTATCGGGAGG + Intronic
924292222 1:242548187-242548209 CTGTAGTCCCAGCTATTTGGGGG + Intergenic
924430018 1:243988780-243988802 CTGGAGTCCTAGCTATAGGGAGG - Intergenic
924440101 1:244078813-244078835 CTGTAATCCCAGCTACTGGAGGG - Intergenic
924515831 1:244765272-244765294 CTGTAGTCCCAGATAATTGAGGG - Intergenic
924573894 1:245261704-245261726 CTGTAGTCCTAGCTATAGAGAGG - Intronic
924763653 1:247011506-247011528 CTGTAATCCCATCTATAGGGAGG + Intergenic
924778086 1:247124918-247124940 CTGTAGTCCCAGCTATTGGGAGG - Intronic
1063252980 10:4294576-4294598 CTGTAGTCCCAGGTACTTGGAGG + Intergenic
1063293557 10:4777484-4777506 CTGTAGTCCCAGCTATAGCCTGG - Intergenic
1063400163 10:5736059-5736081 TTGTAGTCCCAGCTATTTGAGGG - Intronic
1063424582 10:5941407-5941429 CTGTAGTCCCAGCTACTTGAGGG - Intronic
1063477686 10:6343217-6343239 ATGGAGTGCCAGGTGTAGGAGGG + Intergenic
1063712731 10:8495299-8495321 CTGTAGTCCCAGCTACTTGAGGG - Intergenic
1063771287 10:9205003-9205025 CTGTAATCCCAGCTATAGGGAGG + Intergenic
1064019098 10:11795024-11795046 CTGTATTCCCAGCTACAGGCTGG - Intergenic
1064019725 10:11799385-11799407 CTGTAGTCCCAGCTACAGGGAGG - Intergenic
1064031926 10:11888022-11888044 CTGCAGTCCCAGCTACAGGTGGG + Intergenic
1064045556 10:12011473-12011495 CTGTAGTCCCAGTTATTGCTTGG + Intronic
1064069055 10:12209685-12209707 CTGTAGTCCCAGCTATTTGGGGG - Intronic
1064100152 10:12456653-12456675 CTGTTGTCCCAGGTTGAGGCGGG + Intronic
1064134927 10:12742255-12742277 CTGTAGTCCCAGCTACTTGAGGG - Intronic
1064200484 10:13280457-13280479 CTGTAGTCCCAGCTACTCGAAGG - Intronic
1064201874 10:13291599-13291621 TTGTAGTCCCTGCTATTGGAAGG - Intronic
1064394358 10:14969324-14969346 CTGTAGTCCCAGCTACTGGGAGG + Intronic
1064642613 10:17429605-17429627 CTGTAGTCCCAGGTATTCTCAGG - Intronic
1064805260 10:19122991-19123013 CTGTAATCCCAGGCATGGGCTGG - Intronic
1065003940 10:21362469-21362491 CTGTAGTCCCAGCTACTGGGAGG - Intergenic
1065246226 10:23760991-23761013 CTGTAGTTCCAGCTACAGGGAGG + Intronic
1065248961 10:23790855-23790877 CTGTAGTCCCAGCTATTGGGGGG - Intronic
1065566575 10:27017069-27017091 CTGTAGTCCCAGCTATCCAAAGG + Intronic
1065850992 10:29788767-29788789 CTATAGTCCCAGGTACTGGGAGG + Intergenic
1065859859 10:29863463-29863485 CTGTAGTGCCAGCTGAAGGAGGG - Intergenic
1066097215 10:32083880-32083902 CTGTAGTCCCAGCTATTGGGAGG - Intergenic
1066161632 10:32738594-32738616 CTGTAGTCCCAGGTACTTGGAGG - Intronic
1066362540 10:34745238-34745260 CTGTAGTCCCAGATATTCGGAGG + Intronic
1066434172 10:35381436-35381458 CTGTAATCCCAGCTACTGGAGGG + Intronic
1066549891 10:36544796-36544818 CTGTAGTCCCAGCTACTGGGAGG - Intergenic
1067398559 10:45948602-45948624 CTGTAGTCTCAGCTACATGAGGG + Intergenic
1067494917 10:46753316-46753338 CTGTAGTCCCAGCTAATGGGGGG - Intergenic
1067599737 10:47587080-47587102 CTGTAGTCCCAGCTAATGGGGGG + Intergenic
1067843031 10:49697068-49697090 CTGTAGTCCCAGCTACTTGAGGG + Intronic
1067845251 10:49714813-49714835 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
1068707799 10:60096049-60096071 CTGTAATCCCAGCTATCGGGAGG + Intronic
1068990019 10:63140534-63140556 CTGTAGTCCCAGCTACAGGAGGG - Intronic
1068994203 10:63184047-63184069 CTGTAGTCCCAGCTATCAGGAGG - Intronic
1069032202 10:63609327-63609349 CTGTAGTCCCAGCTACTGGAGGG + Intronic
1069033794 10:63627414-63627436 CTGTAGTCCCAGCTATTTGCGGG + Intergenic
1069278646 10:66625509-66625531 CTGTAGTCCCAGCTACTTGAGGG - Intronic
1069320216 10:67160557-67160579 CTGTGGTCCCAGCTCTAGGGAGG - Intronic
1069442563 10:68442035-68442057 CTGTAGTCCCAGGATGAGGTGGG - Intronic
1069449138 10:68502071-68502093 CTGTAATCCCAGCTACTGGAGGG + Intronic
1069460635 10:68591778-68591800 CTGTAGTCCCAGCTACTGGCTGG + Intronic
1069975422 10:72209040-72209062 CTGTAGTCCCAGCTATTTGGGGG + Intronic
1070048552 10:72863736-72863758 CTGTAATCCCAGTTACAGGGAGG - Intronic
1070049255 10:72871020-72871042 CTGTAGTCCCAGCTATCGGGAGG - Intronic
1070108670 10:73461322-73461344 CTGTAGTCCCAGCTATTTGGGGG + Intronic
1070650984 10:78236261-78236283 CTGTAATCCCAGCTATTGGGAGG + Intergenic
1070993371 10:80752676-80752698 CTGTAGTCCCAGCTATTTGGGGG - Intergenic
1071050141 10:81437471-81437493 CTGTAGTCCCAGCTACTCGAGGG + Intergenic
1071415635 10:85438408-85438430 CTATAGTCACAGATATAGTAAGG - Intergenic
1071614623 10:87063998-87064020 CTGTAGTCCCAGCTATCGGGAGG - Intronic
1071651271 10:87394966-87394988 CTGTAGTCCCAGCTAATGGGGGG + Intergenic
1071927366 10:90425778-90425800 CTGTAGTCCCAGCTACTCGAGGG - Intergenic
1072055200 10:91748249-91748271 CTGTAGTCCCAGCTACTTGAGGG - Intergenic
1072066009 10:91872370-91872392 CTGTAGTCCCAGCTACCGGGAGG + Intergenic
1072092020 10:92137876-92137898 CTGTAGTCCCAGCTACTGGGAGG + Intronic
1072111468 10:92324482-92324504 CTGTAGTCCCAGCTATTCGGGGG - Intronic
1072611472 10:97020091-97020113 CTGTAGTCCCAGCTACTGGGTGG - Intronic
1072647113 10:97265375-97265397 CTGTAGTCCCAGCTAGTGGGAGG + Intronic
1072805362 10:98420591-98420613 CTGTAGTCCCAGCTATTTGGGGG + Intronic
1073161711 10:101403711-101403733 CTGTAGTCCCAGCTACTTGAGGG - Intronic
1073278903 10:102337253-102337275 CTGTAGTCCCAGGTACTCGGGGG + Intronic
1073313619 10:102562399-102562421 CTGTAGTCCCAGCTATCGGGAGG + Intronic
1073861035 10:107740811-107740833 CTGTAGTCCCAGCTATGTGGAGG + Intergenic
1074064786 10:110004409-110004431 CTGTAGTCCCAGGCTGAGGCAGG + Intronic
1074381042 10:112980747-112980769 CTGTAGTCCCAGCTACTGGGAGG - Intronic
1074526477 10:114267552-114267574 CTGTAATCCCAGCTATCGGGAGG - Intronic
1074779848 10:116794078-116794100 CTGTAGTCCCAGCTATACTCGGG + Intergenic
1074802050 10:117009779-117009801 CTGTAGTCCCAGCTACTGGGAGG + Intronic
1075207976 10:120463147-120463169 CTGTAGTCCCAGCTACTGGGAGG - Intronic
1075262585 10:120976071-120976093 CTGTGGTCCCAGGAAACGGAAGG - Intergenic
1075332232 10:121582052-121582074 CTGTAGTCCCAGGTACTTGGGGG - Intronic
1075749192 10:124751241-124751263 CTGTAGTCCCAGCTACCGGGAGG - Intronic
1076106155 10:127825267-127825289 CTGTAGTCCCAGGTACTGGGGGG + Intergenic
1076386494 10:130060699-130060721 CTGCAGTCCCAGCTATCGGGAGG + Intergenic
1076656595 10:132028202-132028224 CTGTAGTCCCAGGTACTCGGAGG - Intergenic
1077068467 11:655952-655974 CTGTAGTCCCAGCTGTGGGGAGG - Intronic
1077450540 11:2640406-2640428 CTGTAGTCCCAGCTACTTGAGGG - Intronic
1077628342 11:3793408-3793430 CTGTAGTCCCAGCTACTGGGAGG - Intronic
1077730709 11:4726338-4726360 CTGTAGTCCCAGCTACTCGAAGG + Intronic
1078129589 11:8602331-8602353 CTGTAGTCCCAGGCTGAGGCAGG - Intergenic
1078233410 11:9462439-9462461 CTGTAGTCCCAGGTACTTGGAGG + Intronic
1078401499 11:11031658-11031680 CTGTAGTCCCAGCTAGTGGGAGG + Intergenic
1078701788 11:13692043-13692065 CTGTAGTCCCAGCTACTCGAAGG + Intronic
1079011572 11:16832901-16832923 CTGCAGTCTCAGGAATAGGGTGG + Intronic
1079066942 11:17302859-17302881 CTGTAGTCCCAGCTACTGGGAGG - Intronic
1079231853 11:18655970-18655992 CTGTAGTCCCAGCAATCGGGAGG - Intergenic
1079503759 11:21131957-21131979 CTGGAGACACAGGTACAGGATGG + Intronic
1079543150 11:21600013-21600035 CTGCAGTCCCAGCTACAGGGAGG - Intergenic
1079578413 11:22031429-22031451 CTGTAATCCCAGCTACTGGAGGG - Intergenic
1079635859 11:22739449-22739471 CTGTTGTCCCAGCTATCGGGAGG + Intronic
1079972243 11:27049505-27049527 CTGTAATCCCAGCTATTTGAGGG - Intronic
1080223335 11:29932714-29932736 CTGTAGTCCCAGCTACAGGGAGG - Intergenic
1080449959 11:32370597-32370619 CTGTAGTCCCAGCTACCGGGAGG - Intergenic
1080516508 11:33026723-33026745 CTGTAGTCCCAGCTACTGGGAGG - Intronic
1080523713 11:33091834-33091856 CTGTAGTCCCAGATACTGGGAGG - Intronic
1080526224 11:33122791-33122813 CTGTAGTCCCAGCTACTTGAGGG + Intronic
1080536049 11:33222792-33222814 CTGTAGTCCCAGCTCTCGGGGGG + Intergenic
1080884703 11:36356032-36356054 CTGTAGTCCCAGCTACTTGAAGG - Intronic
1080949709 11:37017597-37017619 CTGTAGTCCCAGCTACTGGGTGG - Intergenic
1081508714 11:43745772-43745794 CTGTAATCCCAGCTTTTGGAAGG + Intronic
1081927592 11:46843606-46843628 CTGTAGTCCCAGCTACCGGAAGG + Intronic
1082039665 11:47674442-47674464 CTGTAGTCCCAGCTACTTGAGGG + Intronic
1082040538 11:47681207-47681229 CTATAGTCCCAGCTACACGACGG + Intronic
1082051955 11:47777632-47777654 CTGTAGTCCCAGCTACTAGAGGG - Intergenic
1082696204 11:56367749-56367771 CTGTAGTCCCAGGTACTCGGAGG + Intergenic
1082727521 11:56754173-56754195 CTGTAGTCCCAGCTACATGGGGG - Intergenic
1082865918 11:57900088-57900110 CTGTAGTCCCAGCTACTGAAAGG + Intergenic
1083039374 11:59670715-59670737 CTGTAGTCCCAGCTACTCGAGGG + Intergenic
1083097604 11:60267558-60267580 CAGTAGTCCCAGAGAGAGGATGG + Intergenic
1083203857 11:61135675-61135697 CTGTAGTCCCAGCTATTGGAAGG - Intronic
1083259189 11:61514039-61514061 CGGTGGTCCCAGGTACAGGGAGG + Intergenic
1083407334 11:62467079-62467101 CTGTAGTCCCAGCTACTTGAGGG + Intronic
1083800141 11:65041752-65041774 CTGCAGGCCCAGGTGCAGGAGGG + Exonic
1083873460 11:65506896-65506918 CTGTAGTCCCAGCTACAGGGAGG - Intergenic
1083957839 11:65995883-65995905 CTGTAGTCCCAGCTATGGAGAGG + Intergenic
1084620699 11:70268656-70268678 CTGTAGTCCCAGGTACTTGGGGG - Intergenic
1084725915 11:70941934-70941956 CTGTAATCCCAGCTATTTGAGGG + Intronic
1085065572 11:73492517-73492539 CTGTAGTCCCAGCTACACGGGGG + Intronic
1085106583 11:73848942-73848964 CTGTAGTCCCAGCTATTCCAGGG - Intronic
1085356663 11:75844347-75844369 CTGTAGTCCCAGCTACTGGGAGG - Intronic
1085367232 11:75960642-75960664 CTGTAGTCCCAGCTATTTGGGGG + Intronic
1085567221 11:77525224-77525246 CTGTAGTCCCAGGTACTAGGAGG + Intronic
1086092315 11:83017214-83017236 CTGTAGTCCCAGCTACTAGAGGG + Intronic
1086467977 11:87075087-87075109 CTGTAGTCCCAGCTACTGGTCGG - Intronic
1086579293 11:88378838-88378860 CTGTAGTCCCAGCTACTGGAGGG + Intergenic
1087228924 11:95637648-95637670 CTGTAGTCCCAGCTACTGGGAGG - Intergenic
1087469723 11:98557083-98557105 CTGTAGTTCCAGCTACTGGACGG + Intergenic
1087758639 11:102081767-102081789 CTGTAGTCCCAGCTTTGGGGAGG + Intronic
1087769447 11:102191791-102191813 CTGTAGTCCCAGCTACAGGCGGG - Intronic
1087783817 11:102331761-102331783 CTGTAATCCCAGCTAAGGGAAGG - Intronic
1088101029 11:106155852-106155874 CTGTAATCCCAGTTACTGGAGGG - Intergenic
1088167176 11:106952760-106952782 CTGTAGTCCCAGATATTGGGAGG - Intronic
1088333621 11:108678979-108679001 CTGTAGTCCCAGCTATCGGGAGG - Intronic
1088588983 11:111386040-111386062 CTGTAGTCCCAGCTACTTGAAGG + Intronic
1088684663 11:112274662-112274684 CTATAGTCCCAGCTATAGGGAGG - Intergenic
1088863753 11:113826430-113826452 CTGTAGTCCCAGGTACTTGGTGG - Intronic
1089250426 11:117156064-117156086 CTGTAGTCCCAGCTACTGGGGGG + Intronic
1089266923 11:117270568-117270590 CTGTAGTCCCAGCTACCGGGGGG - Intronic
1089278697 11:117357227-117357249 CTGTAATCCCAGCTATTTGAGGG - Intronic
1089363267 11:117905015-117905037 CTGTAGTCCCAGCTATGAGAGGG - Intronic
1089685296 11:120142842-120142864 CTGTAGTCCCAGGCACTGGGAGG - Intronic
1089844877 11:121450942-121450964 TGGTAGTCCTAGGTAGAGGAGGG + Intergenic
1090080937 11:123612186-123612208 CTGTAGTCCCAGCTAATGGGAGG - Intronic
1090275994 11:125420062-125420084 CTGTAGTCCCAGCTATTTGTGGG + Intronic
1090428364 11:126626141-126626163 CTATAGTCCTGGGTCTAGGAGGG + Intronic
1090674104 11:128973088-128973110 CTGTTGTCTCTGGTAGAGGATGG + Exonic
1090705153 11:129329554-129329576 CTGTAGTCCCAGCTACTTGAAGG - Intergenic
1090784362 11:130036224-130036246 CTGTAGTCCCAGCTATCAGGGGG + Intergenic
1090822166 11:130352782-130352804 CTGTAGTCCCAGATACTGGGAGG - Intergenic
1091257338 11:134201144-134201166 CTGTAGTCCCAGCTATGAGGAGG - Intronic
1091401487 12:183433-183455 CTGTAATCCCAGCTATTCGAAGG + Intergenic
1091566761 12:1654519-1654541 CTGTAGTCCCAGCTACTGGCCGG + Intergenic
1091728237 12:2860360-2860382 CTGTAGTTCCAGCTACAGGTGGG + Intronic
1091924827 12:4337286-4337308 CTGTAATCCCAGCTATTGGGAGG - Intronic
1092511523 12:9162082-9162104 CTGTAGTCCCAGCTACATGGGGG - Intronic
1092605877 12:10118078-10118100 CTGTAGTCCCAGCTACTTGAGGG + Intronic
1092819737 12:12342063-12342085 ATGTAGTCCCAGCTATTGGGAGG - Intronic
1093432292 12:19097858-19097880 CTGTTGTCCCAGCTCTTGGAAGG - Intergenic
1093764474 12:22947098-22947120 CTGTGGTAACAGGTATGGGAAGG + Intergenic
1093888259 12:24488460-24488482 CTGTAGTCCCAGCTACTTGAGGG + Intergenic
1093913055 12:24769028-24769050 CTGTAATCCCAGCTATCGGGAGG + Intergenic
1093930824 12:24953706-24953728 CTGTAGTCCCAGCTACCGGGAGG + Intergenic
1093947013 12:25120601-25120623 CTGTAGTCCCAGCTACCGGGAGG + Intronic
1094137136 12:27139627-27139649 CTGTAGTCCCAGCTACTCGAGGG - Intergenic
1094518003 12:31153340-31153362 CTGTGGTCCCAGCTACAGGGAGG - Intergenic
1094552657 12:31467515-31467537 CTGTAGTCCCAGCTATCAGGAGG + Intronic
1094674646 12:32607635-32607657 CTGTAGTCCCAGCTATGCGGAGG - Intronic
1094734246 12:33215827-33215849 CTGTAGTCCCAGCTACCGGGAGG - Intergenic
1094820483 12:34220298-34220320 CTTTAGTCCCAGGTACTCGAGGG - Intergenic
1095411644 12:41931805-41931827 CTGCAGTCCCAGCTACCGGAAGG + Intergenic
1095420002 12:42015617-42015639 CTGTAATCCCAGCTACAGGGGGG - Intergenic
1095580655 12:43793107-43793129 CTGTAGTCCCAGCTACAGGCTGG - Intergenic
1095811679 12:46378667-46378689 CTGTAATCCCAGCTGTAGGGAGG - Intergenic
1096003882 12:48152878-48152900 CTGTAGTCCCAGCTACTTGAGGG + Intronic
1096046977 12:48570852-48570874 CTGTAGTCCCAGCTACTTGAGGG + Intergenic
1096086968 12:48871847-48871869 CTGTAGTCTCAGCTACTGGAAGG + Intergenic
1096170686 12:49467169-49467191 CTGTAGTCCCAGCTATCGGGAGG - Intronic
1096170870 12:49468597-49468619 CTGTAGTCCCAGCTACTTGAGGG - Intronic
1096296202 12:50386304-50386326 CTGTAATCCCAGCTATAGGGAGG + Intronic
1096298717 12:50406839-50406861 CTGTAGTCCCAGCTATACTGGGG - Intronic
1096364646 12:51018270-51018292 CTGTAATCCCAGCTATTGGGAGG + Intronic
1096406699 12:51349007-51349029 CTGTAGTCCCAGCTACTTGAGGG - Intergenic
1096419549 12:51445289-51445311 CTGTAGTCCCAGCTATTGGGAGG - Intronic
1096502435 12:52072893-52072915 CTGTAGTCCCAGTTACTTGAGGG - Intronic
1096590214 12:52653290-52653312 CTGTGGTCCCAGCTATAAAATGG + Intergenic
1096671013 12:53198249-53198271 CTGTAGTCCCAGCTACCGGGAGG - Intronic
1096699007 12:53369985-53370007 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
1096887163 12:54729577-54729599 CTGTAGTCCCAGCTATGTGGAGG + Intergenic
1096991640 12:55809081-55809103 CTGTAGTCCCAGCTACTTGAGGG + Intronic
1097022600 12:56031127-56031149 CTGTAGTCCCAGCTACTGGGAGG + Intronic
1097092584 12:56519039-56519061 CTGTAGTCCCAGCTACAGGGTGG + Intergenic
1097112720 12:56673838-56673860 CTGTAGTCCCAGATACTTGAGGG + Intronic
1097546576 12:61009902-61009924 CTGTAGTCCCAGGTACTTGGGGG + Intergenic
1097630758 12:62059193-62059215 CTGTAGTCCCAGCTATCAGAGGG + Intronic
1097737212 12:63195237-63195259 CTGTAGTCCCAGCTCTCGGGAGG + Intergenic
1097998997 12:65921369-65921391 CTGTAGTCCCAGGCTGAGGCAGG - Intronic
1098089875 12:66890049-66890071 CTGTAGTCCCAGCTATTGGGAGG - Intergenic
1098234883 12:68408803-68408825 CTGTAGTCCCAGCTATTCGGGGG + Intergenic
1099010861 12:77289478-77289500 CTGTAGTCCCAGTTACTCGAGGG + Intergenic
1099013518 12:77319866-77319888 CTGTAGTCCCAGCTACTCGAGGG - Intergenic
1099150196 12:79101782-79101804 CTGTAGTCCCAGCTACTCGAGGG + Intronic
1099714862 12:86278299-86278321 CTGTAATCCCAGCTATTTGAGGG - Intronic
