ID: 976092425

View in Genome Browser
Species Human (GRCh38)
Location 4:81471975-81471997
Sequence CGCCCCGCCCCGGCAGGCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 471
Summary {0: 1, 1: 0, 2: 2, 3: 46, 4: 422}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976092406_976092425 28 Left 976092406 4:81471924-81471946 CCGCCGCGCACGCCCCCCTTGGC 0: 1
1: 0
2: 3
3: 26
4: 303
Right 976092425 4:81471975-81471997 CGCCCCGCCCCGGCAGGCGCGGG 0: 1
1: 0
2: 2
3: 46
4: 422
976092407_976092425 25 Left 976092407 4:81471927-81471949 CCGCGCACGCCCCCCTTGGCTCA 0: 1
1: 0
2: 1
3: 13
4: 121
Right 976092425 4:81471975-81471997 CGCCCCGCCCCGGCAGGCGCGGG 0: 1
1: 0
2: 2
3: 46
4: 422
976092417_976092425 -10 Left 976092417 4:81471962-81471984 CCGCTGCCAGCCCCGCCCCGCCC 0: 1
1: 2
2: 61
3: 595
4: 2399
Right 976092425 4:81471975-81471997 CGCCCCGCCCCGGCAGGCGCGGG 0: 1
1: 0
2: 2
3: 46
4: 422
976092415_976092425 -6 Left 976092415 4:81471958-81471980 CCTCCCGCTGCCAGCCCCGCCCC 0: 1
1: 1
2: 24
3: 212
4: 1734
Right 976092425 4:81471975-81471997 CGCCCCGCCCCGGCAGGCGCGGG 0: 1
1: 0
2: 2
3: 46
4: 422
976092411_976092425 14 Left 976092411 4:81471938-81471960 CCCCTTGGCTCAGGCGCCTGCCT 0: 1
1: 0
2: 0
3: 16
4: 253
Right 976092425 4:81471975-81471997 CGCCCCGCCCCGGCAGGCGCGGG 0: 1
1: 0
2: 2
3: 46
4: 422
976092414_976092425 -2 Left 976092414 4:81471954-81471976 CCTGCCTCCCGCTGCCAGCCCCG 0: 1
1: 0
2: 3
3: 88
4: 794
Right 976092425 4:81471975-81471997 CGCCCCGCCCCGGCAGGCGCGGG 0: 1
1: 0
2: 2
3: 46
4: 422
976092410_976092425 15 Left 976092410 4:81471937-81471959 CCCCCTTGGCTCAGGCGCCTGCC 0: 1
1: 0
2: 2
3: 20
4: 281
Right 976092425 4:81471975-81471997 CGCCCCGCCCCGGCAGGCGCGGG 0: 1
1: 0
2: 2
3: 46
4: 422
976092412_976092425 13 Left 976092412 4:81471939-81471961 CCCTTGGCTCAGGCGCCTGCCTC 0: 1
1: 0
2: 0
3: 17
4: 199
Right 976092425 4:81471975-81471997 CGCCCCGCCCCGGCAGGCGCGGG 0: 1
1: 0
2: 2
3: 46
4: 422
976092413_976092425 12 Left 976092413 4:81471940-81471962 CCTTGGCTCAGGCGCCTGCCTCC 0: 1
1: 0
2: 1
3: 41
4: 434
Right 976092425 4:81471975-81471997 CGCCCCGCCCCGGCAGGCGCGGG 0: 1
1: 0
2: 2
3: 46
4: 422
976092416_976092425 -9 Left 976092416 4:81471961-81471983 CCCGCTGCCAGCCCCGCCCCGCC 0: 1
1: 1
2: 29
3: 188
4: 1472
Right 976092425 4:81471975-81471997 CGCCCCGCCCCGGCAGGCGCGGG 0: 1
1: 0
2: 2
3: 46
4: 422
976092409_976092425 16 Left 976092409 4:81471936-81471958 CCCCCCTTGGCTCAGGCGCCTGC 0: 1
1: 0
2: 0
3: 22
4: 275
Right 976092425 4:81471975-81471997 CGCCCCGCCCCGGCAGGCGCGGG 0: 1
1: 0
2: 2
3: 46
4: 422

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976092425 Original CRISPR CGCCCCGCCCCGGCAGGCGC GGG Intronic
900170543 1:1266190-1266212 GGCCCAGCCCAGGCAGGCGGAGG - Intronic
900180114 1:1307601-1307623 GGCCCCGCCCCGCCATGCCCCGG - Intronic
900217184 1:1487781-1487803 CGTCCGGCCGCGGCAGGAGCAGG - Intronic
900224213 1:1525158-1525180 CGTCCGGCCGCGGCAGGAGCAGG - Intronic
900340500 1:2186495-2186517 CGCCCCCCCCCGGCCAGCTCAGG + Intronic
900583982 1:3423616-3423638 CACCCCGCCCCGACCGGTGCCGG - Intronic
900654245 1:3747195-3747217 CGGCCCGCCTGGGCAGGCGGCGG + Intergenic
901017980 1:6242540-6242562 CGCCCCGGCCCGGCCGGTCCTGG + Intergenic
901171871 1:7265003-7265025 CTCCCCACCCCTGCAGGCCCTGG - Intronic
901483079 1:9539510-9539532 GGCCACGCCGCGGAAGGCGCGGG + Exonic
901661947 1:10804201-10804223 TGCCCCACCCTGGCAGGCGTGGG - Intergenic