1100188159 12:92159968-92159990 CTGTAGTCCCAGCTACTTGAGGG - Intergenic
1100369250 12:93951028-93951050 CTGTAGTCTCAGGTACTTGAAGG + Intergenic
1100431888 12:94538104-94538126 CTGTAATCCCAGGTACTTGAGGG + Intergenic
1100534007 12:95488732-95488754 CTGTATTCCCATGTATATAATGG + Intronic
1100544325 12:95586827-95586849 CTGTAATCCCAGCTATTGGGAGG + Intergenic
1100545254 12:95596278-95596300 CTGTAATCCCAGCTATTGGGAGG - Intergenic
1100625531 12:96327670-96327692 CTGTAGTCCCAGCTATGGTGGGG - Intronic
1100924040 12:99523673-99523695 CTGTGGTCCCAGCTATTGGGAGG - Intronic
1100942029 12:99734232-99734254 CTGTAGAACAAGGTATGGGAAGG - Intronic
1100998638 12:100331482-100331504 CTGTAGTCCCAGCTACCAGAGGG + Intronic
1101034752 12:100694453-100694475 CTGTAGTCCCAGCTACTTGAGGG - Intergenic
1101094782 12:101326844-101326866 CTGTAGTCCCAGCTACCTGAGGG - Intronic
1101115327 12:101525810-101525832 CTGTAATCCCAGCTACAGGGAGG + Intergenic
1101746470 12:107545364-107545386 CTGTAGTCCCAGCTACTTGAGGG - Intronic
1101907105 12:108835316-108835338 CTGTAATCCCAGCTATTGGGAGG + Intronic
1101960146 12:109242841-109242863 CTGTAGTCCCAGCTACTTGAAGG + Intronic
1102144949 12:110648091-110648113 CTGTAGTCCCAGCTATTAGGAGG - Intronic
1102226190 12:111229889-111229911 CTGTAGTCCCAGGTACTAGGGGG + Intronic
1102273684 12:111562308-111562330 CTGTAGTCCCAGCTACAGATGGG + Intronic
1102285009 12:111648802-111648824 CTGTAGTCCCAGCTATTGGGAGG + Intronic
1102631509 12:114284893-114284915 CTGTAGTCCCAGCTATTTGAGGG - Intergenic
1102808060 12:115799527-115799549 CTGTAGTCCCAGCTATTTGGGGG + Intergenic
1102915139 12:116746931-116746953 CTGAAGTCCCTGGTATAAAATGG + Intronic
1102941636 12:116947615-116947637 CTGTAGTCCCAGCTACTGGGAGG + Intronic
1102990644 12:117313415-117313437 CTGTAGTCCCAGCTACTGGAGGG - Intronic
1103134600 12:118496921-118496943 CTGTAGTCCCAGCTACATGGAGG + Intergenic
1103383696 12:120514913-120514935 CTGTAATCCCAGCTATTTGAAGG - Intronic
1103435954 12:120925569-120925591 CTGCAGTCCCATCTATGGGAAGG + Intergenic
1103799051 12:123525337-123525359 CTGTAGTCCCAGCTACTGGGAGG - Intronic
1103829889 12:123770340-123770362 CTATAGTCCCAGCTACAGGGTGG - Intronic
1103849424 12:123922248-123922270 CTGTAGTCCCAGCTACTGGGGGG + Intronic
1104011378 12:124932790-124932812 CTGTAATCCCAGCTATCGGGAGG + Intergenic
1104309938 12:127645529-127645551 CTGTCATTCCAGGTACAGGATGG - Intergenic
1104326794 12:127806293-127806315 CTGTAGTCCCAGCTACTTGAGGG + Intergenic
1104678679 12:130733349-130733371 CTGTAGTCCCAGCTACTGGAGGG + Intergenic
1105009926 12:132748809-132748831 CTGTAGTCCCAGCTACTTGAGGG - Intronic
1105057152 12:133112441-133112463 CTGTAGTCCCAGCTACTGGGAGG - Exonic
1105301731 13:19141434-19141456 CTGTAGTCCCAGATATTTGGAGG + Intergenic
1105838588 13:24232669-24232691 CTGTAGTCCCAGCTACTGGGTGG - Intronic
1105866587 13:24466302-24466324 CTGTAGTCCCAGCTACTTGAGGG - Intronic
1106127196 13:26910246-26910268 CTGTAGTCCCAGCTATGTGGGGG + Intergenic
1106192008 13:27461883-27461905 CTGTAGTTCCAGCTATCGGGAGG - Intergenic
1106202419 13:27551163-27551185 CTGTAGTCCCAGTTACTGGGAGG + Intronic
1106247078 13:27959856-27959878 CTGTAATCCCAGCTATCGGGAGG - Intergenic
1106789697 13:33142148-33142170 CTGTAGTCCCAGCTATCGAGAGG - Intronic
1107031906 13:35861908-35861930 CTGTAGTCCCAGCTACTCGAAGG + Intronic
1107121834 13:36804558-36804580 CTGTAGTCCCAGGCTGAGGTGGG - Intergenic
1107452692 13:40525416-40525438 CTGTGGTCCCAGCTACACGAGGG + Intergenic
1107855637 13:44612955-44612977 CTGTAGTCCCAGTTACTTGAGGG - Intergenic
1108035469 13:46285943-46285965 CTGTAGTCCCAGATATTTGTGGG + Intergenic
1108352702 13:49601776-49601798 CTGTAGTCCCAGCTATCGGGAGG - Intergenic
1108699903 13:52934758-52934780 CTGTAATCCCAGCTACTGGAAGG + Intergenic
1108729781 13:53222870-53222892 CTGTTGTCTCTGATATAGGATGG + Intergenic
1108890367 13:55250992-55251014 CTGTAGTCCCAGCTAGTGGGAGG + Intergenic
1109043401 13:57373550-57373572 CTGCAGTCCCAGCTACAGGTAGG - Intergenic
1109233359 13:59785962-59785984 CTGTACTCCTAAGTATAAGATGG - Intronic
1109801909 13:67390910-67390932 CTGTAATCCCAGCTATTTGAGGG - Intergenic
1110903861 13:80860875-80860897 CTGTAGTCCCAGCTACTGGGAGG - Intergenic
1110985759 13:81965844-81965866 CTGTAGTCCCAGACACAGGGAGG - Intergenic
1111124614 13:83898218-83898240 CTGTAATCCCAGCTATTGGGAGG - Intergenic
1111507153 13:89207234-89207256 CTGTAGTCCCAGCTACTTGAGGG - Intergenic
1111580907 13:90222473-90222495 CTGTAGTCCCAGCTACGGGCGGG + Intergenic
1112781979 13:102910883-102910905 CTGTAGTCCCAACTATTGGGAGG + Intergenic
1113181339 13:107631117-107631139 CTGTAGTCCCAGCTACTGGGAGG - Intronic
1113228100 13:108180829-108180851 CTGGAGACCCAGGTATCGGCTGG - Intergenic
1113393107 13:109916714-109916736 CTGTGGTCCCAGCTACCGGAAGG - Intergenic
1113502758 13:110790765-110790787 CTGTAGTCCCAGCTACTGGGAGG - Intergenic
1113827167 13:113265291-113265313 CTGTAGTCCCAGCTATGGGAGGG + Intronic
1114235634 14:20821103-20821125 CTGTAATCCCAGGTCCAGGGAGG + Intergenic
1114311471 14:21471493-21471515 CTGTAGTCCCAGCTACTTGAGGG + Intronic
1114541560 14:23464074-23464096 CTGTAGTCCCAGCTATTGGGAGG - Intergenic
1114552350 14:23540111-23540133 CTGTAGTCCCAGCTACTGGGAGG - Intronic
1115233880 14:31189637-31189659 CTATAGTCCCAGCTACCGGATGG + Intronic
1115669173 14:35589820-35589842 CTGTAGTCCCAGCTATTTGGAGG - Intronic
1115704439 14:35984355-35984377 CTTGAGTGCCAGGTATAGGAAGG + Intergenic
1115976932 14:39007082-39007104 CTGTAGTCCCAGTTACTGGGAGG - Intergenic
1116614650 14:47119186-47119208 CTGTAGTCCCAGCTACGGGGTGG - Intronic
1116674532 14:47888436-47888458 CTGTAGTCCCAGGTATTCAGGGG + Intergenic
1116803710 14:49470123-49470145 CTGTAGTCCCAGCTATCTGGGGG + Intergenic
1116874906 14:50101318-50101340 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
1116886162 14:50223720-50223742 CTGTAGTCCCAGCTATATGGGGG + Intronic
1117114276 14:52493901-52493923 CTGTAGTCCCAGCTATTTGGTGG - Intronic
1117265371 14:54080759-54080781 ATGTAGCCCTAGGTATAAGATGG + Intergenic
1117345657 14:54829568-54829590 CTGTAGTCCCAGCTATGTGGAGG - Intergenic
1117392370 14:55273926-55273948 CGGTAGTCCCAGCTATTCGAGGG - Intronic
1117394119 14:55291839-55291861 CTGTAGTCCCAGCTATGTGGGGG + Intronic
1117413554 14:55472550-55472572 CTGTGGTCCCAGCTACAGGTGGG - Intergenic
1117423827 14:55575099-55575121 CTGTAGTCCCAGCTATTTGAGGG + Intronic
1117459467 14:55930631-55930653 CTGTAGTCCCAGCTACTGGGAGG - Intergenic
1117553653 14:56862207-56862229 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
1117695527 14:58358343-58358365 CTGTAATCCCAGATATTGGGAGG + Intronic
1117766195 14:59085812-59085834 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
1117800974 14:59444681-59444703 CTGTAGTCCCAGCTACTGGGGGG + Intronic
1117863031 14:60113057-60113079 CTGTAGTCCCAGCTACTGGGGGG + Intronic
1118197164 14:63638065-63638087 CTGTAGTCCCAGCTACTGGGGGG - Intronic
1118584134 14:67335979-67336001 CTGTTGGCACAGGTATAGGTAGG + Intronic
1118658467 14:67980320-67980342 CTGTAATCCCAGTTATGGGAAGG + Intronic
1118672932 14:68149865-68149887 TTGTAGTCCCAGCTATTGGGAGG - Intronic
1118830046 14:69422342-69422364 CTGTTGTCCCAGATATGGGGAGG - Intronic
1118872327 14:69753708-69753730 CTGTAGTCCCAGCTACAGGGGGG - Intronic
1118948382 14:70410299-70410321 CTGTAGTCCCAGCTACTTGAGGG + Intronic
1119038578 14:71251723-71251745 CTGTAGTCCCAGCTACAGGGAGG + Intergenic
1119112455 14:71987640-71987662 CTGTAGTCCCAGCTATGGGAAGG - Intronic
1119241907 14:73067525-73067547 CTGTAGTCCCAGCTCTTGGGAGG - Intronic
1119307955 14:73623029-73623051 CTGTATTCCCAGCTACAGGGAGG - Intergenic
1119452535 14:74724405-74724427 CTGTAGTCCCAGCTACTTGAGGG - Intronic
1119598698 14:75959510-75959532 CTGTAGTCCCAGGACTTGGGAGG + Intronic
1119797313 14:77410484-77410506 CTGTAATCCCAGGTATGTGAGGG + Intronic
1120207793 14:81604675-81604697 CTGTAGTCCCAGCTACTGGGGGG + Intergenic
1120456388 14:84736104-84736126 CTGTAGTCCCAGCTATGAGGGGG + Intergenic
1120527176 14:85590718-85590740 CTGTAGTCCCAGCTATCGGGAGG - Intronic
1120583052 14:86278036-86278058 CTGTAATCCCAGCTATTGCAGGG + Intergenic
1120787028 14:88547529-88547551 CTGTAGTCCCAGCTCTTGGCAGG + Intronic
1120931809 14:89856309-89856331 CTGTAGTCCCAGTTATTTGGGGG - Intronic
1120960741 14:90122460-90122482 CTGTATTCCCAGCTACAGGCCGG - Intronic
1120994931 14:90409872-90409894 CTGTAGTCCCAGCTACTGGGGGG - Intergenic
1121041079 14:90748448-90748470 CTGTAGTCCCAGCTACTGGGAGG - Intronic
1121202840 14:92133579-92133601 CTGTAGTCCCAGCTACTTGAGGG - Intronic
1121365993 14:93310620-93310642 CTGTAGTCCCAGGTACTCGGGGG + Intronic
1121566751 14:94915759-94915781 CTGTAGTCCCAGCACTAGGGAGG - Intergenic
1121751268 14:96359247-96359269 CTGTAGTCCCAGCTACTGCAGGG + Intronic
1122002948 14:98678710-98678732 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
1122083601 14:99284310-99284332 GTGCAGTCCCAGGTAATGGAGGG - Intergenic
1122213859 14:100190789-100190811 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
1122260636 14:100518766-100518788 CTGTAGTCCCAGCTAGAGGACGG + Intronic
1122383523 14:101328090-101328112 CTGTAGTCCCAGCTACTGGGAGG - Intergenic
1122481643 14:102051132-102051154 CTGTAGTCCCAGCTACTTGAGGG + Intergenic
1122557178 14:102587372-102587394 CTGTAATCCCAGCTATGGGGTGG - Intergenic
1122567898 14:102674935-102674957 CTGTAGTCCCAGCTACAGGCTGG + Intronic
1122591413 14:102854618-102854640 CTGTAGTCCCAGCTATCTGGGGG - Intronic
1123009904 14:105344038-105344060 CTGTAGTCCCAGCTACATGTAGG - Intronic
1202905178 14_GL000194v1_random:67514-67536 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
1123679960 15:22755938-22755960 CTGTAGTCCCAGCTACTCGAAGG - Intergenic
1123726560 15:23109000-23109022 CTGTGGTCCCAGCTATCGGGAGG - Intergenic
1123808048 15:23895590-23895612 CTGTAATCCCAGCTATCGGGAGG + Intergenic
1123906107 15:24923026-24923048 CTGTAGTCCCAGTTACATGGGGG - Intronic
1123916927 15:25040499-25040521 CTGTAGTCCCAGCTACTCGAAGG + Intergenic
1123985632 15:25643608-25643630 CTGTAGTCCCAGCTATTTGGGGG + Intergenic
1124571142 15:30865122-30865144 CTGTAGTCCCAGGTGCAGATTGG + Intergenic
1124603973 15:31157032-31157054 CTGTAGTCCCAGGTATTAGGAGG - Intronic
1124801354 15:32835980-32836002 CTGTAGTCCCAGGTACAGAGAGG - Intronic
1125007181 15:34830628-34830650 CTGTAGTCCCAGTTATCAGGAGG - Intergenic
1125064098 15:35461204-35461226 CTGTAGTCCCAGCTATTCGAAGG - Intronic
1125440777 15:39701027-39701049 CTGTAGTCCCAGCTATTTGGGGG + Intronic
1125583230 15:40802290-40802312 CTGTAGTCCCAGCTACTGGGAGG - Intronic
1125647321 15:41283514-41283536 CTGTAGTCCCAGCTACTTGAGGG + Intergenic
1125730348 15:41889538-41889560 CTGTAGTCCCAGCTCTCGGGAGG - Intronic
1125768057 15:42148058-42148080 CTGTAGTCCCAGCTATCTGGAGG + Intronic
1125800620 15:42443605-42443627 CTGTAGTCCCAGCTACTGGGGGG + Intronic
1125850299 15:42896669-42896691 CTGTAGTCCCAGCTACTGGGAGG + Intronic
1125924728 15:43553463-43553485 CTGTAGTCCCAGCTATCCGAGGG - Intronic
1125998544 15:44187689-44187711 CTGTAGTCCTAGCTACATGAGGG - Intronic
1126013037 15:44321347-44321369 CTGTAGTCCCAGCTATCAGGAGG + Intronic
1126040021 15:44581327-44581349 CTGTAGTCCCAGCTACTTGAGGG - Intronic
1126077334 15:44923895-44923917 CTGTAGTCCCAGCTATTTGGAGG - Intergenic
1126414917 15:48407448-48407470 CTGTAGTCCCAGCTACTCGAGGG - Intergenic
1126574871 15:50186558-50186580 CTGTAGTCCCAGCTACTTGAGGG - Intronic
1126608260 15:50502753-50502775 CTGTAGTCCCAGCTATTTGGGGG - Exonic
1126733714 15:51710706-51710728 CTGTAGTCCCAGCTATTAGGAGG - Intronic
1126766461 15:52015932-52015954 CTGTAATCCCAGCTACTGGAAGG + Intronic
1127067904 15:55259405-55259427 TTGTAGTCCCAGTTATTGGGAGG - Intronic
1127118884 15:55754195-55754217 CTGTAATCCCAGGACTAGGGAGG + Intergenic
1127243673 15:57147999-57148021 CTGTACTCCCAGCTATTCGAAGG - Intronic
1127243707 15:57148307-57148329 CTGTAGTCCCAGCTGTTTGAAGG + Intronic
1127332393 15:57951752-57951774 CTGTAGTCAGAGAAATAGGAGGG - Intergenic
1127435216 15:58950567-58950589 CTGTAGTCCCAGCTATCGGTGGG - Intronic
1127449616 15:59103932-59103954 CTGTAGTCCCAGGTACTGGGAGG - Intergenic
1127561754 15:60145626-60145648 CTGTAGTCCCAGCTACACGGAGG - Intergenic
1128024925 15:64427495-64427517 CTGTAGTCCCAGCTACTGGGAGG - Intronic
1128135159 15:65257506-65257528 CTGTAATCCCAGCTACAGGGAGG + Intronic
1128165140 15:65457484-65457506 CTGTAGTCCCAGCTACTTGAAGG - Intronic
1128198024 15:65777910-65777932 CTGTAGTCCCAGCTACTGGAAGG + Intronic
1128253136 15:66177805-66177827 CTGTAGTCCCAGCTACACTAGGG - Intronic
1128295801 15:66518401-66518423 CTGTAGTCCCAGTTACTGGGAGG - Intronic
1128430808 15:67591490-67591512 CTGTAGTCCCAGCTGGAGGCTGG - Intronic
1128611814 15:69080009-69080031 CTGTAGTCCCAGCTACGGGGAGG - Intergenic
1128655293 15:69456718-69456740 CTGTAGTCCCAGCTACTTGAGGG - Intergenic
1128831673 15:70774930-70774952 CTGTAGTCCCAGCTACTGGTCGG + Intergenic
1128878974 15:71225663-71225685 CTGTAGTCCCAGCTATAGGCTGG - Intronic
1129363605 15:75040783-75040805 CTGTAGTCCCAGCTATATTCGGG - Intronic
1129395542 15:75243435-75243457 CTGTAGTCCCAGCTACTTGAAGG - Intergenic
1129493451 15:75952677-75952699 CTGTAGTCCCAGCTATTGGGAGG - Intronic
1129545362 15:76389693-76389715 CTGTAGTCCCAGCTACATGGGGG + Intronic
1129556946 15:76520338-76520360 CTGTAGTCCCAGCTACTCGAAGG - Intronic
1129559530 15:76552158-76552180 CTGTAGTCCCAGCTATTAGGTGG + Intronic
1129639418 15:77359315-77359337 CTGTAGTCCCAGCTACTTGAGGG + Intronic
1129774495 15:78227095-78227117 CTGTAGTCCCAGCTACTTGAAGG + Intronic
1129850929 15:78793483-78793505 CTGTAGTCCCAGCTACTTGAGGG - Intronic
1130113143 15:80982954-80982976 CTGTAGTCCCAGCTACAGTGAGG + Intronic
1130249336 15:82287017-82287039 CTGTAGTCCCAGGTACTTGGGGG - Intergenic
1130251455 15:82302582-82302604 CTGTAGTCCCAGCTACTTGAGGG + Intergenic
1130361249 15:83188504-83188526 CTGTAATCCCAGGTTTTGGGAGG - Intronic
1130670380 15:85907153-85907175 CTGTAGTCCCAGCTACCGGGAGG - Intergenic
1130978361 15:88794649-88794671 CTGTAGTCCCAGCTATTCGGGGG - Intergenic
1131109227 15:89754288-89754310 CTGTAGTCCCAGCTCTCGGGAGG + Intergenic
1131544774 15:93306896-93306918 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
1131698356 15:94904545-94904567 CTGTAGTCCCAGCTACTTGAGGG - Intergenic
1131903724 15:97117819-97117841 CTGAAGACCAAGGTCTAGGATGG + Intergenic
1132509658 16:332452-332474 CTGTAGTCCCAGCTCTAGGGAGG + Intronic
1133048840 16:3105270-3105292 CTGTAGTCCCAGCTACTGGTGGG + Intergenic
1133125592 16:3643881-3643903 CTGTAGTCCCAGCTACTGGGAGG - Intronic
1133252354 16:4491527-4491549 CTGTAGTCCCAGGTACTTGGGGG + Intronic
1133389680 16:5399608-5399630 CTGTAGTCCCAGCTACTGAAAGG + Intergenic
1133735607 16:8612944-8612966 CTGTAATCCCAGCTATCGGGAGG - Intergenic
1133890514 16:9874963-9874985 CTGTAGTCCCAGCTACTTGAGGG + Intronic
1133928098 16:10210076-10210098 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
1133950925 16:10391772-10391794 CTGTAGTCCCAGCTGCTGGAGGG + Intronic
1134030303 16:10986973-10986995 CTGTAGTCCCAGCTATTCGGAGG - Intronic
1134040487 16:11064652-11064674 CTGTAGTCCCAGATACTTGAGGG + Intronic
1134150945 16:11804466-11804488 CTGTAGTCCCAGCTACATGGAGG + Intergenic
1134182463 16:12058913-12058935 CTGTAGACCCAGCTACTGGAGGG - Intronic
1134383991 16:13754999-13755021 CTGTAGTCCCAGCTACTTGAGGG - Intergenic
1134738900 16:16524928-16524950 CTGTAGTCCCAGGTACTCGGGGG - Intergenic
1134928599 16:18187225-18187247 CTGTAGTCCCAGGTACTCGGGGG + Intergenic
1135221712 16:20620466-20620488 CTGTAGTCCCAGGCTGAGGTGGG - Intronic
1135321030 16:21496536-21496558 CTGTGGTCCCAGCTATTGGGAGG + Intergenic
1135373864 16:21928038-21928060 CTGTGGTCCCAGCTATTGGGAGG + Intergenic
1135378226 16:21969409-21969431 CTGTAATCCCAGCTATCGGGGGG + Intronic
1135437922 16:22442683-22442705 CTGTGGTCCCAGCTATTGGGAGG - Intergenic
1135459908 16:22633214-22633236 CTGTAGGCCCAGCTACAGGGAGG - Intergenic
1135485218 16:22859041-22859063 CTGTAGTCCCAGCTACTTGAGGG + Intronic
1135539737 16:23320783-23320805 CTGGAGCCCCAGGGATGGGAGGG + Intronic
1135541777 16:23335567-23335589 CTGTAATCCCAGCTATTGGGAGG - Intronic
1135612091 16:23877213-23877235 CTGTAGTCCCAGCTATGTGGAGG + Intronic
1135678199 16:24435195-24435217 CTGTATTCCCAGCTATCGGAGGG + Intergenic
1135699964 16:24623778-24623800 CTGTAGTCCCAGCTATCGGGAGG + Intergenic
1135702643 16:24645894-24645916 CTGTAGTCCCAGCTACTTGAGGG + Intergenic
1135794084 16:25424803-25424825 CTGTAGTCCCAGCTATTTGGGGG - Intergenic
1136119571 16:28123226-28123248 CTGTAGTCCCCGCTATGGGAGGG - Intronic
1136132625 16:28233338-28233360 CTGTAATCCCAGCTACAGGGTGG + Intergenic
1136136855 16:28261505-28261527 CTGTAGTCCCAGCTATTCCAGGG + Intergenic
1136253828 16:29025003-29025025 CTGTAGTCCCAGCTACTTGAGGG - Intergenic
1136332511 16:29589644-29589666 CTGTGGTCCCAGCTATTGGGAGG + Intergenic
1136447205 16:30329740-30329762 CTGTGGTCCCAGCTATTGGGAGG + Intergenic
1136458703 16:30396809-30396831 CTGTAGTCCCAGCTACTGGGAGG - Intronic
1136514237 16:30758192-30758214 CTGTAGTCCCAGCTACTGGGAGG - Exonic
1136614394 16:31388222-31388244 CTGTAGTTCCAGCTACAGGCAGG + Intergenic
1137320115 16:47372033-47372055 CTGTAGTCCCAGCTACTGGGGGG - Intronic
1137320254 16:47373402-47373424 CTGTAGTCCCAGCTATTCGGAGG - Intronic
1137420856 16:48332587-48332609 CTGTAGTCCCAGCTACAGGGAGG + Intronic
1137430040 16:48411279-48411301 CTGTAATCCCAGCTACAGGGAGG + Intronic
1137631717 16:49951061-49951083 CTGTAGTCCCAGCTACTTGAGGG + Intergenic
1137659972 16:50196812-50196834 CTGTAGTCCCAGCTACAGTGGGG + Intronic
1137865413 16:51890556-51890578 CTGTAGTCCCAGCTACCGGGAGG + Intergenic
1137990866 16:53153649-53153671 CTGTAGTCCCAGCTATTTGGGGG - Intronic
1137993311 16:53181955-53181977 CTGTAATCCCAGCTATCGGGAGG + Intronic
1138027780 16:53536167-53536189 CTGTAGTCCCAGCTACTTGAGGG + Intergenic
1138089116 16:54159603-54159625 CTGTAGTCCCAGCTACTTGAGGG + Intergenic
1138089181 16:54160325-54160347 TTGTAGTCCCAGCTATTGGGAGG - Intergenic
1138241519 16:55431186-55431208 CTGTAATCCCAGCTATTGGAAGG - Intronic
1138424257 16:56920109-56920131 CTGTAGTCCCAGCTATTTGGGGG + Intergenic
1138437032 16:57007605-57007627 CTGTAATCCCAGCTATTGGGAGG + Intronic
1138489588 16:57368631-57368653 CTGTAGTCCCAGCTATATTTGGG + Intergenic
1138672545 16:58627281-58627303 CTGTAGTCCCAGCTACTCGAGGG + Intronic
1138679686 16:58675904-58675926 CTCTAGTCCCAGGTCTTGGGGGG + Intronic
1138876033 16:60951062-60951084 CTGTAGTCCCAGCTATTCAAGGG - Intergenic
1139082934 16:63547623-63547645 CTGTAGTCCCAGCTACTGGGAGG - Intergenic
1139451625 16:67031946-67031968 CTGTAGTCCCAGCTATTGGGAGG - Intronic
1139540225 16:67609743-67609765 CTGTAGTCCCAGCTCTTGGGAGG - Intronic
1139829218 16:69783130-69783152 CTGTAATCCCAGGTATCCGGAGG - Intronic
1139845732 16:69919914-69919936 CTGTAGTCCCAGCTACTTGAGGG - Intronic
1139890271 16:70248715-70248737 CTGTAGTCCCAGCTACTTGAAGG - Exonic
1139892647 16:70263757-70263779 CTGTAGTCCCAGCTATTTGTGGG - Intronic
1140026057 16:71291355-71291377 CTGTAGTCCCAGCTCTAGGGAGG + Intergenic
1140077498 16:71715235-71715257 CTGTAGTCCCAGCTACTTGAGGG + Intronic
1140082204 16:71759336-71759358 CTGTAGTCCCAGCTACTCGAGGG + Intronic
1140398137 16:74646963-74646985 CTGTAGTCCCAGCTACCGGGAGG + Intronic
1140764499 16:78144641-78144663 CTGTAATCCCAGCTATTGGGAGG - Intronic
1141198787 16:81881764-81881786 CTGTAGTCCCAGCTATTCGGAGG - Intronic
1141269676 16:82527839-82527861 CTGTAGTCCCAGCTACTGGGAGG - Intergenic
1141386588 16:83627165-83627187 CTGTAGTCTCAGCTACTGGAGGG + Intronic
1141536405 16:84684038-84684060 CTGTAGTCTCAGCTATGGGGAGG + Intergenic
1141549185 16:84793827-84793849 CTGTAGTCCCAGGTACTTGGGGG - Intergenic
1141768907 16:86076884-86076906 CTGTAGTCCCAGCTATACTTGGG - Intergenic
1141973786 16:87500489-87500511 CTGTAGTCCCAGCTACTCGAGGG + Intergenic
1142437430 16:90070459-90070481 CTGTAGTCCCAGCTATGTGGGGG + Intronic
1142470191 17:158920-158942 CTGTAATCCCAGCTATTGGGAGG + Intronic
1142797321 17:2318574-2318596 CTGTAGTCCCAGGCTGAGGCAGG - Intronic
1142857649 17:2740842-2740864 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
1142934102 17:3312744-3312766 CTGTAATCCCAGCTATCGGGAGG - Intergenic
1143077253 17:4354970-4354992 CTATAGTCCCAGCTATAGGGAGG + Intronic
1143132155 17:4685668-4685690 CTGTAGTCCCAGCTATTGGTGGG + Intronic
1143208160 17:5161319-5161341 CTGTAAGCCCAGATAGAGGATGG + Intronic
1143219370 17:5248705-5248727 CTATAGTCCCAGCTATTGGGAGG - Intergenic
1143438225 17:6946531-6946553 CTGTAGTCCCAGCTACCGGGAGG + Intronic
1143438803 17:6951826-6951848 CTGTAGTCCCAGCTACCGGGAGG - Intronic
1143444753 17:7001067-7001089 CTGTGGTCCCAGCTACTGGAGGG - Intronic
1143549838 17:7623578-7623600 CTGTAGTCCCAGCTACTGGGGGG - Intronic
1143552518 17:7639698-7639720 CTGTAGTCCCAGCTACTGGGGGG - Intergenic
1143949111 17:10618919-10618941 CTGTAGTCCCAGCTACCGGGAGG - Intergenic
1144100835 17:11941001-11941023 CTAGAGTCCCAGGTAAAAGAAGG + Intronic
1144133632 17:12271625-12271647 CTGTAGTCCCAGCTCTCGGGAGG - Intergenic
1144569033 17:16383828-16383850 CTGTAGTCCCAGCTATGTGGGGG - Intergenic
1144577976 17:16441684-16441706 CTGTAGTCCCAGCTACAAGGTGG - Intronic
1144689959 17:17254686-17254708 CTGTAGTCCCAGCTCTCGGGAGG + Intronic
1144711243 17:17403051-17403073 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
1144820981 17:18074198-18074220 CTGTAGTCCCAGCTACTGGGAGG - Intergenic
1144887641 17:18474511-18474533 CTGTAGTCCCAGCTACAGGGAGG - Intergenic
1145032083 17:19512035-19512057 CTGTAGTCCCAGCTATACTCAGG + Intronic
1145073197 17:19829412-19829434 CTGTAGTCCCAGCTACTTGAGGG + Intronic
1145083247 17:19913273-19913295 TTGTAGTCCCAGCTATCGGGAGG - Intronic
1145144575 17:20469789-20469811 CTGTAGTCCCAGCTACAGGGAGG + Intergenic
1145176027 17:20701191-20701213 CTGTAGTCCCAGCTACAGGGAGG + Intergenic
1145189507 17:20826713-20826735 CTGCAGTCCCAGATATTGGAGGG + Intergenic
1145225936 17:21128156-21128178 CTGTAGTCCCAGCTATTTGTTGG + Intronic
1145227226 17:21140144-21140166 CTGTAGTCCCAGCTAGGGGGAGG - Intronic
1145791289 17:27628983-27629005 CTGTAGTCCTGGCTACAGGAAGG - Intronic
1146179793 17:30690416-30690438 CTGTAGTCCCAGCTACTCGAGGG + Intergenic
1146337886 17:31990868-31990890 CTGTAGTCCCATCTATATGGAGG - Intronic
1146394966 17:32457491-32457513 CTGTAATCCCAGGACTTGGAAGG - Intronic
1146408166 17:32557627-32557649 CTGTAGTCCCAGCTACTGGATGG - Intronic
1146565878 17:33912368-33912390 CTGTAGTCCCAGCTACAGGCAGG + Intronic
1146576504 17:33997261-33997283 CTGTAGTCCCAGCTATTTGGGGG - Intronic
1146682615 17:34819019-34819041 CTGTAGTCCCAGCTACTGGGGGG + Intergenic
1146716552 17:35090915-35090937 CTGTAGACCCAGCTATAGGGTGG - Intronic
1146756409 17:35435384-35435406 CTGTAGTCCCAGCTACTGGGAGG - Exonic
1146966413 17:37035000-37035022 CTGTAGTCCCAGCTACTGGGAGG + Intronic
1147048373 17:37771788-37771810 CTGTAGTCCCAGCTATTTGGGGG - Intergenic
1147279402 17:39346210-39346232 CTGTAGTCCCAGCTATTTGGTGG + Intronic
1147407194 17:40220516-40220538 CTGTGGTCCCAGCTATTGGCGGG - Intronic
1147430963 17:40370489-40370511 CTGTAGTCCCAGCTATTTGGGGG + Intergenic
1147728901 17:42584683-42584705 CTGTAGTCCCAGCTACTGAAGGG + Intronic
1147796632 17:43048323-43048345 CTGTAGTCCCAGCTACTTGAGGG - Intronic
1148036906 17:44670659-44670681 CTGTAGTCCCAGCTATTTGGGGG - Intronic
1148057678 17:44810894-44810916 CTGTAGTCCCAGCTACTGCAGGG - Intronic
1148115822 17:45174130-45174152 CTGTAGTCCCAGCTACCGGGAGG + Intergenic
1148168053 17:45497574-45497596 CTGTAGTCCCAGATATTGGAGGG + Intergenic
1148272231 17:46270782-46270804 CTGTAATCCCAGCTATTGGGGGG + Intergenic
1148280764 17:46345383-46345405 CTGTAGTCCCAGATATTGGAGGG - Intronic
1148302992 17:46563318-46563340 CTGTAGTCCCAGATATTGGAGGG - Intronic
1148446428 17:47740606-47740628 CTGTAGTCCCAGCTCTTGGGAGG + Intronic
1148490632 17:48021847-48021869 CTGTAGTCCCAGCTACTGGGGGG - Intergenic
1148591250 17:48818006-48818028 CTGTGGTCCCAGCTATCGGGAGG + Intergenic
1148636380 17:49152254-49152276 CTGTAGTCCCAGCTATGAAAAGG + Intronic
1148810105 17:50284938-50284960 CTGTGGTCCCAGCTATCCGATGG + Intergenic
1148840445 17:50492705-50492727 CTGTAGTCCCAGCTACTGGTGGG + Intergenic
1148869161 17:50645720-50645742 CTGTAGTCCCAGTTACATGGAGG - Intronic
1148898791 17:50859057-50859079 CTGTAGTCCCAGCTACAGGCTGG - Intergenic
1148926938 17:51095172-51095194 CTGTAGTCCCAGCTACCGGGAGG + Intronic
1149269779 17:54965704-54965726 CTGTAGTCCCAGGTCTACTCGGG + Intronic
1149462519 17:56841915-56841937 CTGTAGTCCCAGCTCTAGTGAGG - Intronic
1149622629 17:58057495-58057517 CTGTAGGCTCAGGAACAGGAAGG + Intergenic
1149828234 17:59848975-59848997 CTGTAGTCCCAGCTACTGGTGGG - Intergenic
1149831911 17:59879873-59879895 CTGTAGTCCCAGGTACCTGGAGG - Intronic
1149872241 17:60193117-60193139 CTGTAAGCCCAGATAGAGGATGG - Intronic
1149971543 17:61223277-61223299 CTGTAATCCCAGCTATTGGGGGG - Intronic
1150077394 17:62204219-62204241 CTGCAGTCCCAGATACTGGAGGG - Intergenic
1150097833 17:62394074-62394096 CTGTAGTCCCAGCTACCGGGAGG - Intronic
1150230587 17:63547828-63547850 CTGTAGTCCCAGGTACTACAGGG + Intronic
1150282550 17:63937852-63937874 CTGTAGTCCCAGGCTCAGGTGGG + Intergenic
1150312868 17:64143757-64143779 CTGTAGTCCCAGCACTAGGGAGG + Intergenic
1150399237 17:64843990-64844012 CTGTAGTCCCAGATATTGGAGGG + Intergenic
1150740119 17:67772581-67772603 CTGTAGTCCCAGCTACAGGGAGG + Intergenic
1150793038 17:68214904-68214926 CTGTAGTCCCAGCTATTTGCGGG - Intergenic
1150795595 17:68234324-68234346 CTGTAGTCCCAGCTACATGGAGG + Intergenic
1151483420 17:74383765-74383787 CTGTAGTCCCAGCTACATGGAGG - Intergenic
1151484896 17:74392750-74392772 CTGTAGTCCCAGCTCTTGGGAGG + Intergenic
1151627140 17:75283989-75284011 CTGTAGTCCCAGGTACTTGGGGG + Intronic
1151640586 17:75389721-75389743 CTGTAGTCCCAGCTACTGGGAGG + Intronic
1151643001 17:75410176-75410198 CTGTTGTCCCAGGTACTGGGGGG - Intergenic
1151670570 17:75569679-75569701 CTGTAATCCCAGCTACTGGAAGG + Intronic
1151688515 17:75664788-75664810 CTGTAATCCCAGCTATATGGGGG + Intronic
1151793526 17:76325725-76325747 CTGTAGTCCCAGCTACCGGGTGG - Intronic
1151845163 17:76648576-76648598 CTGTAGTCCCAGCTACTTGAGGG + Intergenic
1151861089 17:76762542-76762564 CTGTAGTCCCAGGCTGAGGCAGG + Intronic
1152000401 17:77641721-77641743 CTGTAATCCCAGGTTAAGGCAGG + Intergenic
1152086333 17:78221371-78221393 CTGTAGTCCCAGCTACTGGGAGG - Intronic
1152127761 17:78457614-78457636 CTGTAGTCCCAGCACTTGGAGGG - Intronic
1152174736 17:78780384-78780406 CTGTAGTCCAGGTTACAGGAGGG + Intronic
1152255160 17:79234851-79234873 CTGTAGTCCCAGCTACTGGTAGG - Intronic
1152478047 17:80531251-80531273 CTGTAGTCCCAGCTACTGGGAGG - Intergenic
1152742385 17:82023992-82024014 CTCTACTCCCAGGTGCAGGAAGG - Intronic
1152791093 17:82280323-82280345 CTGTAGTCCCAGCTATCGGGAGG + Intergenic
1152831322 17:82498528-82498550 CTGTAATCCCAGCTATCGGGAGG + Intergenic
1153243027 18:3047813-3047835 CTGTAGTCCCAGCTATTCGGAGG + Intergenic
1153377426 18:4396480-4396502 CTGAAGTCCAAGAGATAGGAAGG + Intronic
1153495366 18:5692846-5692868 CTGTAATCCCAGCTATTGGGGGG + Intergenic
1153506130 18:5800926-5800948 CTGTAGTCCCAGCTATGTGGAGG + Intergenic
1153672637 18:7427135-7427157 CTGTAGTCCCAGCTACTGGGAGG - Intergenic
1153788704 18:8557838-8557860 CTGTAGTCCCAGCTATTTGTGGG - Intergenic
1154218626 18:12433545-12433567 CTGTAGTCCCAGCTGTCGGGAGG - Intergenic
1154222921 18:12472780-12472802 CTGTAGTCCTAGCTACTGGAAGG - Intronic
1155028894 18:21967095-21967117 CTGTAGTCCCAGCTACTCGAGGG + Intergenic
1155158022 18:23173839-23173861 CTGTAGTCCCAGCTATTGGGAGG + Intronic
1155305562 18:24474806-24474828 CTGTAGTCCCAGCTCTCGGGAGG - Intronic
1155312144 18:24534468-24534490 CTGTGGTCACAGGAATAGGCTGG - Intergenic
1155434793 18:25801185-25801207 CTGTAGTCCCAGCTACTTGAGGG + Intergenic
1155471617 18:26197627-26197649 CTGTAGTCCCAGGTATTTGGGGG + Intergenic
1155480776 18:26285088-26285110 CTGTAGTCCCAGCTACCGCAGGG - Intronic
1155563074 18:27101468-27101490 CTGTAGTCCCAGCTACTGGCGGG + Intronic
1155583428 18:27338389-27338411 CTATAGTCCCAGCTTCAGGAGGG + Intergenic
1155776476 18:29768166-29768188 CTGTAGCCCCAGGTATTTGGGGG - Intergenic
1155836751 18:30594960-30594982 CTGTAGTCCCAGCTACTCGAGGG - Intergenic
1155930139 18:31698507-31698529 CAGTAATCCCAGCTACAGGAAGG + Intergenic
1156199511 18:34813728-34813750 CTGTAGTCCCAGCTAGAAGCAGG + Intronic
1156383439 18:36584269-36584291 CTGCAACCCCAGGTATATGATGG + Intronic
1156383472 18:36584682-36584704 CTGTAGTCCCAGCTATCGGGAGG + Intronic
1156650487 18:39220412-39220434 CTGTGGATCCAGGTCTAGGAGGG + Intergenic
1156757786 18:40549694-40549716 CTCTAGTCCCAGCTACACGAGGG - Intergenic
1156842764 18:41628905-41628927 CTGTAGTCCCAGCTATTCCAGGG - Intergenic
1157369433 18:47096995-47097017 CTGTAGTCCCAGCTACTGGGGGG + Intronic
1158074026 18:53508013-53508035 CTGTAGTCCCAGCTCTCGGGAGG - Intronic
1158459770 18:57635943-57635965 CTGTAGTCCCAGCTACGGGGAGG - Intergenic
1158637208 18:59170595-59170617 CTGTAGTCCCAGCTACTCGAGGG + Intergenic
1158712013 18:59845996-59846018 CTGTAGTCCCAGGCTGAGGCAGG + Intergenic
1159341592 18:67141057-67141079 CTGTAGTCCCAGCTACTGGGGGG - Intergenic
1159527594 18:69612991-69613013 CTGTAGTCCCAGCTTCAGGTGGG - Intronic
1159963317 18:74572663-74572685 CTGTAGTCCCAGCTATTTAAGGG + Intronic
1160159986 18:76463722-76463744 CCGTGGTCCCAGGTATAAGTGGG - Intronic
1160173216 18:76571645-76571667 CTGTAGTCCCAGCTCTCGGGAGG + Intergenic
1160187445 18:76686636-76686658 CTGTGGTCCCAGCTACTGGAAGG - Intergenic
1160755359 19:754339-754361 CCGTAGTCCCAGCTCTAGGGAGG + Intronic
1160800914 19:968235-968257 CTGTAGTCCCAGCTACTGGGAGG + Intronic
1161243157 19:3234158-3234180 ATGGAGGCCCAGGTAGAGGAGGG + Intronic
1161500520 19:4612177-4612199 CTATAATCCCAGTTAGAGGAAGG - Intergenic
1161540197 19:4846102-4846124 CTGTAGTCCCAGCTACCAGAAGG + Intronic
1161689896 19:5725776-5725798 CTGTAATCCCAGCTATCGGGAGG + Intronic
1161691938 19:5740642-5740664 CTGTAATCCCAGCTATCGGGAGG + Intronic
1161692870 19:5747294-5747316 CTGTAGTCCCAGTTACTGGGAGG - Intronic
1161702089 19:5801199-5801221 CTGTAGTCCCAGCTACACGGAGG + Intergenic
1161756397 19:6137332-6137354 CTGTAGTCCCAGCTATCTGAGGG + Intronic
1161757954 19:6148521-6148543 CTGTAGTCCCAGCTATCAGGAGG + Intronic
1161787816 19:6338997-6339019 CTGTAATCCCAGCTATCGGGAGG - Intergenic
1161812866 19:6480725-6480747 CTGTAATCCCAGCTACAGGGAGG - Intronic
1161835545 19:6643628-6643650 CTGTAATCCCAGGTACTGGGAGG + Intergenic
1161909046 19:7179031-7179053 CTGTAGTCCCAGGTACTTGAGGG - Intronic
1162081723 19:8222001-8222023 CTGTAGTCCCAGCTACTGGGAGG - Intronic
1162323401 19:9984143-9984165 CTGTAATCCCAGGTACATGGAGG - Intronic
1162347892 19:10131251-10131273 CTGTAGTCCCAGTTACACGGAGG + Intergenic
1162404166 19:10463521-10463543 CTGTAATCCCAGCTATAGTGGGG - Intronic
1162417719 19:10548150-10548172 CTGTAGTCCCAGCTATTGGGAGG - Intronic
1162422868 19:10575886-10575908 CTGTAGTCCCAGCTACCGGGAGG - Intronic
1162437044 19:10667375-10667397 CTGTAGTCCCAGCTATAGGGAGG - Intronic
1162472513 19:10880904-10880926 CTGTAATCCCAGGTTTTGGGAGG + Intronic
1162473478 19:10886314-10886336 CTGTAATCCCAGCTACAGGCTGG - Intronic
1162492352 19:11000754-11000776 CTGTAGTCCCAGCTACTGGGAGG + Intronic
1162517930 19:11160954-11160976 CTGTAGTCCCAGCTACTGGGAGG - Intergenic
1162729290 19:12708252-12708274 CTGTAGTCCTAGCTATTGGGAGG - Intronic
1162740952 19:12773369-12773391 CTGTAGTCCCAGCTACTGGGAGG - Intronic
1162742569 19:12781959-12781981 CTATAGTCCCAGGTATGTGGGGG - Intronic
1162809800 19:13156848-13156870 CTGTAATCCCAGCTATCCGAAGG + Intergenic
1162842380 19:13365788-13365810 CTGTAGTCCTAGCTATTGCAGGG - Intronic
1162890955 19:13732729-13732751 CTGTAGTCCCAGCTACTGGGAGG - Intronic
1162978817 19:14225146-14225168 CTGTAGTCCCAGCTACTTGAGGG - Intergenic
1163001078 19:14367674-14367696 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
1163014946 19:14449060-14449082 CTGTAGTCCCAGCTATTAGAAGG - Intronic
1163024687 19:14503740-14503762 CTGTGGTCCCAGGTACTTGAGGG - Intergenic
1163043225 19:14618430-14618452 TTGTAGTCCCAGCTATCGGGAGG + Intergenic
1163058222 19:14738498-14738520 CTGTAGTCCCAGCTACCGGGAGG - Intronic
1163122911 19:15228638-15228660 CTGTAGTCCCAGCTACCGGGAGG - Intronic
1163206877 19:15809937-15809959 CTGTAGTCCCAGCTATTTAAGGG - Intergenic
1163351965 19:16782736-16782758 CTGTAGTCCCAGCTACAAGGAGG + Intronic
1163445530 19:17343922-17343944 CTATAGTCCCAGCTATCGGGAGG + Intergenic
1163465355 19:17465054-17465076 CTGTAGTCCCAGCTACTTGAGGG + Intergenic
1163524655 19:17813325-17813347 CTGTAGTCCCAGCTATACTTGGG + Intergenic
1163528176 19:17833995-17834017 CTATAGTTCCAGCTATAGGTAGG - Intronic
1163532245 19:17856964-17856986 CTGTAGTCCCAGCTACTCGAGGG + Intergenic
1163533768 19:17865468-17865490 CTGTAGTCCCAGCTACACGGGGG + Intergenic
1163658857 19:18564496-18564518 CTGTAGTCCCAGCTATACTCGGG + Intronic
1163791558 19:19309360-19309382 CTGTAGCCCCAGCTACAGGGAGG + Intronic
1163865766 19:19772095-19772117 CTGTAGTCCCAGGCTGAGGCAGG + Intergenic
1163937998 19:20467652-20467674 CTGTAGTCCCAGCTACTGGGAGG - Intergenic
1164043471 19:21512991-21513013 CTGTAGTCCCAGCTACTGGGAGG - Intronic
1164064435 19:21703500-21703522 CTGTAATCCCAGGTATTTGGAGG - Intergenic
1164139541 19:22446355-22446377 CTGTAATCCCAGGTACTGGGAGG - Intronic
1164393874 19:27847261-27847283 CTGTAGTTCCAGCTACTGGAGGG - Intergenic
1164641763 19:29831492-29831514 CTGTAATCCCAGCTATTGGGAGG + Intergenic
1164930252 19:32169834-32169856 CTGTAGTCCCAGCTACTTGAGGG + Intergenic
1164949082 19:32321244-32321266 CTGTAGTCCCAGCTACTTGAGGG + Intergenic
1164973523 19:32552596-32552618 CTGTAGTCCCAGGTACTTGGCGG - Intergenic
1165055092 19:33170737-33170759 CTGTAGTCCCAGCTATTCGGGGG + Intronic
1165082533 19:33317277-33317299 CTGTAATCCCAGCTATGGGGTGG - Intergenic
1165206547 19:34193272-34193294 CTGTAGTCCCAGCTATAAGGAGG - Intronic
1165336913 19:35177119-35177141 CTGTGGTCCCAGCTATTTGAGGG + Intergenic
1165368468 19:35385794-35385816 CTGTAGTCCCAGCTACTTGAGGG - Intergenic
1165458968 19:35933005-35933027 CTGTAATCCCAGGTTGAGGTGGG + Intergenic
1165524085 19:36338111-36338133 CTGTAGTCCCAGGCTGAGGTGGG - Exonic
1165598506 19:37032215-37032237 CTGTAGTCCCAGCTACTGGGAGG + Intronic
1165644644 19:37424995-37425017 CTGTAGTCCCAGCTATCAGGAGG + Intronic
1165701984 19:37945354-37945376 CTGTAGTCCCAGCTACCGGGAGG - Intronic
1165716454 19:38048958-38048980 CTGTAGTCCCAGCTATCGTGAGG + Intronic
1165737788 19:38187872-38187894 CTGTAGTCTCAGCTATTGGGAGG + Intronic
1165871751 19:38977806-38977828 CTGTAGTCCCAGCTACTTGAGGG - Intergenic
1165880404 19:39038616-39038638 CTGTAGTCCCAGCTACTCGAGGG - Intergenic
1166037655 19:40180808-40180830 CTGTAATCCCAGTTACAGGGAGG - Intergenic
1166076012 19:40414244-40414266 CTGTGGTCCCAGCTATTTGAGGG - Intergenic
1166082035 19:40450073-40450095 CTGTAGTCCCAGCTATTCGGGGG + Intronic
1166129236 19:40736166-40736188 CTGTAGTCCCAGCTATCAGGAGG + Intronic
1166513087 19:43424110-43424132 CTGTAGTCCCAGCTACTGGAGGG - Intergenic
1166529073 19:43531902-43531924 CTGTAGTCCCAGCTATTTCACGG - Intronic
1166533685 19:43558210-43558232 CTGTAGTCCCAGCTACTTGAGGG + Intronic
1166540523 19:43602340-43602362 CTGTAGTCCCAGCTACAGGGAGG - Intronic
1166837163 19:45674481-45674503 CTGTGGTACCAGCTATAGGGGGG + Intronic
1166845607 19:45726219-45726241 CTGTAGTCCCAGCTATACTCAGG + Intronic
1167127894 19:47563726-47563748 CTGTAATCCCAGGTACTGGGAGG - Intergenic
1167138203 19:47631175-47631197 CTGTAGTCCCAGCTATCAGGAGG - Intronic
1167168319 19:47814176-47814198 CTGTATTCCCAGCTATTGGGAGG - Intronic
1167255893 19:48428483-48428505 CTGTAATCTCAGCTACAGGAGGG - Intronic
1167268419 19:48494448-48494470 CTGTAGTCCCAGCTATTCGGTGG - Intronic
1167291335 19:48626691-48626713 CTGTAATCCCAGCTACAGGAGGG + Intronic
1167514993 19:49918186-49918208 CTGTAGTCCCAGCTAACGGGAGG - Intronic
1167655302 19:50759770-50759792 CTGTAGTCCCAGCTATTTGGGGG - Intergenic
1167729794 19:51245334-51245356 CTGTAGTCCCAGCTACGTGAGGG + Intergenic
1167787549 19:51647980-51648002 CTGTAGTCCCAGCTACTGGGGGG + Intergenic
1167841929 19:52129153-52129175 CTGTAATCCCAGCTATTGGGAGG + Intronic
1167923410 19:52803335-52803357 CTGTAATCCCAGGTCTTGGGAGG - Intronic
1168013384 19:53552608-53552630 CTGTAGTCCCAGCTCTTGGGAGG + Intronic
1168058283 19:53875724-53875746 CTGTAATCCCAGGTATTTGGGGG + Exonic
1168081862 19:54016019-54016041 CTGTAGTCCCAGGGATTTGGGGG - Intergenic
1168263886 19:55210636-55210658 CTGTAGTCCCAGCTACCGGGAGG + Intergenic
1168471631 19:56644879-56644901 CTGTAGTCTCAGATATTGGAAGG - Intronic
1168555622 19:57337201-57337223 CTGTAGTCCCAGTTACTGAAAGG - Intergenic
1168704064 19:58458288-58458310 CTGTAATCCCAGCTACTGGAGGG - Intergenic
1168708845 19:58486213-58486235 CTGTAGTCTCAGCTATCGGGAGG - Intronic
925018967 2:553680-553702 CTGTAGTCCCAGGAGGAGGTGGG + Intergenic
925168749 2:1737659-1737681 CTGTAGTTCCAGCTATCGGGAGG - Intronic
925205673 2:2003635-2003657 CTGAAGACTCAGGTACAGGAAGG - Intronic
925993758 2:9275190-9275212 CTGTAATCCCAGGCTGAGGAGGG - Intronic
926178281 2:10616669-10616691 CTGTAGTCCCAGCTACTTGAAGG - Intronic
926497849 2:13613991-13614013 CTGTAGTCCCAGCTACTGGGGGG + Intergenic
926676823 2:15631719-15631741 CTGTAGTCCCAGGTACCTGGGGG - Intergenic
926770775 2:16373025-16373047 CTGTAGTCCCAGCTACTGCAGGG - Intergenic
926906327 2:17808953-17808975 CTGTAGTCCCAGCTATAAGGAGG + Intergenic
927023931 2:19046304-19046326 CTGTAGTCCCAGCTATGAGGTGG - Intergenic
927140014 2:20123500-20123522 CTGTAGTCCCAGGTACTTGGAGG - Intergenic
927221802 2:20717906-20717928 CTGTAGTCCCAGCTAATTGAAGG - Intronic
927368524 2:22327486-22327508 CTGTAGTCCCAGCTATTGGGAGG + Intergenic
927375018 2:22403527-22403549 CTGTAGTCCCAACTATTGGGAGG - Intergenic
927664231 2:25018616-25018638 CTGTAGTCCCATCTACTGGAGGG - Intergenic
927755402 2:25704581-25704603 CTGTAGTCCCAGCTATTGGGAGG - Intergenic
927778786 2:25922970-25922992 CTGTAATCCCAGCTACAGGCAGG - Intergenic
927891355 2:26751953-26751975 CTGTAGTCCCAGGCTGAGGTGGG - Intergenic
927952040 2:27177572-27177594 CTGTAGTCCCAGGTACAGGAGGG - Intergenic
928041681 2:27884367-27884389 CTGTAGTCCCAGCTACTGGGGGG - Intronic
928149994 2:28818042-28818064 CTGTAGTCCCAGCTATCTGGGGG + Intronic
928307623 2:30183495-30183517 CTGTAGTCCCAGCTACTGGGAGG - Intergenic
928320514 2:30279515-30279537 CTGTAATCCCAGTAATAGGGAGG - Intronic
928355253 2:30607156-30607178 CTGTAGTCCCAGCTACACAATGG - Intronic
928447383 2:31345392-31345414 ATATAGTCCAAGGGATAGGATGG - Intronic
928519940 2:32078958-32078980 CTGTAGTCCCAGCTACTTGAGGG - Intronic
928614120 2:33019455-33019477 CTGTAATCCCAGTTCTCGGAAGG - Intronic
928678707 2:33676996-33677018 CTGTAGTCCCAGCTCTTGGGAGG - Intergenic
928706008 2:33950456-33950478 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
928773500 2:34730972-34730994 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
928775618 2:34759670-34759692 CTGTAGTCCCAGCTACTGGGAGG - Intergenic
928848506 2:35710715-35710737 CTGTAATCCCAGGCTTAGGCAGG - Intergenic
928939904 2:36717288-36717310 CTGTAGTCCCAGGCTGAGGCAGG - Intronic
928978818 2:37117412-37117434 CTGTAGTCCCAGCTATGTGGGGG + Intronic
929058075 2:37895796-37895818 CTGTAGTCCCAGCTATGGGGAGG + Intergenic
929135304 2:38618222-38618244 CTGTAGTCCCAGCTATTTGGCGG - Intergenic
929212021 2:39367646-39367668 CTGTAGTCCCAGATATTTGGGGG + Intronic
929537896 2:42795438-42795460 CTGTAGTCCCAGCTACAGTGAGG - Intergenic
929557665 2:42935697-42935719 CTGTAGTCTCAGCTATATGGGGG + Intergenic
929831601 2:45351231-45351253 ATGTCATCCCAGGCATAGGAGGG + Intergenic
929981831 2:46688499-46688521 CTATAGTCCCAGCTATTGGGAGG + Intergenic
930009450 2:46924747-46924769 CTGTAGTCCCAGCTATTCCAGGG - Intronic
930142174 2:47963932-47963954 CTGTAGTCCCAGCTATTCGGGGG - Intergenic
930180426 2:48350464-48350486 CTCTAGTCCCAGGCAAAGGATGG - Intronic
930196877 2:48519030-48519052 CTGTGGTCCCAGCTACATGAGGG + Intergenic
930824060 2:55677859-55677881 CTGTAGTCCCAGCTACTGGGAGG - Intronic
930866238 2:56124701-56124723 CTTTATTCCCAGATATAAGATGG + Intergenic
931331037 2:61283736-61283758 TTGTAGTCCCAGCTATTGGGAGG - Intronic
931466723 2:62494891-62494913 CTGTAGTCCCAGCTACCGGGAGG + Intergenic
931469475 2:62524062-62524084 CTGTAGTCCCAGCTATTTGGGGG - Intergenic
931832534 2:66067651-66067673 CTGTAGTCCCAGCTATTTAAGGG - Intergenic
931963961 2:67512981-67513003 CTGTAGTCCCAGCTATTGAGAGG + Intergenic
932634853 2:73379197-73379219 CTGTAGTCCCAGCTACTGGGGGG - Intergenic
932675338 2:73775730-73775752 CTGTAGTCCCAGCTACCGGGAGG + Intronic
933747392 2:85581057-85581079 CTGTAGTCCCAGCACTAGGGAGG + Intronic
933881160 2:86671236-86671258 CTGTAATCCCAGCTATTGGGAGG + Intronic
933911696 2:86946379-86946401 CCGTAGTCCCAGCTACAGGCTGG - Intronic
934011300 2:87823516-87823538 CCGTAGTCCCAGCTACAGGCTGG + Intronic
934086249 2:88512471-88512493 CTGTAGTCCCAGCTACCGGGAGG - Intergenic
934090467 2:88546395-88546417 CTGTAGTCCCAGCTACTCGAGGG + Intergenic
934504976 2:94883017-94883039 CTGTAGTCCCAGCTATGGGGGGG - Intergenic
934754931 2:96818205-96818227 CTGTAGTCCCAGCTACTCGAAGG - Intronic
934757658 2:96835588-96835610 CTGTAGTCCCAGCTATGGGGAGG - Intronic
934869339 2:97847054-97847076 CTGTAGTCCCAGCTACTGGGGGG + Intronic
935102531 2:100010587-100010609 CTGCAGTCCCCGTTATATGAAGG - Intronic
935513123 2:104001047-104001069 CTGTAGTCCCAGCTATCGGGAGG + Intergenic
935560780 2:104557489-104557511 CTGTAGTCCCAGGCTGAGGCAGG + Intergenic
935774861 2:106464221-106464243 CCGTAGTCCCAGCTACAGGCTGG + Intronic
935788813 2:106571994-106572016 CTGAAGGGCCAGGTATTGGAGGG + Intergenic
935905206 2:107831691-107831713 CTGTAGTCCCAGCTACAGGCTGG - Intronic
935991572 2:108723395-108723417 CTGTAGTCCCAGCTACAGGCTGG - Intronic
936021743 2:109000402-109000424 CTGTAGTCCCAGCTATCGGGAGG + Intergenic
936067556 2:109343864-109343886 CTGTAGTCTCAGCTATTGGGAGG - Intronic
936126989 2:109796761-109796783 CTGTAGTCCCAGCTACAGGCTGG - Intronic
936217708 2:110574725-110574747 CTGTAGTCCCAGCTACAGGCTGG + Intronic
936374403 2:111928346-111928368 CTGTAGTCCCAGCTATTTGGGGG - Intronic
936426850 2:112429296-112429318 CTGTAGTCCCAGCTACAGGCTGG + Intronic
936434517 2:112492606-112492628 CTGTAGTCCCAGCTACTGGGAGG + Intronic
936830377 2:116637806-116637828 CTATAATCCCAGCTATAGGCTGG + Intergenic
936863266 2:117047482-117047504 CTGTAATCCCAGGATTTGGAAGG + Intergenic
937116894 2:119413021-119413043 CTGTAGTCCCAGGCAGAGGCAGG - Intergenic
937183623 2:120018081-120018103 CTGTAGTCCCAGCTACCGGGAGG - Intronic
937294335 2:120800625-120800647 CTGTAGTCCCAGCTACTGGGAGG - Intronic
937523530 2:122739700-122739722 CTGTATTCCCTGGTATAGCTGGG - Intergenic
937873787 2:126804904-126804926 CTGTAGTCCCAGCTATTTGGGGG - Intergenic
937992083 2:127669593-127669615 CTGTAGTCCCAGCTACTGGAGGG + Intronic
938143664 2:128816278-128816300 CTGTAGTCCCAGCTATTCGGAGG + Intergenic
938205725 2:129421186-129421208 CTGTAGTCCCAGCTACTTGAGGG + Intergenic
938212144 2:129477350-129477372 CTGTAATCCCAGCTATAGGGAGG + Intergenic
938417166 2:131113202-131113224 CTGTAGTCCCAGCTACTGGGGGG - Intronic
938814461 2:134886107-134886129 CTGGAATTCCAGGAATAGGATGG + Intronic
938892011 2:135715224-135715246 CTGTAGTCCCAGCTACAGGCTGG + Intronic
939561754 2:143740657-143740679 ATGTAGTCCCAGGTACAGCAGGG + Intronic
939916123 2:148046104-148046126 CTGTAGTCCCAGCTACTCGAGGG - Intronic
939953776 2:148507634-148507656 CTGTAGTCCCAGCTACTCGAGGG + Intronic
939984229 2:148814302-148814324 CTGTAGTCCCAGCTACTGGGTGG + Intergenic
940032676 2:149281116-149281138 CTGTAGTCCCAGCCATCGGGAGG - Intergenic
940119218 2:150244669-150244691 CTGTAGTCCCAGCTGTCGGGAGG + Intergenic
940160280 2:150704506-150704528 CTGTAGACCCAGCTATCGGGAGG - Intergenic
940186972 2:150996654-150996676 CTGTAGTCCCAGCTATTTGGGGG - Intergenic
940772316 2:157852373-157852395 CTGTGGTCCCAGCTATAGGGAGG + Intronic
941117641 2:161489837-161489859 CTGTAGTCCTAGCTATAGGGAGG - Intronic
941368316 2:164633880-164633902 CTGTAGTCCCAGTTATTTGGGGG - Intergenic
941455156 2:165706380-165706402 CTGTAGTCCCAGCTATTTGGGGG - Intergenic
941616237 2:167723651-167723673 CTGTAGTCCCAGTTACTCGAGGG - Intergenic
941699323 2:168587046-168587068 CTGTAGTCCCAGCTATGCGGTGG + Intronic
942105800 2:172632143-172632165 CTGTAATCCCAGCTATAGGGAGG + Intergenic
942414946 2:175748655-175748677 CTGTAGTCCCATCTACAGGGAGG - Intergenic
942514909 2:176741861-176741883 CTGTAGTCCCAAGTACTTGAAGG - Intergenic
942999931 2:182314302-182314324 CTGTAGTCCCAGCTACTTGAAGG + Intronic
943193681 2:184715508-184715530 CTGTAGTCCTAGCTATATGTGGG - Intronic
943308832 2:186301350-186301372 CTATAGTCCCAGCTACAGGTGGG + Intergenic
943370287 2:187007653-187007675 CTGTAGTCCCAGCTATACTCAGG + Intergenic
944312390 2:198248360-198248382 CTGTAGTCCCAGGTACTTGGGGG - Intronic
944324010 2:198382250-198382272 CTATAGTCCTAGGCATATGAGGG - Intronic
944337385 2:198551784-198551806 CTGTAGTCCCAGCTACTGGGAGG + Intronic
944674633 2:202024858-202024880 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
944739485 2:202597793-202597815 CTGTAGTCCTAGCTACTGGAGGG - Intergenic
944746109 2:202658423-202658445 CTGTAGTCCCAGGACTTGGGAGG - Intronic
945139864 2:206673378-206673400 CTGTAATCCCAGCTACTGGAGGG - Intronic
945271935 2:207949416-207949438 CTGTAATCCCAGCTACTGGAAGG + Intronic
945422852 2:209660513-209660535 CTGTAGTCCCAGCTATTGGGAGG - Intronic
945452815 2:210013436-210013458 CTGCAGTCCCAGCTACTGGAGGG - Intronic
945528790 2:210924462-210924484 CTGTAATCCCAGGCAGAGGCAGG - Intergenic
945701250 2:213173415-213173437 CTGTGGTCCCAGCTATAGGGAGG + Intergenic
945802658 2:214452275-214452297 CTGTAGTCCCAGCTACTGGGAGG - Intronic
945996094 2:216437458-216437480 CTGGTATCCCAGCTATAGGAAGG + Intronic
946019335 2:216630141-216630163 CTGTAGGCCCAGGGCTAGAACGG - Intergenic
946264307 2:218525358-218525380 CTGTAGTCCCAGCTACTGGGGGG + Intronic
946323375 2:218967579-218967601 CTGTAGTCCCAGCTACTGGGGGG + Intergenic
946380054 2:219341434-219341456 CTGAAGTCCCTGGTATAAAACGG + Intergenic
946395185 2:219440262-219440284 CTGTAGTCTCAGGTACAAGGGGG + Intronic
946647629 2:221855274-221855296 CTGTGGTCCCAGCTCTACGATGG + Intergenic
946768001 2:223057913-223057935 CTCTATTCACAGGTATGGGAGGG + Intronic
946843980 2:223843134-223843156 CTGTAGTCCCAGCTACATGGGGG - Intergenic
946891618 2:224282841-224282863 ATGTAGTCCCTGGAAAAGGAAGG - Intergenic
946925544 2:224623275-224623297 CTGTAATCCCAGCTATCGGGAGG - Intergenic
947004334 2:225493106-225493128 CTGTAGTCCCAGCTATTTGTTGG - Intronic
947007249 2:225526380-225526402 CTGTATTCTCAGGTAGGGGAGGG + Intronic
947080262 2:226388158-226388180 CTGTAGTCCCAGCTACTTGAGGG + Intergenic
947262714 2:228242006-228242028 CTGTAACCCCAGCTATCGGATGG + Intergenic
947561489 2:231157687-231157709 CTGTAGTCCCAGCTACAGGAGGG - Intronic
947724795 2:232390305-232390327 CTGTAGTCCCAGCTATCAGGAGG + Intergenic
948414933 2:237796259-237796281 CTGTAATCCCAGCTACTGGAAGG + Intronic
1169162207 20:3390485-3390507 CTGTAATCCCAGCTACAGGGAGG - Intronic
1169364959 20:4984429-4984451 CTGTAGTCCCAGCTATTTGGAGG + Intronic
1169786624 20:9366273-9366295 CTGTAGTCCCAGCTACTGGGAGG + Intronic
1169790634 20:9406615-9406637 CTGTAGTCCCAGCTACTGGGAGG - Intronic
1170014536 20:11766056-11766078 CTGTAGTCCCAGCTATTCGGGGG - Intergenic
1170186871 20:13601154-13601176 CTGTAGTCCCAGCTATTGAGCGG + Intronic
1170221836 20:13949539-13949561 CTGTAGTCCCAGCTATCGGGAGG + Intronic
1170770099 20:19325321-19325343 CTGTAGTCCCAGCTACTGGTGGG + Intronic
1171073324 20:22097197-22097219 CTGTAGACCCAGCTATAGGGAGG + Intergenic
1171221837 20:23405180-23405202 CTGTAGTCCCAGCTACTTGAGGG + Intronic
1171453674 20:25253947-25253969 CTGTAGTCCCAGGTACTTGGGGG + Intronic
1171475060 20:25402269-25402291 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
1171980163 20:31622334-31622356 CTGTACTCCCAGGTATTGGGAGG + Intergenic
1172059966 20:32180686-32180708 CTGTAGTCCCAGCTATTCGGAGG - Intergenic
1172063082 20:32200357-32200379 CTGTAGTCCCAGCTACCGGGAGG - Intronic
1172077920 20:32313827-32313849 CTGTAGTCCCAGATACTCGAAGG - Intronic
1172287690 20:33752772-33752794 CTGTAGTCCCAGCTATCGGGAGG - Intronic
1172381992 20:34502259-34502281 CTGTAGTCCCAGTTATTTGGAGG + Intronic
1172415809 20:34766503-34766525 CTGTAGTCCCAGCTACTGCAGGG + Intronic
1172545363 20:35756789-35756811 CTGTAATCCCAGCTACTGGAGGG - Intergenic
1172552561 20:35813088-35813110 CTGTAGTCCCAGCTCTCGGGAGG - Intronic
1172564258 20:35916587-35916609 CTGTAATCCCAGCTATGGGGAGG - Intronic
1172577814 20:36022740-36022762 CTGTAGTCCCAGGCTGAGGTGGG - Intronic
1172665995 20:36600672-36600694 CTGTAGTCCCAGCTATTTGAAGG - Intronic
1172732341 20:37098570-37098592 CTGTAGTCCCAGGTACTTGGGGG - Intergenic
1172743579 20:37188737-37188759 CTGTAGTCCCAGCTACTCGAGGG - Intronic
1172755050 20:37277800-37277822 CTGTAGTCCCAGCTACTTGATGG + Intergenic
1172869087 20:38124703-38124725 CTGTAGTCCCAGGTACTCGGGGG - Intronic
1173638833 20:44584844-44584866 CTGTAATCCCAGCTATTCGAGGG - Intronic
1173729805 20:45320241-45320263 CTGTAGTCCCAGCTATGGGGTGG + Intergenic
1174004028 20:47396020-47396042 CTGTAATCCCAGCTACAGGGAGG - Intergenic
1174021609 20:47534791-47534813 CTGTAGTCCCAGCTGTTGGGTGG + Intronic
1174187077 20:48713613-48713635 CTGTAGTTCCAGCTTTTGGAAGG + Intronic
1174194694 20:48764658-48764680 CTGTGGTCCCAGCTCTTGGAAGG + Intronic
1174235020 20:49082639-49082661 CTGTAGTCCCAGCTATCGCGAGG - Intronic
1174275573 20:49401415-49401437 CTGTAGTCCCAGCTACATGGGGG - Intronic
1174301121 20:49583258-49583280 CTGTAGTCCCAGCTACTTGAGGG + Intergenic
1174327605 20:49791687-49791709 CTGTAGTCCCAGGCTGAGGAGGG + Intergenic
1174649802 20:52115080-52115102 CTGTAGTCCCAGGTACTGGGAGG + Intronic
1175212288 20:57368009-57368031 CTGTAGTCCCAGTTAACGGGAGG - Intronic
1175433011 20:58920365-58920387 CTGTAGTCCCAGCTATAGGGAGG + Intergenic
1176175872 20:63723946-63723968 CTGTAGTCCCAGCTATTTGGGGG + Intronic
1176212460 20:63931634-63931656 CTGTAGTCACAGAGATGGGAAGG + Exonic
1176624544 21:9082269-9082291 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
1176943993 21:14956538-14956560 CTGTAATCCCAGCTACTGGAGGG + Intergenic
1177158426 21:17522102-17522124 CTGTAGTCCCAGCTACTTGAGGG - Intronic
1177214101 21:18106615-18106637 CTGTAGTCCCAGCTATTTGGAGG - Intronic
1177303998 21:19288780-19288802 CTGTAGTCCCAGCTATTCGGAGG + Intergenic
1177429463 21:20972393-20972415 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
1177599949 21:23298189-23298211 CTGTAGTCCCAGCTACTTGACGG + Intergenic
1177687112 21:24451331-24451353 CTGTAATCCCAGCTACAGGGAGG - Intergenic
1178336802 21:31750609-31750631 CTGTAGTCCCAGCTCTCGGGAGG - Intergenic
1178359067 21:31933036-31933058 CTGTAGTCTCAGCTACAGGCTGG - Intronic
1178878525 21:36430650-36430672 CTGTAGTCCCAGCTATTTGTGGG - Intergenic
1178937986 21:36881090-36881112 CTGTAGTCCCAGCTAGTTGAGGG - Intronic
1180236386 21:46461937-46461959 CTGTAGTCCCAGCTACTTGAGGG + Intronic
1180580130 22:16827068-16827090 CTGTAGTCCCAGGTCTCGGGAGG - Intergenic
1180883254 22:19221567-19221589 CTGGAGTCCCAGATTCAGGAAGG - Exonic
1180993448 22:19952515-19952537 CTGTAGTCCCAGCTACTGGGAGG + Intronic
1181103375 22:20556421-20556443 CTGTAGTCCCAGGTAGTCGGAGG - Intronic
1181151128 22:20884208-20884230 CTGTAATCCCAGCTATCGGGTGG + Intronic
1181284182 22:21740158-21740180 CTGTAGTCCCAGGTACTTGGGGG + Intergenic
1181293648 22:21817722-21817744 CTGTAGTCCCAGCTATTTGGGGG + Intronic
1181600724 22:23950269-23950291 CTGTAGTCCCAGCTACTTGAGGG - Intergenic
1181607789 22:23991053-23991075 CTGTAGTCCCAGCTACTTGAGGG + Intergenic
1181687789 22:24541505-24541527 CTGTAGTCCCAGCTAGTGGGGGG + Intronic
1181846659 22:25715387-25715409 CTGTAGTCCCAGGGACTGGGGGG + Intronic
1181974552 22:26719711-26719733 CTGTAGTCCCAGTTACAGGCTGG + Intergenic
1182094778 22:27618675-27618697 CTGTAGTCCCAGCTACTTGAGGG + Intergenic
1182460552 22:30480667-30480689 CTGTAGTCCCAGCTACTTGAGGG + Intergenic
1182461633 22:30487585-30487607 CTGTAGTCCCAGCTACTCGAGGG - Intergenic
1182489367 22:30660428-30660450 CTGTAGTCCCAGCTATTTGTTGG - Intronic
1182628857 22:31668983-31669005 CTGTAATCTCAGCTATAGGGAGG + Intergenic
1182725247 22:32440255-32440277 CTTTAGTCCCAGCTACAGGGAGG - Intronic
1182832053 22:33312316-33312338 CTGTAGTCCCAGCTATTGGGAGG + Intronic
1182849281 22:33458226-33458248 CTGTAGTCCCAGCTACTGGGAGG - Intronic
1183163500 22:36130620-36130642 CTGGCGACCCAGGTATAGAAGGG - Intergenic
1183477935 22:38046304-38046326 CTGTAGCCCCATGTAGAGAATGG + Intergenic
1183505987 22:38209185-38209207 CTGTAGTCCCAGCTATCAGGAGG - Intronic
1183514975 22:38260031-38260053 CTGTAGTCCCAGTTACTGGGAGG - Intronic
1183569764 22:38644022-38644044 CTGTAGTTCCAGCTATCGGGAGG + Intronic
1183756151 22:39767365-39767387 CTGTAGTCCCAGCTACTGGGAGG + Intronic
1183851912 22:40596682-40596704 CTGTAGTCCCAGGTACTCGGAGG + Intronic
1183994039 22:41620240-41620262 TTGCAGTCCCAGGGATAGGTGGG - Intronic
1184008481 22:41728736-41728758 CTGTAGTCCCAGCTACTTGAGGG + Intronic
1184209566 22:43027535-43027557 CTGTAGTCCCAGCTACTTGAGGG - Intergenic
1184268962 22:43366668-43366690 CTGTAGTCCCAGCTACCGGGAGG - Intergenic
1184506440 22:44906608-44906630 CTGTAGGCCCTGGGACAGGAGGG + Intronic
1184985834 22:48133017-48133039 CTGTAGTCCCAGCTATCGGGAGG + Intergenic
1185327190 22:50232433-50232455 CTGTAGTCCCAGCTACATGGAGG + Intronic
949443916 3:4113404-4113426 CTGTAGTCCCAGCTATGTGGGGG + Intronic
949708583 3:6847409-6847431 CTGTAGTTCCAGCTATTTGAGGG - Intronic
950007581 3:9701411-9701433 CTGTAGTCCCAGCTACTTGAGGG + Intronic
950056781 3:10031378-10031400 CTGTAGTCCCAGCTACTGGGAGG + Intronic
950242418 3:11383569-11383591 CTGTAGTCCCAGCTATTTGTGGG - Intronic
950515838 3:13464598-13464620 CTGTAGTCCCAGCTATATTCAGG - Intergenic
950659666 3:14459399-14459421 CTGGAGTCCCAGGTCTTGCAGGG - Intronic
950795884 3:15510583-15510605 CTGTAATCCCAGCTACTGGAAGG + Intronic
950975947 3:17245068-17245090 CTGTAGTCCCAGCTACTTGAGGG + Intronic
951173308 3:19568536-19568558 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
951208831 3:19952089-19952111 CTGTAGTCCCAGGTATTTGGAGG + Intronic
951210161 3:19965853-19965875 CTGTAGTCCCAGCTACTGGGCGG - Intronic
951216061 3:20026342-20026364 CTGTAATCCCAGCTACACGAGGG + Intergenic
951312951 3:21151843-21151865 CTGAAGTCTCAGGTAATGGAGGG - Intergenic
951357297 3:21683493-21683515 CTGTAGTCCCAGCTACTCGAAGG + Intronic
951456971 3:22903714-22903736 CTGTAATCCCAGCTACAGGCCGG + Intergenic
951554089 3:23903234-23903256 CTGTAGTCCCAGCTACTTGAAGG - Intronic
951560193 3:23958516-23958538 CTGTAGTCCCAGCTCTTGGGAGG + Intronic
951741146 3:25925121-25925143 CTGTAGTCCCAGCTATTGGGAGG - Intergenic
951944727 3:28123005-28123027 TTGTAGCCCCAGGGATGGGAAGG + Intergenic
952148800 3:30563497-30563519 CTGTAGTCCCAGCTATTCGGAGG + Intergenic
952800201 3:37283646-37283668 CTGTAGTCCCAGCTACTTGAGGG - Intronic
952927458 3:38331174-38331196 CTGTAGTCCCAGCTATTGGGAGG - Intergenic
953236418 3:41111383-41111405 CTGTAGGACCAGGTAGAGGCTGG + Intergenic
953328057 3:42029359-42029381 CTGCAGTCCCAGCTACTGGAGGG - Intronic
953332891 3:42069207-42069229 CTGTAGTCTCAGCTACAGGTGGG + Intronic
953511383 3:43543509-43543531 CTGTAGTCCCAGCTACTGGGAGG - Intronic
953620276 3:44526941-44526963 CTGTAGTCCCAACTACTGGAGGG + Intergenic
953762480 3:45700792-45700814 CTGTAGTCCCAGCTATTGGGAGG - Intronic
953804531 3:46056594-46056616 CTGTAGTCCCAGTTATTTGAGGG - Intergenic
953940411 3:47090123-47090145 CTGTAGTACCAGCTATCGGGAGG + Intronic
954075178 3:48173094-48173116 CTGTAGTCCCAGCTACTGGGAGG + Intronic
954160783 3:48720246-48720268 CTGTAGTCCCAGGTGTAGCGTGG + Intronic
954282986 3:49597450-49597472 CTGTAGTCCCAGCTACTGGCAGG - Intronic
954477316 3:50759725-50759747 CTGTAGTTCCAACTACAGGAAGG + Intronic
954738415 3:52726781-52726803 CTGTAGTCCCAGCTACTCGAAGG + Intronic
955196015 3:56805355-56805377 CTGTAGTCCCAGCTACTTGAGGG - Intronic
955350676 3:58190919-58190941 CTGTAGTCCCAGCTACTGGGAGG - Intergenic
955388896 3:58504475-58504497 CTGTGGTCCCAGCTATAGGGAGG - Intergenic
955840940 3:63112091-63112113 CTGTAGTCCCAGCTACTGGGGGG - Intergenic
955921633 3:63963036-63963058 CTGTAGTCCCAGGTACTGGAAGG - Intronic
956101774 3:65775818-65775840 CTGTAGTCCCAGCTATGCAATGG + Intronic
956137595 3:66114449-66114471 CTCTACTCCCAGGTACTGGAAGG + Intergenic
956286731 3:67618295-67618317 CTGTAGTCCCAGCTACAGGGAGG + Intronic
956395262 3:68819147-68819169 CTGCAGTCCCAGCTATCTGAAGG + Intronic
956397371 3:68840329-68840351 CTGTGGTCCCAGTTATATGGAGG - Intronic
956684011 3:71807518-71807540 CTGTAGTCCCAGCTACATGAGGG - Intergenic
956695516 3:71915964-71915986 CTGTAGTCCCAGCTACCAGAGGG - Intergenic
956800000 3:72748566-72748588 CTGTAGTCCCAGGTACTTGGGGG + Intergenic
957478701 3:80761458-80761480 CTGTAGTCCCAGTACTAGGCAGG + Intergenic
957504480 3:81101719-81101741 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
957580791 3:82070054-82070076 CGGTAGTCCCAGCTACAGGGAGG + Intergenic
957706191 3:83788539-83788561 CTGTAGTCCCAGCTATTCGGGGG - Intergenic
957778064 3:84781690-84781712 CTGTAGTCCCAGCTACTTGAGGG + Intergenic
957842080 3:85685004-85685026 CTGTAATCCCAGCAAGAGGAGGG + Intronic
957924273 3:86788607-86788629 CTGTAATCCCAGCTACTGGAGGG - Intergenic
958145599 3:89620583-89620605 CTGTATTCACAGGTGTAGCAAGG - Intergenic
958579320 3:95997152-95997174 CTGGATTCCCAGATATAGAAAGG - Intergenic
958707036 3:97668789-97668811 CTGTAGTCCCAGCTCTCGGGAGG + Intronic
958933298 3:100230517-100230539 CTGTAGTCCCAGCTATTCGGAGG + Intergenic
958958813 3:100489879-100489901 CTGTAGTCTCAGGTACAGGTGGG - Intergenic
959066537 3:101662884-101662906 CTGTAGTCCCAGCTATTTGTTGG - Intronic
959302065 3:104615454-104615476 CTGTAGTCCCAGCTATCAGGAGG - Intergenic
959303137 3:104627958-104627980 CTGTAGTCCCAGCTACCGGGAGG + Intergenic
959469751 3:106735895-106735917 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
959564006 3:107815803-107815825 CTGTAGTCCCAGCTATCAGGAGG - Intergenic
959984605 3:112558859-112558881 CTGTAATCCCAGCTACAGGCAGG - Intronic
960042060 3:113160675-113160697 CTGTAGTCCCAGTTACTGGGAGG - Intergenic
960533048 3:118786921-118786943 CTGTAATCCCAGCTATCGGGAGG - Intergenic
960683026 3:120268656-120268678 CTGTAGTCCCAGCTACTTGATGG - Intronic
960884669 3:122382340-122382362 CTGTAGTCCTAGCTACAGGGAGG + Intronic
960918365 3:122720848-122720870 CTGTAGTCCCAGCTATTGGGAGG + Intronic
961030305 3:123597216-123597238 CTGTAGTCCCAGTTATCGGAAGG - Intergenic
961407812 3:126694434-126694456 CTGTAGTCCCAGCTATCGAGAGG - Intergenic
961442846 3:126962946-126962968 CTGTGGTCCCTGGTATAGGCAGG + Intergenic
961790693 3:129374582-129374604 CTGTAGTCCCAGCTACACGGAGG - Intergenic
961807090 3:129497144-129497166 CTGTAGTCCCAGCTACTGGGAGG + Intronic
961997561 3:131262262-131262284 CTGTAGTCCCAGCTATTGGGAGG + Intronic
962113907 3:132481456-132481478 CTGTAGTCCCAGCTACTTGAGGG + Intronic
962231233 3:133667233-133667255 CTGTAGTCCCAGGTACTGGGAGG + Intergenic
962235681 3:133705150-133705172 CTGTAATCCCAGCTACAGGGAGG + Intergenic
962581115 3:136798840-136798862 CTGTAGTCCCAGCTATTAGGGGG - Intergenic
962765886 3:138561899-138561921 CTGTAGTCCCAGCTATTGGGAGG + Intronic
963006297 3:140728864-140728886 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
963407586 3:144887016-144887038 CTGTAGTCCCAGCTATCGGGAGG - Intergenic
963573957 3:147035360-147035382 CTGTAGTCCCAGCTACTTGATGG + Intergenic
963748621 3:149151128-149151150 CTGTAGTCCCAGCTACTTGAGGG - Intronic
963805459 3:149717043-149717065 CTGTAGTCCCAGCTATCTGGGGG + Intronic
964013810 3:151922393-151922415 CTGTAGTCCCAGCTATCAGGAGG - Intergenic
964014893 3:151932916-151932938 CTGTAATCCCTGCTATAGGGAGG + Intergenic
964065796 3:152577294-152577316 CTGTAATCCCAGCTACTGGAGGG + Intergenic
964069210 3:152611510-152611532 CTGTAGTCCCAGCTACAGGTGGG - Intergenic
964369268 3:155982838-155982860 CTGTAGTCCCAGCTACTCGAGGG + Intergenic
964571953 3:158117418-158117440 CTGTAGTCCCAGCTACTTGAGGG - Intronic
964660396 3:159114431-159114453 CTGTAGTCCCAGCTATGAGGGGG - Intronic
964718601 3:159749189-159749211 CTGTAGTCCCAGCTACTGGTGGG + Intronic
965191717 3:165538892-165538914 CTGTAATCCCAGAAATTGGAAGG - Intergenic
965368548 3:167830132-167830154 CTGTAGTCCCAGCTACTCGAGGG + Intergenic
965550533 3:169960507-169960529 CTGTAGTCCCAGCTACAGGGAGG - Intergenic
965981659 3:174699368-174699390 CTGTAGTCCCAGCTACTTGAAGG + Intronic
966123124 3:176545727-176545749 CTGTAGTCCCAGCTACATGGGGG + Intergenic
966189847 3:177262251-177262273 CTGTAGTCCCAGGCTGAGGCAGG - Intergenic
966363924 3:179161573-179161595 CTGTAATCCCAGCTATCGGGAGG + Intronic
966555020 3:181249438-181249460 CTGTAGTCCCAGCTCTTGGGAGG - Intergenic
966629432 3:182056155-182056177 CTGTAGTCCCAGCTACTGGGAGG - Intergenic
966837964 3:184064129-184064151 CTGTAGTCCCAGCTACTTGAGGG + Intergenic
967066379 3:185920664-185920686 CTGTAGTCCCAGCTACTGGCAGG - Intronic
967157379 3:186705835-186705857 ATGTACTCACAGGTGTAGGAAGG - Intergenic
967733992 3:192933206-192933228 CTGTAGTCCCAGCTACAGGGAGG - Intergenic
967974275 3:195023389-195023411 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
968337146 3:197923606-197923628 CTGTAGTCCCAGCTATCTGGGGG + Intronic
968665756 4:1821564-1821586 CTGTACTCCCAGATATTGGGAGG + Intronic
968733406 4:2282819-2282841 CTGTAGTCCCAGCTACGGGGAGG + Intronic
968768559 4:2488339-2488361 CTGTAGTCCCAGCTACTGGGAGG + Intronic
968792875 4:2680440-2680462 CTGTAATCCCAGCTATTGGGGGG - Intronic
968843428 4:3025146-3025168 CTGTAGTCCCAGCTACTTGAGGG + Intronic
968888929 4:3356175-3356197 CTGTACTCCCAGCTATATGAGGG - Intronic
969045427 4:4333191-4333213 CTGTAGTCCCAGCTATTCGGGGG + Intergenic
969294408 4:6261329-6261351 CTGTAGTCCCAGCTACAGGGTGG + Intergenic
969621708 4:8281973-8281995 CTGTAGCCCCAGGGCTCGGAGGG + Intronic
969815730 4:9686020-9686042 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
970074461 4:12201678-12201700 CTGTAGTCCCAGTTACTGGTGGG + Intergenic
970577375 4:17440676-17440698 CTGTAATCCCAGCTACAGGGAGG + Intergenic
970843813 4:20511541-20511563 CTGTAGTCCCAGCTACCGGGAGG - Intronic
971116580 4:23653605-23653627 CTGTAGTCCCAGCTACCGGGAGG + Intergenic
971278218 4:25217808-25217830 CTGTAGTCCCAGCTACTCGAGGG - Intronic
971319271 4:25592211-25592233 CTGTAATCCCAGGTAGAGATGGG + Intergenic
971322589 4:25617259-25617281 CTGTAATCCCAGCTATTGGGAGG + Intergenic
971329386 4:25670098-25670120 CTGTAGTCCCAGCTATGTGGGGG + Intronic
971456693 4:26851836-26851858 CTGTAGTCCCAGCTATTGGGAGG - Intergenic
972037761 4:34548095-34548117 CTGTAGTCCCAGCTATTTGGAGG + Intergenic
972209059 4:36814825-36814847 CTGTAGTCCCAGCTACCGGGAGG + Intergenic
972353270 4:38257501-38257523 CTGTAGTCCCAGGTACTCGGGGG - Intergenic
972441472 4:39098009-39098031 CTGTAGTCCCAGCTACACGTGGG + Intronic
972479403 4:39483698-39483720 CTGTAGTCCCAGCTATTTGGGGG - Intergenic
972499776 4:39667179-39667201 CTGTAGTCCCAGCACTAGGGAGG + Intergenic
972513809 4:39794121-39794143 CTGTAGTCCCAGCTACTTGAGGG - Intergenic
972533497 4:39980615-39980637 CTGTAGTCCCAGATCTTGGGAGG - Intergenic
972545901 4:40080457-40080479 CTGTAGTCCCAGACAGAGGCAGG - Intronic
972547206 4:40091729-40091751 CTGTGGTCCCAGGTACTGGTGGG - Intronic
973099109 4:46240222-46240244 CTGTAGTCCCAGTTATCGGGAGG + Intergenic
973202245 4:47517292-47517314 GTGTAGTCCCAGATATTGGGAGG + Intronic
973288498 4:48446241-48446263 TTGTAGTCCCAGTTACAGGGAGG - Intergenic
973620072 4:52717371-52717393 CTGTAGTCCCAGCTCTCGGGAGG - Intergenic
973756208 4:54076164-54076186 CTGTAGTCCCAGTTATTTGGGGG + Intronic
974118678 4:57611810-57611832 CTGTAGTCCCAGGGGGATGAGGG + Intergenic
974159533 4:58119822-58119844 CTGTAGTCCCAGCTACATGAGGG - Intergenic
974388041 4:61228812-61228834 CTGTAATCCCAGCTCTAGGGAGG - Intronic
974422134 4:61690319-61690341 CTGTGGTCCCAACTATAGGGAGG + Intronic
974654146 4:64797996-64798018 CTGTAATCCCAGCTATTGGGTGG - Intergenic
975576241 4:75865506-75865528 CTGTAGACCCAGCTATTGGGAGG - Intronic
975804544 4:78098395-78098417 CTGTAGTCCCAGCTACTGGGAGG - Intronic
975914646 4:79309836-79309858 CTGTAGTCCCAGCTACTGGAGGG - Intronic
976089026 4:81435899-81435921 CTGTAGTCCCAGGTATAGGAGGG - Intronic
976279233 4:83310547-83310569 CTGTAGTCCCAGCTATTTGTGGG + Intronic
976310034 4:83602208-83602230 CTGTAGTCTCAGACACAGGAAGG + Intronic
976407617 4:84677838-84677860 CTATAGTCCCAGTTATTTGAGGG + Intronic
976447301 4:85145826-85145848 CTGTAGTCCCAGCTACTTGAGGG + Intergenic
976641263 4:87341292-87341314 CTGTAGTCCCAGCTACTTGAGGG - Intronic
976644600 4:87374196-87374218 CTGTAGTCCCAGCTACTTGAGGG + Intronic
977183438 4:93905887-93905909 CTGTAATCCCAGATATTGGTAGG - Intergenic
977342299 4:95774060-95774082 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
977508273 4:97930019-97930041 CTGTAGTCCCAGGTATCGGGAGG - Intronic
977613048 4:99056690-99056712 CTGTAGTCCCAGCTACCGGGAGG - Intronic
977656376 4:99525670-99525692 CTGTAGTCCCAGCTACTGGGAGG + Intronic
977926307 4:102704298-102704320 CTGTAGTCCCAAGTATTCGGAGG - Intronic
978222899 4:106298486-106298508 CTGTAGTCCCAGCTACTCGATGG + Intronic
978428458 4:108606600-108606622 CTGTAGTCCCAGCTACTTGAGGG - Intergenic
978462042 4:108966726-108966748 CTGTAGTCCCAGCTATTCGGGGG + Intronic
978502337 4:109422825-109422847 CTGTAGTCCCAGGGCTTGGGAGG - Intergenic
978528442 4:109690398-109690420 CTATAGTCCCAGCTACAGGGGGG + Intronic
978573613 4:110166488-110166510 CTGTAGTCCCAGCTACTAGAAGG + Intronic
978732080 4:112039562-112039584 CTGTAGTCCCAGCTATTCGGGGG + Intergenic
978762733 4:112372333-112372355 CTGTAGTCACAGCTATTGGGAGG - Intronic
979540443 4:121874873-121874895 CTGTAGTCTCAGCTATTTGAAGG + Intergenic
979803922 4:124946999-124947021 CTGTAGTCCCAGCTATTGGGGGG - Intergenic
980105654 4:128585734-128585756 CTGTAGTCCCAGCTACCGGGTGG + Intergenic
980131881 4:128824306-128824328 CTGTAGTCCCAGGCTGAGGCAGG + Intronic
980278008 4:130680204-130680226 CTGTAGTCCCAGCTACTCGAGGG + Intergenic
980539662 4:134177296-134177318 CTGTAGTCCCAGCTGTTGGGAGG - Intergenic
980573252 4:134651165-134651187 CTGTAATCCCAGCTATAGGGAGG - Intergenic
980645526 4:135637463-135637485 CAGTATTCCCACATATAGGATGG + Intergenic
980994316 4:139765863-139765885 CTGTAGTCCCAGGTACTAGGTGG + Intronic
981256340 4:142664422-142664444 ATGCAGTGCCAGGTATTGGATGG - Intronic
981267417 4:142803045-142803067 CTGTAATCCCAGCTACAGGGCGG + Intronic
981295955 4:143131657-143131679 CTGTAGTCCCAGCTACTCGAGGG + Intergenic
981312467 4:143310749-143310771 CTGTAGTCCCAGGTACTCGGGGG + Intergenic
981314762 4:143331278-143331300 CTGTAGTCCCAGCTACTGGGTGG + Intergenic
981690291 4:147500593-147500615 CTGCAGTCCCAGCTACTGGAAGG + Intronic
981716460 4:147757314-147757336 CTGTAGTCCCAGCTTTCGGGAGG - Intronic
981843105 4:149135301-149135323 CTGTAGTCCCAGCTACTCGAGGG + Intergenic
982003284 4:151040765-151040787 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
982019871 4:151192064-151192086 CTGTAGTCCCAGCTGTGGGGAGG - Intronic
982250946 4:153405924-153405946 CTGTAGTCCCAGGTACTCGGAGG - Intronic
982359549 4:154504918-154504940 CTGTAGACCCAGCTATTGGGAGG - Intergenic
982814015 4:159862881-159862903 CTGTAATCCCAGCTATTTGAGGG + Intergenic
983109297 4:163728099-163728121 CTGTAGTCCCAGCTACAGTGTGG - Intronic
983378209 4:166957130-166957152 CTGTAGTCCCAGCTACTGGGAGG + Intronic
983901591 4:173141664-173141686 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
984072752 4:175135916-175135938 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
984161415 4:176256814-176256836 CTGTAGTCCCAGCTACATGGGGG + Intronic
984261682 4:177450565-177450587 CTGTAGTCCCAGCTATTAAATGG + Intergenic
984284265 4:177709197-177709219 CTGTAATCCCAGCTATTGGGAGG + Intergenic
984477178 4:180250260-180250282 CTGTAGTCCCAGGTATTGGGAGG + Intergenic
984490912 4:180433354-180433376 CTGTAGTCCCAGGCTGAGGCAGG - Intergenic
984523351 4:180826654-180826676 CTGTAGTCCCAGCTACTTGAGGG + Intergenic
984536243 4:180979402-180979424 CTGTAGTCCCAGGTGCTTGAGGG - Intergenic
984653898 4:182297188-182297210 CTGTGGCCCCAGTTATATGATGG - Intronic
984783047 4:183543312-183543334 CTGTAGTCCCAGCTACTTGAAGG + Intergenic
984939740 4:184920504-184920526 CTGTAGTCCCAGGTACCCAAGGG + Intergenic
984974803 4:185220987-185221009 CTGTAGTCCCAGCCATTGGCGGG - Intronic
985314163 4:188636934-188636956 CTGTAGTCCCAGCTACGGGGAGG + Intergenic
985483530 5:135064-135086 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
985555599 5:556487-556509 CTGTAGTCCCAGCTACTGGGGGG - Intergenic
986781351 5:11068792-11068814 CTGTAGTCCCAGCTATGTGGGGG + Intronic
986813300 5:11382474-11382496 CTGTAATCCCAGCTATCGGGAGG + Intronic
987026028 5:13927367-13927389 CTGTAGTCCCAGCTACAGGCTGG + Intronic
987085932 5:14467689-14467711 CGGTAGTCCCAGCTATCGGGAGG + Intronic
987210134 5:15673067-15673089 CTGTAATCCCAGGCCGAGGAAGG + Intronic
987593510 5:19964473-19964495 CTGTAGTCCCAGCTACTTGAGGG + Intronic
987627402 5:20419598-20419620 CTGTAGTCCCAGCTACTGAAGGG - Intronic
987685486 5:21194640-21194662 CTGTAGTCCCAGTTAGTCGAAGG + Intergenic
988717052 5:33838558-33838580 CTGTAGTCCCAGCTATGTGGAGG + Intronic
988737006 5:34032672-34032694 CTGTAATTCCAGCTATAGGGAGG + Intronic
988883933 5:35534625-35534647 CTGTAGTCCCAGTTATTTGGAGG + Intergenic
989018314 5:36967972-36967994 CTGTAGTCCCAGCTATTTGGAGG + Intronic
989052562 5:37335827-37335849 CTGTAGTCCCAGCTACATGGCGG + Intronic
989054166 5:37350679-37350701 CTGTAATCCCAGCTATTGGGAGG + Intronic
989219271 5:38937153-38937175 CTGTAGTCCCAGCTACAGGGAGG - Intronic
989315046 5:40068770-40068792 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
989463099 5:41724244-41724266 CTGTAGTCCCAGCTACTTGAGGG - Intergenic
989587319 5:43085598-43085620 CTGTACTCCCAGCTACAGGTAGG + Intronic
989721831 5:44538180-44538202 CTGTAGTCCCAGCTACTGGGGGG + Intergenic
990410610 5:55537365-55537387 CTGTAGTCCCAGCTACATGGAGG + Intergenic
990598099 5:57331191-57331213 CTGTAGTCCCAGCTACTTGAGGG + Intergenic
990958342 5:61366015-61366037 CTGTAGTCCCAGCTACTGGTGGG - Intronic
991061612 5:62382317-62382339 CTGTAGTCCCAGCTATTGGGAGG + Intronic
991078874 5:62573138-62573160 CTGTAGTCCCAGCTACAAGCCGG - Intronic
991253548 5:64589803-64589825 CTATAGTCCCAGCTATTGGGAGG + Intronic
991509066 5:67356759-67356781 CTGTAGTCCCAGCTACATGGGGG - Intergenic
991709479 5:69394181-69394203 CTGTAGTCCCAGCTACTAGATGG - Intronic
991732838 5:69605583-69605605 CTGTAGTCCCAGCTATTGTGGGG + Intergenic
991809272 5:70460727-70460749 CTGTAGTCCCAGCTATTGTGGGG + Intergenic
991862117 5:71022269-71022291 CTGTAGTCCCAGCTATTGTGGGG - Intronic
992175024 5:74141462-74141484 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
992660215 5:78952457-78952479 CTGTAGTCCAAGCTACTGGAGGG - Intronic
992695209 5:79279209-79279231 CTGTAGTCCCAGCTACTCGAAGG + Intronic
992751328 5:79865479-79865501 CTGTAGTCCCAGGTTGAGGTGGG - Intergenic
992812803 5:80407083-80407105 CTGTAGTCCCAGCTACTGGCTGG - Intergenic
993024595 5:82630806-82630828 CTGTAGTCCCAGCTATCCGGAGG - Intergenic
993978551 5:94512772-94512794 CTGTAGTCCCAGCTACTGGGAGG + Intronic
993990265 5:94648187-94648209 CTTTGGTCCCAGTAATAGGAAGG + Intronic
993994264 5:94702174-94702196 CTGTTGTCACAGTTATGGGAGGG + Intronic
994014376 5:94947736-94947758 CTGTGGTCCCAGCTCTAGGGAGG - Intronic
994628419 5:102250863-102250885 CTGTAGTCCCAGTTCTCGGGAGG + Intronic
994803053 5:104404628-104404650 CTGTAGTCCCAGCTCTTGGGAGG - Intergenic
994943992 5:106361582-106361604 CTGTAATCCCAGCTATCGGGAGG - Intergenic
995109423 5:108412417-108412439 CTGTAGTCCCAGCTACTGGAGGG - Intergenic
995496125 5:112745688-112745710 CTGTAGTCCCAGCTATGGTGTGG - Intronic
996578320 5:125000855-125000877 CTCTAGTCCCAGCTATGGGGAGG + Intergenic
996721013 5:126630162-126630184 CTGTGGTCCCAGCTATTGGGAGG + Intergenic
996741275 5:126801104-126801126 CTGTAGTCCCAGCTACTAGAGGG - Intronic
997402927 5:133616522-133616544 CTGTAGTCCCAGCTATTGGGAGG - Intergenic
998071230 5:139199272-139199294 CTGTGGTCCCAGCTACTGGATGG - Intronic
998082459 5:139288091-139288113 CTGTAGTCCCAGGTACTCGGAGG + Intronic
998303323 5:141047912-141047934 CTGTAGTCCCAGTTACTTGAGGG - Intergenic
998386367 5:141759350-141759372 CTGTAGTCCCAGCTACTGGTGGG - Intergenic
998434109 5:142092658-142092680 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
998660730 5:144234416-144234438 TTGTAATCCCTGGAATAGGAAGG - Intronic
998800420 5:145863742-145863764 TTGTAATCCCAGGCAGAGGAGGG - Intronic
999162219 5:149511204-149511226 CTGTAGTCCCAGCTACAGGTAGG + Intronic
999207044 5:149856498-149856520 CCGTAGTGCAAGGAATAGGATGG + Intergenic
999291032 5:150426529-150426551 CTGTAATCCCAGCTACAGGCTGG - Intergenic
999681048 5:154060476-154060498 CTGTAGTCCCAGCTACAGGCAGG - Intronic
999792357 5:154953231-154953253 CTGTAGTCCCAGCTACTGGGAGG + Intronic
1000064336 5:157682202-157682224 CTGTAATCCCAGCTATTGGGAGG - Intergenic
1000083035 5:157865228-157865250 CTGTAGTCCCAGCTAAATGGAGG + Intergenic
1000313723 5:160069160-160069182 CTGTAGTCCCAGCTACTTGAGGG + Intronic
1000315576 5:160087257-160087279 CAGTAGTCCCAGCTATGGTAGGG + Intronic
1000340137 5:160270486-160270508 CTGTGGTCCCAGGTACTGGGAGG + Intronic
1000597474 5:163232439-163232461 CTGTATTCCCAGCTACAGGCTGG - Intergenic
1000880244 5:166689183-166689205 CTGTAGTCCCAGCTATTCGGAGG - Intergenic
1001083661 5:168685070-168685092 CTGTAATCCCAGCTATTGGGAGG - Intronic
1001107140 5:168864085-168864107 CTGTAGTCCCAGCTACTGCAGGG + Intronic
1001199291 5:169701443-169701465 CTGAAGTCTCAGGTAAAGCATGG - Intronic
1001344337 5:170877385-170877407 CTGTAGTCCCAGCTATTAGAGGG - Intronic
1001410942 5:171511168-171511190 CTGTAGTCCCAGCTACTAGAGGG - Intergenic
1001502248 5:172246564-172246586 CTGTAGTCCCAGCTTTTGGGAGG - Intronic
1001624073 5:173115725-173115747 CTGTAGTCCCAGCTACTGGGAGG - Intronic
1001915854 5:175559439-175559461 CTGCAGTCCCAGCTACAGGCTGG - Intergenic
1001968732 5:175936650-175936672 CTGTAGTCCCAGCTACTGGGAGG - Intronic
1002012436 5:176294399-176294421 CTGTAGTCCCAGCTACTTGAAGG - Intronic
1002033090 5:176445396-176445418 CTGTAGTCCCAGGCCGAGGCAGG - Intergenic
1002129510 5:177071561-177071583 CTGTAGTCCCAGCTACCGGGAGG + Intronic
1002215388 5:177628204-177628226 CTGTAGTCCCAGCTACTTGAAGG + Intergenic
1002248711 5:177907087-177907109 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
1002291374 5:178203312-178203334 CTGTAGTCCCAGTTACCGGGAGG - Intergenic
1002492286 5:179587173-179587195 CTGTAGTCCCAGCTACTGGGAGG - Intronic
1002589344 5:180278575-180278597 CTGTAGTCCCAGCTACCGGGAGG + Intronic
1002627043 5:180536731-180536753 CTGTAGTCCCAGCTACTTGAGGG - Intronic
1002646822 5:180661909-180661931 CTGTAGTCCCAGCTACTGGGGGG - Intergenic
1002823433 6:750733-750755 CTGTAATCCCAGCTATCGGGAGG - Intergenic
1002977590 6:2098179-2098201 CTGTAATCCCAGCTACAGGGAGG - Intronic
1003042010 6:2696935-2696957 CTGTAGTCCCAGCTATCAGGAGG + Intronic
1003455067 6:6274691-6274713 CAGTAGTCCCAGGAAGAGGCTGG - Intronic
1004036454 6:11929032-11929054 CTGTACTCCCAGCTACAGGAGGG - Intergenic
1004104494 6:12653320-12653342 CTGTAGTCCCAGCTACTTGAGGG + Intergenic
1004214135 6:13685803-13685825 CTGTAGTCCCAGCTAATGGGAGG + Intronic
1004224560 6:13773748-13773770 TTGTAGTCTCAGCTATATGAAGG + Intergenic
1004381637 6:15137737-15137759 CTGTAGTCCCAGCTATTCCAGGG + Intergenic
1004415276 6:15417619-15417641 CTGTAGTCCCAGTTACAGGAGGG + Intronic
1004454279 6:15777279-15777301 CTGTAGTCCCAGCTATCAGGAGG + Intergenic
1004641593 6:17521294-17521316 CTGTAGTCCCAGCTACCGGGAGG + Intronic
1004724048 6:18294010-18294032 CTGTAGTCCCAGCTACCGGGAGG - Intergenic
1004863567 6:19832153-19832175 CTGTAGTCCCAGCTACTGGGGGG - Intergenic
1004893452 6:20123933-20123955 CTGTAGTCCCAGCTACTGGGAGG + Intronic
1004933934 6:20489339-20489361 ATGTAGTCCCAGCTATAGGGAGG + Intronic
1004992684 6:21156299-21156321 CTGTAGTCCCAGCTACTGGCAGG + Intronic
1005079778 6:21945139-21945161 CTGTAGTCCCAGCTACTTGAGGG - Intergenic
1005180561 6:23100246-23100268 CTGTAGTCCCAGGTACTTGGGGG - Intergenic
1005515117 6:26547356-26547378 CTGTAGTCCCAGGTACTCGGAGG - Intergenic
1005722726 6:28618678-28618700 CTGTAGTCCCAGCTATTTGGGGG + Intergenic
1005740604 6:28787231-28787253 CTGTAGTCCCAGCTACGGGGAGG - Intergenic
1005751979 6:28891958-28891980 CTGTAGTCCCAGCTACTCGAGGG - Intergenic
1005911138 6:30310553-30310575 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
1006322416 6:33327735-33327757 CTGTAGTCCCAGCTATTTGGGGG + Intronic
1006354487 6:33546676-33546698 CTGTAGTCCCAGATACAGGCAGG - Intergenic
1006367481 6:33623956-33623978 CTGGAGTTCCAGGTATGGGAAGG - Intronic
1006504691 6:34481166-34481188 CTGTAGTCCCAGCTCTCGGGGGG - Intronic
1006545904 6:34781091-34781113 CTGTAGTCCCAGCTACTCGAAGG - Intergenic
1006612912 6:35305693-35305715 CTGTAATCCCAGTTACAGGGAGG - Intronic
1006647798 6:35527016-35527038 CTGTAGTCCCAGCTACTGGAGGG + Intergenic
1006990887 6:38213858-38213880 CTGTAGTCCCAGCTACAGGCTGG + Intronic
1006999474 6:38295924-38295946 CTGTAATCCCAGCTATTGGGAGG + Intronic
1007080407 6:39097996-39098018 CTGTAATCCCAGCTATTGGGAGG - Intergenic
1007350589 6:41270826-41270848 CTGTAGTCCCAGCTATGTGGTGG - Intronic
1007460429 6:42014242-42014264 CTGTAGTCCCAGCTACTGGGAGG + Intronic
1007474656 6:42111232-42111254 CTGTAGTCCCAGCTACAGATGGG - Intronic
1007485339 6:42177439-42177461 CCGTATTCCCAGGTATAAAATGG - Intronic
1007502568 6:42309896-42309918 TTGTAGTCCCAGGTTGAGGCGGG - Intronic
1007547258 6:42703976-42703998 CTGTAGTCCCAGCTATCGGGAGG + Intronic
1007759089 6:44121815-44121837 CTGTAGTCCCAGCTACAGCCCGG + Intronic
1008161252 6:48078994-48079016 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
1008187304 6:48409964-48409986 CTGTAGTCCCAGCTATTTGAGGG + Intergenic
1008199003 6:48563200-48563222 CTGTAATCCCAGGTTTTGGGAGG + Intergenic
1008508308 6:52252646-52252668 CTGTAGTCCCAGCTACTTGAGGG + Intergenic
1008568972 6:52796663-52796685 CTGTAATCCCAGCTATTGGGAGG - Intronic
1008611426 6:53187849-53187871 CTGTAATCCCAGCTACAGGCAGG + Intergenic
1008710379 6:54218639-54218661 CTGTAGTCCCAGCTACCGGGAGG - Intronic
1008877338 6:56343818-56343840 CTGTAGTCCCAGCTACTCGATGG + Intronic
1008936101 6:56994334-56994356 CTGTAGTCCCAGCTACTGGAAGG + Intronic
1009059477 6:58380730-58380752 CTGTAGTCCCAGCTACTGGGGGG + Intergenic
1009741469 6:67752549-67752571 CTGTAGTCCCAGCTCTTGGGAGG - Intergenic
1009965548 6:70574196-70574218 CTGTAATCCCAGCTATTGGGAGG + Intronic
1010002655 6:70963233-70963255 CTGTAGTCCCAGCTATTTGGGGG + Intergenic
1010032683 6:71287780-71287802 CTGTAATCCCAGCTATTGGGAGG + Intergenic
1010234419 6:73563385-73563407 CTGTAGTCCCAGCTACTGGGAGG - Intergenic
1010258801 6:73791318-73791340 CTGTAGTCCCAGTTATGCAAGGG - Intronic
1010405996 6:75506230-75506252 CTGTAGTCCCAGCTATTTGGGGG + Intergenic
1010736044 6:79444512-79444534 CTGTAGTCCCAGCTACTAGAGGG + Intergenic
1010737032 6:79454783-79454805 CTGTAATCCCAGTTACAGGGAGG - Intergenic
1010983804 6:82399658-82399680 CTGTAGTCCCAGCTATTCGTGGG + Intergenic
1011101570 6:83728162-83728184 CTGTAGTCCCTGGGAAGGGAAGG + Intergenic
1011272001 6:85589341-85589363 CTGTAGTCCCAGCTACATGGGGG - Intronic
1011313989 6:86011043-86011065 CTGTAATCCCAGCTATAGCGGGG + Intergenic
1011587499 6:88942490-88942512 CTGTAGTCCCAGCTACTGGGGGG - Intronic
1011955456 6:93019551-93019573 CTGTAGTCCCAGGACTTGGGAGG + Intergenic
1012161646 6:95891931-95891953 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
1012358713 6:98349448-98349470 CTGTAGTCCCAGCTACTCGAAGG + Intergenic
1012546834 6:100429245-100429267 CTGTAGTCCCAGCTACTTGAGGG + Intronic
1013108209 6:107043998-107044020 CTGTAGTCCCAGCTACTGGGAGG + Intronic
1013123430 6:107160468-107160490 CTGTAGTCCCAGGTACTTGGGGG - Intronic
1013154033 6:107476039-107476061 CTGTAGTCCCAGCTACCTGAAGG - Intergenic
1013299458 6:108790239-108790261 CTGTAGTCCCAGCTATTTGTTGG - Intergenic
1013555684 6:111254941-111254963 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
1013606262 6:111751741-111751763 CTGTAGTCCCAGGTACTGGGAGG - Intronic
1013611778 6:111802552-111802574 CTGTAGTCCCAGCTATCGGGAGG - Intronic
1014149343 6:118035809-118035831 CTGTAGTCCCAGCTATGTGGGGG - Intronic
1014235408 6:118948471-118948493 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
1014458977 6:121672455-121672477 CTGTAGTCCTAGCTATCTGAGGG + Intergenic
1014806024 6:125830565-125830587 CTGTAGTCCCAGTTACTGGCAGG + Intronic
1015028625 6:128567986-128568008 CTGTAGTCCCAGCTACTTGAAGG + Intergenic
1015690282 6:135914612-135914634 CTGTAGTCCCAGCTCTCGGGAGG - Intronic
1015777573 6:136829813-136829835 CTGTAGTCCCAGCTATTTGGTGG + Intronic
1015871045 6:137776579-137776601 CTGTAGTCCCAGGTATTCAGAGG + Intergenic
1015911901 6:138177209-138177231 CTGTAGTCCTAGCTACAGGGAGG - Intronic
1016341584 6:143067042-143067064 CTGTAGTCCCAGCTATGTGGGGG + Intronic
1016359784 6:143254913-143254935 CTGTAGTCCCAGCTGTCGGGAGG + Intronic
1016810898 6:148260482-148260504 CTGTAGTCCCAGCTCTTGGGAGG + Intergenic
1016833785 6:148456737-148456759 CTGTAGTCCCAGCTATTTGGGGG + Intronic
1016961124 6:149673795-149673817 CTGTAGTCCCAGCTATATGGAGG - Intronic
1017181429 6:151556331-151556353 CTGTAATCCCAGCTATTGGGAGG + Intronic
1017241544 6:152175069-152175091 CTGTAGTCCCAGGGATTGGGAGG + Intronic
1017256408 6:152338497-152338519 CTATAGTCCCAGCTATTGGGAGG + Intronic
1017491932 6:154952610-154952632 CTGTAGTCCCAGGCTGAGGCAGG - Intronic
1017603171 6:156105383-156105405 CTGTAGTCCCAGATACTTGAAGG + Intergenic
1017690906 6:156962902-156962924 CTGTAGTCCCAGCTACTGGGAGG - Intronic
1017696143 6:157018336-157018358 CTGTAGTCCCAGCTGTTGGGAGG - Intronic
1017742740 6:157421367-157421389 CTGTAGTCCCAGCTATTCGGAGG + Intronic
1017751837 6:157495825-157495847 CTGTAGTCCCAGGTACCCGGTGG - Intronic
1017915298 6:158826872-158826894 CTGTAGTCCCAGGTACTTGAGGG - Intergenic
1018289168 6:162272873-162272895 CTGTAATCCCAGCTACAGGCTGG + Intronic
1018451722 6:163915129-163915151 CTGTAGTCCCAGCTACTTGAAGG - Intergenic
1018476347 6:164145889-164145911 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
1018476693 6:164149606-164149628 CTGTAATCCCAGCTATCGGGAGG + Intergenic
1018663963 6:166116571-166116593 CTGTAGTTTCAGCTACAGGAAGG + Intergenic
1018673671 6:166200595-166200617 CTGTAGTCCCAGCTATCGGGAGG + Intergenic
1018754929 6:166840713-166840735 CTGTAATCCCAGGCTTAGGCGGG + Intronic
1018786636 6:167113496-167113518 CTGTAGTTCCAAGTATTGGAAGG + Intergenic
1019490951 7:1313071-1313093 CTGTAGTCCCAGTTACATGAGGG - Intergenic
1019688732 7:2397693-2397715 CTGTAATCCCAGCTATGGGGAGG - Intergenic
1019881554 7:3865629-3865651 CTGTAGTCCCAGTTACTTGAGGG - Intronic
1019982749 7:4633490-4633512 CTGTAGTCCCAGCTACTAGAAGG + Intergenic
1020031912 7:4939286-4939308 CTGTAATCCCAGCACTAGGAAGG + Intronic
1020043525 7:5022392-5022414 CTGTAGTCCCAGCTACACGGGGG - Intronic
1020095147 7:5364174-5364196 CTGTAGTCCCAGCTATTCGGGGG + Intronic
1020102898 7:5404993-5405015 CTGTAGTCCCAGCTATTGGGAGG + Intronic
1020844148 7:13261525-13261547 CTGTAATCCCAGCTACAGGCTGG - Intergenic
1021037848 7:15823179-15823201 CTGTAGTCCCAGCTACTTGAGGG - Intergenic
1021085397 7:16416717-16416739 CTGTAGTCCCAGCTACTTGAGGG + Intronic
1021442544 7:20693242-20693264 CTGTAGTCCCAGCTACTGGAAGG + Intronic
1021549834 7:21859234-21859256 CTGTAGTCCCAGTTACTTGAGGG - Intronic
1021689340 7:23217093-23217115 CTGTAGTCCCAGATACTGGGTGG - Intergenic
1021712780 7:23432761-23432783 CTGTAGTCCCAGCTACTTGAGGG - Intronic
1021789136 7:24182892-24182914 CTGTAGTCCCAGCTACACGAGGG + Intergenic
1021838617 7:24704810-24704832 CTGTAGTCCCAGCTACTTGAGGG - Intronic
1022117012 7:27270183-27270205 CTGTAGTCCCAGCTATCGGGAGG - Intergenic
1022320557 7:29284034-29284056 CTGTAGTCCCAGCTACAGACAGG - Intronic
1022361443 7:29663404-29663426 CTGTAATCCCAGGTATTCGGAGG - Intergenic
1022551551 7:31244752-31244774 CTGTAGTCCCAGCTACTGGGGGG - Intergenic
1022687554 7:32610666-32610688 CTGTAATCCCAGCTAGAGGCAGG + Intergenic
1022706845 7:32809791-32809813 CTGCAGTCCCAGCTACTGGAGGG + Intergenic
1022800005 7:33767707-33767729 CTGTAATCCCAGCTATTGGGAGG - Intergenic
1023009563 7:35913710-35913732 CTGTAGTCCCAGCTACTGGGAGG - Intergenic
1023246734 7:38213081-38213103 CTGTTCTCCCAGGAATAGCAAGG + Intronic
1023279524 7:38555291-38555313 CTGTAGTCCCAGCTGTGGGTAGG + Intronic
1023427165 7:40050099-40050121 CTGTAATCCCAGCTATCGGTAGG - Intronic
1023507716 7:40917989-40918011 CTGAAGGCCTAGATATAGGAGGG + Intergenic
1023553394 7:41393185-41393207 CTGTAGTCCCAGCTATCGGGAGG - Intergenic
1023641804 7:42266470-42266492 CTGTAGTCCCAGCTATCAGGAGG - Intergenic
1023751325 7:43375768-43375790 CTGTAATCCCAGCTACTGGAGGG + Intronic
1023810581 7:43908198-43908220 CTGTAGTCCCAGCTACTGGGAGG - Intronic
1024271957 7:47649391-47649413 CTGTAGTCCTAGCTACAGGGAGG + Intergenic
1024503666 7:50141849-50141871 CTGTAGTCCCAGCTACTGGGAGG - Intronic
1024758285 7:52562800-52562822 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
1025123240 7:56323982-56324004 CTGTAGTCCCAGCTACTGGGAGG - Intergenic
1025827664 7:65023794-65023816 ATGTAGTCCCAGCTCTTGGAAGG + Intergenic
1025836797 7:65102025-65102047 CTGTAATCCCAGGTACTGGGAGG - Intergenic
1025906575 7:65791461-65791483 CTGTAATCCCAGGTACTGGGAGG - Intergenic
1025915197 7:65860250-65860272 ATGTAGTCCCAGCTCTTGGAAGG + Intergenic
1025953223 7:66162583-66162605 CTGTAGTCTCAGCTATCGGGAGG - Intergenic
1025966594 7:66278659-66278681 CTGTAGTCCCAGCTACTGGGAGG + Intronic
1026001282 7:66560579-66560601 CTGTAATCCCAGCTATTGGGAGG + Intergenic
1026006827 7:66606647-66606669 ATGTAGTCCCAGCTCTTGGAAGG - Intergenic
1026049441 7:66932635-66932657 CTGTAATCCCAGCTATTGGGAGG - Intronic
1026072977 7:67139172-67139194 CTGTAGTCCCAGTTACTTGAAGG - Intronic
1026177691 7:68012448-68012470 CTGTGGTCCCAGCTCTAGGGAGG + Intergenic
1026204328 7:68242644-68242666 CTGTAGTCCCAGCTACTGGAAGG - Intergenic
1026238295 7:68548742-68548764 CTGTAGTCCCAGCTACTCGAGGG + Intergenic
1026266640 7:68801153-68801175 CTGTAGTCCCAGCTACTTGAGGG + Intergenic
1026306274 7:69144760-69144782 CTGTAGTCCCAGCTACTCGAGGG - Intergenic
1026527743 7:71170056-71170078 CTGTAGTCCCAGCTATGTGGAGG - Intronic
1026728886 7:72894139-72894161 CTGTAGTCCCAGATATTTGGAGG + Intronic
1026768946 7:73181158-73181180 CTGTAATCCCAGCTACAGGGAGG - Intergenic
1026826969 7:73590044-73590066 CTGTAGTCCCAGCTACTGGAAGG + Intergenic
1027009815 7:74734542-74734564 CTGTAATCCCAGCTACAGGGAGG - Intronic
1027078227 7:75211496-75211518 CTGTAATCCCAGCTACAGGGAGG + Intergenic
1027149919 7:75725941-75725963 CTGTAATCCCAGCTACAGGGAGG - Intronic
1027169914 7:75864284-75864306 CTGTAGTCCCAGCTACTGGGAGG + Intronic
1027177542 7:75914514-75914536 CTGTAGTCCCAGCTACTGGGAGG + Intronic
1027195438 7:76026936-76026958 CTGTAATCCCAGCTACAGGCTGG + Intronic
1027206197 7:76101666-76101688 CTGTAGTCCCAGCTATACTCTGG - Intergenic
1027218449 7:76199092-76199114 CTGTAATCCCAGTTATCGGGAGG + Intergenic
1027241900 7:76336041-76336063 CTGTAGTTCCAGGTTGAGGCAGG - Intronic
1027506874 7:79026749-79026771 CTGTAGTCCCAGCTATTTGGGGG + Intronic
1027577973 7:79954890-79954912 CTGTAGTCCCAGTACTCGGAAGG + Intergenic
1027587369 7:80075242-80075264 CTGTAGTCCCAGCTACTAGAGGG + Intergenic
1027997772 7:85447733-85447755 CTATAGTCCCAGCTACAGGCTGG - Intergenic
1028598645 7:92575349-92575371 CTGTAGTCCCAGCTACAGGGAGG + Intronic
1028611133 7:92712979-92713001 CTGTAGTCCCAGCTACAGGCTGG - Intronic
1028716592 7:93978190-93978212 CTTTAGTCCCAGCTATGGGGAGG - Intronic
1028763443 7:94521960-94521982 CTGTAGTCCCAGCTATCGGGAGG + Intronic
1028794263 7:94886222-94886244 CTGTAGTCCCAGTTATTTGGAGG + Intergenic
1029053772 7:97718115-97718137 CTGTAATCCCAGCTAAAGGGAGG + Intergenic
1029091676 7:98053255-98053277 CTGTAGTCTCAGTTATCGGGAGG - Intergenic
1029132617 7:98344053-98344075 CTGTAGTCCCAGCTATAGGGAGG + Intronic
1029238991 7:99144962-99144984 CTGTAGTCCCAGGTACTGGGAGG + Intergenic
1029344622 7:99969456-99969478 CTGTAGTCCCAGTTATCGGGAGG + Intronic
1029377079 7:100185165-100185187 CTATAGTCCCAGCTATGAGAGGG - Intronic
1029602717 7:101578557-101578579 CTGTAGTCCCAGATACTGGAAGG + Intergenic
1029679033 7:102095120-102095142 CTGTAGTCCCAGCTACTGGGGGG - Intronic
1029685223 7:102142662-102142684 CTGTAGTCCCAGGTATTCAGGGG + Intronic
1029686550 7:102152512-102152534 CTGTAGTCCCAGCTACTTGAGGG - Intronic
1029709970 7:102294148-102294170 CTGTAGTCCCAGGTACTTGGGGG - Intronic
1029819550 7:103132674-103132696 CTGTAGTCCCAGCTACTGGGAGG + Intronic
1029834367 7:103294008-103294030 CTGTAGTCCCAGGTATTGAGAGG - Intergenic
1029992717 7:104976732-104976754 CTGTAGTCCCAGCTACATGGGGG - Intergenic
1030073406 7:105716755-105716777 CTGTAGTCCCAGCTACTTGAGGG + Intronic
1030574498 7:111268854-111268876 CTGTAATCCCAGGTATTGGAAGG - Intronic
1031476394 7:122227829-122227851 CTGTAGTCCCATATTTAGGAGGG - Intergenic
1031695716 7:124850607-124850629 CTGTAGTCCCAGCTATTGGGAGG + Intronic
1031725514 7:125233147-125233169 CTGTAGTCCCAGCTACTTGAAGG - Intergenic
1032106330 7:129034368-129034390 CTGTAGTCCCAGCTACTGGGGGG + Intronic
1032124025 7:129178478-129178500 CTGTAGTCCCAGCTACCAGAAGG - Intergenic
1032211342 7:129917080-129917102 CTGTAGTCCCAGCTACTGGCAGG + Intronic
1032744631 7:134773394-134773416 CTGTAGTCCCAGCCCTAGGGAGG - Intronic
1032963786 7:137071855-137071877 CTGTAATCCCAGCTATGGGGAGG + Intergenic
1033105368 7:138516475-138516497 CTGTAATCCCAGTTACAGGCAGG - Intronic
1033227623 7:139573723-139573745 CTGTAGTCCCAGCTATTCGGTGG + Intronic
1033797470 7:144864146-144864168 CTGTTGTCCCAGCTATGGGATGG - Intergenic
1033823798 7:145164805-145164827 CTGTAGTCCCAGCTATTCGGGGG - Intergenic
1033987383 7:147243117-147243139 CTGTAGTCCCAGCTCTTGGGAGG - Intronic
1034142534 7:148835298-148835320 CTGTAGTCCCAGCTACTTGAGGG + Intronic
1034331736 7:150288781-150288803 CTCTGGTCCCAGGTAAAGCAGGG + Intronic
1034380982 7:150692101-150692123 CTGTAGTCCCAGCTACTGGGAGG + Intronic
1034620226 7:152451158-152451180 CTGTAGTCCCAGCTACTGGGGGG + Intergenic
1034666302 7:152821089-152821111 CTCTGGTCCCAGGTAAAGCAGGG - Intronic
1034839765 7:154385090-154385112 CTGTAGTCCCAGCTACCGGGAGG - Intronic
1034878187 7:154743735-154743757 CTGAGGACCCAGGTATATGAAGG + Intronic
1034947918 7:155275730-155275752 CTGTAGTCCCAGCTACTGGGGGG + Intergenic
1035138374 7:156730679-156730701 CTGTAATCCCAGGACTTGGAAGG + Intronic
1035240894 7:157528458-157528480 CTGTAGTCCCAGCTACTGGGTGG - Intergenic
1035523684 8:294976-294998 CTGCAGACCCAGGTCTAGGGAGG + Intergenic
1036163358 8:6408679-6408701 CTGTAGTCCCAGCTACTGGGTGG - Intronic
1036694124 8:10963665-10963687 CTGTGGTCCCAGCTACAGGTTGG - Intronic
1036772013 8:11585608-11585630 CTGTAGTCCCAGGTATTTGGAGG + Intergenic
1036925986 8:12906358-12906380 CTATAGTCCCAGCTATGGGGAGG - Intergenic
1037048713 8:14342436-14342458 CTGTAGTCCCAGCTACTGGGAGG - Intronic
1037780560 8:21865595-21865617 CTGTAGTCCCAGCACTAGGGAGG + Intergenic
1037801600 8:22038911-22038933 CTGTAGTCCCAGCTACTTGAGGG - Intergenic
1037850830 8:22326397-22326419 CTGTAGTCCCAGGTACTTGGGGG + Intronic
1037894065 8:22640300-22640322 CTGTAGTCCCAGCTGTACGTGGG - Intronic
1037953095 8:23031508-23031530 CTGTAGTCCCAGCTATTTGTGGG - Intronic
1038154425 8:24974867-24974889 CTGTAGTCCCAGCTATCGGGAGG - Intergenic
1038194670 8:25356075-25356097 CTGTAGTCCGAGCTATTGGGAGG + Intronic
1038403688 8:27305957-27305979 CTGTAGTCCCAGCTACTCGAGGG - Intronic
1038595922 8:28886368-28886390 CTGTAGTCCCAGCTACTTGAGGG - Intronic
1038736070 8:30170761-30170783 CTGTAATCCCAGCTATTGGGAGG - Intronic
1038795202 8:30703622-30703644 CTGTAGTCCCAGCTCTTTGAGGG + Intronic
1038819936 8:30943031-30943053 TTGTAGTCCCAGCTATTGGGAGG - Intergenic
1038822396 8:30964768-30964790 CTGTAATCCCAGCTATTGGGAGG + Intergenic
1038948642 8:32389880-32389902 CTGTAACCCCAGTTATTGGAAGG - Intronic
1038959769 8:32506125-32506147 CTGTAGTCTCAGCTACATGAAGG + Intronic
1038963156 8:32544623-32544645 CTGTAGTCCCAGCTACTGGGAGG - Intronic
1039559416 8:38500754-38500776 CTGTAGTCCCAGGTACTTGGGGG - Intergenic
1039638988 8:39198498-39198520 CTGTAGTCCCAGCTACTTGAGGG - Intronic
1040521549 8:48180593-48180615 CTGCAGGCTCAGGTAGAGGAAGG - Intergenic
1040662227 8:49587289-49587311 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
1040927553 8:52700398-52700420 CTGTAGTCCCAGTTATGGGGGGG + Intronic
1040995523 8:53397227-53397249 CTGTAGTCTCAGCTATCGGGAGG + Intergenic
1041241947 8:55855590-55855612 CTGTAGTCCCAGCTAGTGGGAGG + Intergenic
1041689310 8:60673607-60673629 CTGTAGTCCCAGCTACTGGAAGG - Intergenic
1041910170 8:63080597-63080619 CTGTAGTCCCAGCTACTGGGAGG + Intronic
1042132249 8:65599010-65599032 CTGTAATCCCAGCTATCGGGAGG - Intergenic
1042346052 8:67729149-67729171 CTGCAGTCCCAGGTAGAGCCTGG - Intronic
1042362991 8:67903536-67903558 CTGTAGTCCCAGCTACTGGGGGG - Intergenic
1042379448 8:68095762-68095784 ATGTAGTCCCAGCTACTGGAAGG - Intronic
1042496289 8:69458148-69458170 CTGTAATCCCAGCTCTAGGGAGG - Intergenic
1042561288 8:70073508-70073530 CTGTAGTCCCAGCTAGTTGAGGG - Intergenic
1042938343 8:74082891-74082913 CTTTCACCCCAGGTATAGGAAGG + Intergenic
1043409266 8:79975172-79975194 CTGTAGTCCCAGCTACTTGAAGG + Intronic
1044116028 8:88335195-88335217 CTGTAGTCCCAGCTATTGGGAGG - Intergenic
1044637596 8:94342056-94342078 CTGTAGTCCCAGCTACTGGGTGG - Intergenic
1044975192 8:97657624-97657646 CTGTAGTCCCAGCTACTCGAGGG - Intronic
1044991041 8:97796060-97796082 CTGTAGTCCCAGCTACTGGGGGG - Intronic
1045208724 8:100071938-100071960 CTGTAATCCCAGGTTTTGGGAGG + Intronic
1045308190 8:100977216-100977238 CTGTAGTCCCAGCTACCGGGGGG + Intergenic
1045366507 8:101481309-101481331 CTGTAGTCCCAGGCAAAGGTGGG - Intergenic
1045468962 8:102494146-102494168 CTGTAGTCCCAGCTACTGGGGGG - Intergenic
1045527085 8:102950270-102950292 CTGTAGTCCCAGCTACTCGAGGG - Intronic
1045541705 8:103092726-103092748 CTGTAGTCCCAGCTATTTGTGGG - Intergenic
1045791103 8:105985655-105985677 CTGTAGTCCCAGCTACAGGAGGG - Intergenic
1046638531 8:116699930-116699952 CTGTAATCCCAGCTCTCGGAAGG - Intronic
1046740318 8:117820564-117820586 CTGTAGTCCCAGTTATCGGGAGG + Intronic
1047046350 8:121056921-121056943 CTGTAGTCCCAGCTACATGGGGG - Intergenic
1047484572 8:125317317-125317339 CTGTAGTCCCAGCTATTCGGAGG - Intronic
1047486407 8:125334875-125334897 CTGTAGTCCCAGCTATCAGGAGG - Intronic
1047602318 8:126438017-126438039 GTGTAGTCCCAGCTACAGGGAGG + Intergenic
1047668503 8:127118994-127119016 CTGTAGTCCCAGCTACAGGAGGG - Intergenic
1047712703 8:127568084-127568106 CTGTAGTCCCAGCTACTTGAAGG - Intergenic
1047718071 8:127613966-127613988 CTGTAATCCCAGCTACAGGGTGG + Intergenic
1048184484 8:132227182-132227204 CTGTAGTCCCAGCTACTGGGAGG - Intronic
1048479280 8:134772967-134772989 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
1048614445 8:136058712-136058734 CTGGAGTCCCAGGGATTTGAGGG - Intergenic
1048632163 8:136256157-136256179 CTGTACTCACAGGAATTGGAAGG - Intergenic
1048745387 8:137609279-137609301 CTGTAATCCCAGCTACAGGCAGG - Intergenic
1049104702 8:140604702-140604724 CTGTAGTCCCAGCTACATGGGGG + Intronic
1049696899 8:143988586-143988608 CTGTAATCCCAGCTATTGGGGGG - Intronic
1049958992 9:720464-720486 CTGTAGTCCTAGCTATTGGGAGG - Intronic
1049970880 9:820953-820975 CTGTAGTCCCAGGTACTTGGGGG - Intergenic
1049971144 9:823190-823212 CTGTAGTCCCAGCTACAGGGAGG - Intergenic
1050027885 9:1354669-1354691 TTCTAGTCCCAGGAAGAGGAAGG - Intergenic
1050104519 9:2151609-2151631 CTGTAATCCCAGCTATTGGGAGG + Intronic
1050383458 9:5057702-5057724 CTGTAATCCCAGCTATCGGGAGG - Intronic
1050639718 9:7654465-7654487 CTGTAATCCCAGCTATCGGGAGG - Intergenic
1051144384 9:14010877-14010899 CTGTAGTCCCAGCTACTGGTTGG - Intergenic
1051178749 9:14388248-14388270 CTGTAGTCCCAGCTACATGGAGG + Intronic
1051493408 9:17692521-17692543 CTGTAGTCCCAGCTACTGGGAGG + Intronic
1051647538 9:19283716-19283738 CTGTAGTCCCAGCTACTGGCGGG - Intronic
1051732579 9:20162130-20162152 CTGTAGTCTCAGGTATTCCAGGG + Intergenic
1051868168 9:21705896-21705918 ATGTTATCCCAGGTAAAGGAAGG - Intergenic
1051931822 9:22395325-22395347 CTGTAGTCCCAGCTACCGGGAGG - Intergenic
1051942179 9:22521066-22521088 CTATAATCCCAGATATTGGAAGG - Intergenic
1052181143 9:25529795-25529817 CTGCAGTTCCAGGTACTGGAAGG + Intergenic
1052582097 9:30371332-30371354 CTGTAGTCCCAGCTAAACAAAGG - Intergenic
1052840910 9:33290176-33290198 CTGTAGTTCCAGCTACCGGAAGG + Intergenic
1052934956 9:34085377-34085399 CTGTAATCCCAGCTATTGGGAGG - Intergenic
1052936252 9:34095508-34095530 CTGTAGTCCCAGCTACTGGAGGG - Intronic
1052936714 9:34099352-34099374 CTGTAGTCCCAGCTACAGGCTGG - Intronic
1052937336 9:34103730-34103752 CTGTAGTCCCAGCTACTTGAGGG + Intronic
1053079053 9:35159543-35159565 CTGTAATCCCAGCTATTCGAAGG - Intergenic
1053238609 9:36477698-36477720 CTGTAGTCCCAGCTACAGGGAGG + Intronic
1053330296 9:37199825-37199847 CTGTAGTCCCAGCTACTGGGAGG - Intronic
1053392185 9:37743940-37743962 CTGTAATCCCAGGCCTAGGTAGG + Intronic
1053394737 9:37763016-37763038 CTGTAGTCCCAGCTATATTTGGG + Intronic
1053401994 9:37833008-37833030 CTGTAGTCCCAGCTATTGAGAGG - Intronic
1054787043 9:69220026-69220048 CTGTAATCCCAGCTATCGGGAGG + Intronic
1055013472 9:71591857-71591879 CTGTAGTCCCAGCTATTGGGAGG - Intergenic
1055026887 9:71731606-71731628 CTGTAGTCCCAGCTATTTGGCGG + Intronic
1055368278 9:75569656-75569678 CTGTAATCCCAGCTACAGGGAGG + Intergenic
1055434671 9:76280611-76280633 CTGTAGTCCCAGCTACATGGTGG + Intronic
1055467813 9:76582837-76582859 ATGTGGAACCAGGTATAGGAAGG + Intergenic
1055533360 9:77210364-77210386 CTGTAGTCCCAGCTACTGCAGGG - Intronic
1055601409 9:77922968-77922990 CTGTAGTTCCAGCTATGGGGAGG - Intronic
1055607421 9:77985185-77985207 CTGTAGTCCCAGCTATAGGCTGG + Intronic
1055650533 9:78402848-78402870 CTGTAGTCCCAGCTACTTGAGGG - Intergenic
1056052888 9:82788562-82788584 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
1056134093 9:83614226-83614248 CTGTAGTCCCAGCTACTGGATGG - Intergenic
1056405368 9:86268915-86268937 CTGTAGTCCCAGCTACTGGGAGG - Intronic
1056541430 9:87574797-87574819 CTGTAGTCCCAGCTACTGGGAGG + Intronic
1056923381 9:90811800-90811822 CTGTAGTCCCAGCTACATGGGGG + Intronic
1057135702 9:92686354-92686376 CTGTAGTCCCAGCTCTAGGGAGG - Intergenic
1057180608 9:93027840-93027862 CTGTAGTCCCAGATATTTGGGGG - Intronic
1057210178 9:93196882-93196904 CTGCAGGCCCAGGCAGAGGAGGG - Intronic
1057666517 9:97050074-97050096 CTGTAGGCCCAGCTATAGGGAGG + Intergenic
1057733500 9:97632503-97632525 CTGTAGTCCCAGTTACTCGAGGG - Intronic
1058423628 9:104857179-104857201 CTGTAGTCCCAGGTACTCGGAGG + Intronic
1058488878 9:105473182-105473204 CTGTAGTCCCAGCTACTCGAAGG + Intronic
1058683909 9:107464425-107464447 CTGTAGTCCCAGCTATCAGAAGG + Intergenic
1058787615 9:108405708-108405730 CTGTAGTCCCAGGTACCAGGAGG + Intergenic
1058858377 9:109089136-109089158 CTGTAGTCTCAGCTATCTGAGGG + Intronic
1058954189 9:109930346-109930368 CTGTAGTCCCAGCTACTAGAGGG - Intronic
1059061889 9:111041654-111041676 CTGTAGTCCCAGCTGTTGGGAGG + Intergenic
1059096169 9:111417115-111417137 CTGTAGTCCCAGCTATCGGGAGG + Intronic
1059177112 9:112177170-112177192 CTGTAGTCCCAGCTACTGGGAGG - Intergenic
1059359439 9:113729356-113729378 CTGTAGTCCCAGCTATTTGCGGG - Intergenic
1059464893 9:114462201-114462223 CTGTAGACCCAGCTACAGGCAGG - Intronic
1059760977 9:117337207-117337229 CTGTAGACCCATGTATAAAATGG - Intronic
1059825552 9:118024468-118024490 CTGTAGTCCCAGCTACTCGAAGG + Intergenic
1059936301 9:119314486-119314508 CTGTAGTCCCAGCTACTTGAGGG - Intronic
1060079044 9:120624348-120624370 CTGTAGTCCCAGCTACTTGAGGG - Intronic
1060161224 9:121366962-121366984 CTGTAGTCCCAGCTACTCGAGGG + Intronic
1060274502 9:122172216-122172238 CTGTAATCCCAAGTTAAGGAGGG - Intronic
1060362523 9:122973357-122973379 CTGTAGTCCCAGCTACTGGGAGG - Intronic
1060432307 9:123561050-123561072 CTGTAGTCCCTGGGAGGGGAAGG - Intronic
1060642308 9:125249321-125249343 CTGTAATCCCAGCTACAGGTTGG - Intergenic
1060670405 9:125464104-125464126 CTGTAGTCCCAGCTATTTGGTGG + Intronic
1060789094 9:126473759-126473781 TTGTAATCCCCGGTATTGGAGGG - Intronic
1060837264 9:126765827-126765849 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
1060850757 9:126873384-126873406 CTGTAGTCCCAGGTACTCGGGGG - Intronic
1060860986 9:126954677-126954699 CTGTAATCCCAGCTATTCGAGGG + Intronic
1060997120 9:127880867-127880889 CTGTAGTCCCAGCTACTGGGGGG - Intergenic
1061082680 9:128381571-128381593 CTGTAATCCCAGGTTGAGGCAGG + Intronic
1061220909 9:129251340-129251362 CTGTAGTCCCAGCTATTTGGAGG - Intergenic
1061337810 9:129953366-129953388 CTGTAATCCCAGGACTAGGGAGG + Intronic
1061446933 9:130644154-130644176 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
1061471268 9:130827770-130827792 CTGTAATCCCAGCTATTGGGAGG + Intronic
1061528889 9:131194289-131194311 CTGTAGTCCCAGTTATTCGGGGG - Intronic
1061723711 9:132569856-132569878 CTGTAGTCCCAGCTACAGGGAGG - Intronic
1061978520 9:134086220-134086242 CTGTAGTCCCAGCTATTTGGGGG - Intergenic
1062251375 9:135597035-135597057 TTGTTGGCCCAGGTTTAGGAGGG + Intergenic
1062260706 9:135661735-135661757 CTGTAGTCCCAGCTACTTGAGGG + Intergenic
1062372362 9:136246603-136246625 CTGTAGTCCCAGCTACTTGAGGG + Intergenic
1062540122 9:137038077-137038099 CTGTAGTCCCAGCTATCTGGAGG - Intergenic
1062555401 9:137111531-137111553 CTGTAGTCCCAGTTACTGGGAGG + Intronic
1062659632 9:137622782-137622804 CTGTAGTCCCAGCTACTTGAGGG + Intronic
1203747719 Un_GL000218v1:52701-52723 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
1203562024 Un_KI270744v1:65285-65307 CTGTAGTCCCAGCTACTGGGAGG - Intergenic
1185450728 X:279969-279991 CTGTAGTCCCAGCTACTGGGAGG - Intronic
1186099510 X:6140698-6140720 CTGTAGTCCCAGCTACTTGAGGG - Intronic
1186261207 X:7781780-7781802 CTGTAGTCCCAGCCATGTGAGGG - Intergenic
1186473835 X:9841935-9841957 CTGTAGTCCCAGCTACTGGGAGG + Intronic
1186614842 X:11175542-11175564 GAGGAGACCCAGGTATAGGAAGG + Intronic
1186621091 X:11240920-11240942 CTGTAGTCCCAGCTACTGGGTGG + Intronic
1186987125 X:15029171-15029193 CTGTAGTCCCAGCTACTTGAAGG - Intergenic
1187172150 X:16862503-16862525 CTGTAGGCACTGGTATAGGAAGG - Intronic
1187368663 X:18685560-18685582 CTGTAGTCCCAGCTACTTGAGGG + Intronic
1187395164 X:18912954-18912976 CTGTAGTCCCAGCTACTGGAGGG + Intronic
1187952365 X:24483834-24483856 CTGTAGTCCCAGGTACTCGGAGG - Intronic
1188342476 X:29021099-29021121 CTGTAGTCCCAGGCTGAGGCAGG + Intronic
1188409024 X:29848887-29848909 CTGTAGTCCCAGCTATTCGGGGG - Intronic
1189087377 X:38040050-38040072 CTGTAGTCCCAGCTACTGGGAGG + Intronic
1189294525 X:39909287-39909309 CTGTAATCCCAGTTATTGGGAGG - Intergenic
1189360358 X:40345157-40345179 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
1189761884 X:44330132-44330154 CTGTTGTCCCAGCTATTGGGGGG + Intronic
1189808913 X:44762940-44762962 CTGTAGTCCCAGGCTGAGGGAGG + Intergenic
1189809553 X:44768548-44768570 CTGTAGTCCCAGCTATTCGGGGG + Intergenic
1189828882 X:44950136-44950158 CTGTAGTCCCAGCTACTCGAAGG - Intronic
1190021062 X:46876240-46876262 CTGTAGTCCCAGCTACTCGAGGG - Intronic
1190087033 X:47404285-47404307 CTGTAATCCCAGCTACAGGGAGG - Intronic
1190103382 X:47540463-47540485 CTGTAGTCCCAGCTACTGGTGGG + Intergenic
1190225071 X:48539147-48539169 CTGTAGTCCCAGCTCTTGGGAGG + Intergenic
1190309077 X:49103668-49103690 CTGTAGTCCCAGCTACTTGAGGG + Intergenic
1190312683 X:49128225-49128247 CTGTAGTCCCAGCTATTCGGGGG - Intergenic
1190827944 X:54034874-54034896 CTGTAGTCCCAGCTACTGGGGGG + Intronic
1191007045 X:55720727-55720749 CTGTAATCCCAGGCATGGGATGG + Intronic
1191702146 X:64054506-64054528 CTGTAGTCCCAGTTACTTGAGGG + Intergenic
1191764145 X:64678628-64678650 CTGTAGTCCCAGCTATTTCATGG - Intergenic
1191912180 X:66162917-66162939 CAACAGACCCAGGTATAGGAAGG - Intronic
1192135517 X:68595622-68595644 CTGTAGTCCCAGCTATTGGGAGG - Intergenic
1192453568 X:71258987-71259009 CTGTAGTCCCAGCTACAGGGAGG - Intergenic
1192465831 X:71355169-71355191 CTGTAGTCCCAGCTACTGGAGGG + Intergenic
1192467149 X:71365589-71365611 CTGTAGTCCCAGCTGTTGGGGGG - Intergenic
1192490331 X:71570914-71570936 CTGTAGTCCCAGCTACTGGAAGG - Intronic
1192541558 X:71977541-71977563 CTGTAGTCCCAGCTACTGGGGGG - Intergenic
1192577346 X:72253501-72253523 CTGTAGTCCCAGCTACTGGGAGG + Intronic
1192595352 X:72401355-72401377 CTGTAGTCCCAGCTACTTGAGGG - Intronic
1192606096 X:72519710-72519732 CTGTAGTCCCAGCTACTTGAGGG - Intronic
1192934322 X:75843501-75843523 CTGTAGTCCCAGGTACTTGGGGG - Intergenic
1193554540 X:82936210-82936232 CTTTAGTTTCAGTTATAGGAAGG - Intergenic
1193934520 X:87600359-87600381 CTGTAGTCCCAGCTATCAGGAGG + Intronic
1194053270 X:89099841-89099863 CTGTAGTCCCAGCTACTGGGAGG - Intergenic
1194998844 X:100622257-100622279 CTGTAGTCCCAGCTACTGGAGGG + Intergenic
1195280302 X:103326835-103326857 CTGTAGTCCCAGCTACTCGAGGG + Intergenic
1195458486 X:105097203-105097225 CTGTAGTCCCAGCTACCGGGAGG + Intronic
1195479417 X:105326172-105326194 CTGTAGTCCCAGCTATCTGCAGG - Intronic
1195563063 X:106307020-106307042 CTGTAGTCCCAGCCATTGGGAGG - Intergenic
1195773396 X:108376480-108376502 CTGTAGTCCCAGCTACTGGGAGG + Intronic
1196090695 X:111738658-111738680 CTATAGTCCCAGGTACTGGGGGG - Intronic
1196228447 X:113193069-113193091 CTGTAGTCCAAGGTAAACCAGGG - Intergenic
1196708670 X:118740084-118740106 CTATAGTCCCAGGTACTGGGGGG - Intronic
1196911967 X:120492904-120492926 CTGTAGTCCCAGCTATACTCGGG - Intergenic
1197164385 X:123360571-123360593 CTGTAGTCCCAGCTACTTGAGGG + Intronic
1198105973 X:133461804-133461826 CTGTAGTCCCAGCTATTCGGGGG - Intergenic
1198134958 X:133739751-133739773 CTGTAGTCCCACTTATGGCATGG + Intronic
1198495754 X:137191141-137191163 CTGTAGTCCCAGCTACTGGGGGG + Intergenic
1198766457 X:140084801-140084823 CTGTAGTCCCAGCTACAGAGAGG + Intergenic
1199151243 X:144489587-144489609 CTGTAGTCCCAGCTACATGGGGG - Intergenic
1199734960 X:150677332-150677354 CTGTAGTCCCAGCTACTTGAGGG - Intergenic
1200241199 X:154494980-154495002 CTGTAGTCCCAGCTACTCGAGGG - Intergenic
1200764173 Y:7066487-7066509 CTGTAGTCCCAGCTACTGGGAGG - Intronic
1200780434 Y:7210712-7210734 CTGTAATCCCAGCTATTGGGAGG + Intergenic
1200794521 Y:7328615-7328637 CTGTAATCCCAGGCCGAGGAGGG - Intergenic
1200920837 Y:8611480-8611502 CTGTAGTCCCAGCTACACGGAGG - Intergenic
1201161053 Y:11167686-11167708 CTGTAGTCCCAGCTACTGGGAGG + Intergenic
1201323166 Y:12723509-12723531 CTGTAGTCCCAGCTACCGGGAGG - Intronic
1201562446 Y:15332438-15332460 CTATATTCCCAGGTATAGCATGG - Intergenic
1201637285 Y:16137981-16138003 CTGTAGTCCCAGCTATGGGGAGG + Intergenic
1201702166 Y:16895906-16895928 CTGTAGTCCTAGCTACAGGGAGG - Intergenic
1202101161 Y:21309488-21309510 CTATAGTCCCAGCTACAGGTGGG - Intergenic