901700772 1:11043898-11043920 CCCCCCGCCCCGGCAGAGCCTGG - Intronic
901791285 1:11654812-11654834 CGCCCCGCCCCGCGCAGCGCTGG - Intronic
902330724 1:15730044-15730066 CGCCCCGCCCCGCCCCGCCCAGG - Intronic
902870695 1:19312158-19312180 CGCTCCTCCCCGGCATGGGCGGG - Intergenic
903211899 1:21823369-21823391 CGCCCCGCCCCCACAGCCCCTGG - Exonic
903263329 1:22142813-22142835 CGCCCCGCCCCGCTCGGCCCCGG + Intronic
903446265 1:23424516-23424538 CCCCCGCCCCCGGGAGGCGCGGG - Intronic
903597134 1:24503159-24503181 CGCCCCGCCCCGCCCCGCGCTGG - Intronic
903954142 1:27013125-27013147 CACCCCGCCCCGCCAGGGTCAGG + Intergenic
903998307 1:27322167-27322189 CGCCCCGCTCCGACTGGCCCCGG - Exonic
905038115 1:34930184-34930206 CGCCCCATCCTGGCAGGGGCTGG - Intergenic
905684997 1:39901701-39901723 CGCCCGGCCCCGCCGGGCCCTGG - Intronic
905714150 1:40133493-40133515 CGCACCCACCCGGCAGACGCCGG - Intergenic
906556655 1:46719231-46719253 GGCCCTGCCCCGGCTGGGGCTGG + Intergenic
906627041 1:47333883-47333905 CGCCCCGCCCCGCGCCGCGCCGG + Exonic
907591789 1:55680977-55680999 CTCCCCGCCCCAACAGGCCCTGG + Intergenic
910771511 1:90836221-90836243 CACCCCGCCCCGCCGGGGGCTGG - Intergenic
911474151 1:98355754-98355776 GGCCCTGCCCCTGCAGACGCAGG - Intergenic
911498785 1:98661563-98661585 CGCCCGGCCCGGGCCAGCGCTGG + Intergenic
911707041 1:101025918-101025940 CGCCCTGCCCCAGCAGCCGGCGG - Intronic
912561684 1:110555718-110555740 CGTCCCGCCCCGGCTGCCGGCGG - Intergenic
912576365 1:110675326-110675348 CGCCGCGGCCCCGCGGGCGCCGG + Intergenic
913144507 1:115976471-115976493 CGCCCCGGCCCGGCCCGCCCCGG + Intergenic
914244372 1:145874822-145874844 CGCCCCGCCGCCGCCGGCTCAGG + Exonic
914250662 1:145918975-145918997 CGCCCCGCCCCGGCCCCTGCAGG - Intergenic
914263559 1:146019416-146019438 GGCCCCGCCCTTCCAGGCGCGGG - Exonic
915544913 1:156591725-156591747 CGCCCCGCCCCCGAAGAGGCCGG - Intergenic
916928590 1:169550290-169550312 CCCCCCCCCCCGACAGGCCCCGG + Intronic
917289522 1:173457953-173457975 CCCCACCCCCCGGCAGGCCCAGG - Intergenic
917962378 1:180155135-180155157 CGCCCCGACGTGGAAGGCGCTGG + Exonic
919463242 1:197902937-197902959 CGCCCCGCCGCGGCCGCCCCGGG + Intronic
921599284 1:217089717-217089739 CGCTCTGCCCCCGCGGGCGCGGG + Intronic
922518137 1:226223523-226223545 CCCCCGGCCCCGCCAGACGCCGG - Intergenic
923056091 1:230426466-230426488 CGCCCCGCCCCGCCCCGCGGAGG - Intergenic
923505301 1:234600239-234600261 CGCCCCGCCCCGCCCCGCCCGGG + Intergenic
924467500 1:244311864-244311886 CGCTCCTCTCCGGCAGGAGCAGG + Intergenic
1063663877 10:8050640-8050662 GGGACCGCCCAGGCAGGCGCCGG + Intergenic
1064017482 10:11783799-11783821 CGCCCCGCCCTGCCAGAGGCTGG - Intergenic
1064167888 10:13001838-13001860 GTCCCCGCCCCAGCCGGCGCCGG - Intronic
1065099895 10:22321863-22321885 CGCGCGGGGCCGGCAGGCGCGGG - Intronic
1065343002 10:24723747-24723769 CGACCTGCCCCGGCCGGCCCCGG + Intergenic
1067071924 10:43138611-43138633 CGCACCGCCCGGGCCGGAGCCGG - Intronic
1067082398 10:43219111-43219133 TGCCCTTTCCCGGCAGGCGCTGG + Intronic
1067436940 10:46284919-46284941 CGCCGAGACCCGGCAGGCCCAGG - Intergenic
1069556387 10:69401232-69401254 CTCCCCGCGCCGGCAGGCCCTGG - Exonic
1069782136 10:70963445-70963467 GGCCCTGCCCTGGCAGGAGCTGG - Intergenic
1070768011 10:79067514-79067536 CTCCCCTCCCCGGCAGGCGGGGG - Intergenic
1071598124 10:86942686-86942708 CGCCCTGGCCGGGCTGGCGCGGG - Exonic
1071997555 10:91162973-91162995 CGCCCCGCCCCCGCCGGCGCGGG + Intergenic
1072809349 10:98446966-98446988 CCGCCCGCCCCGGGAGGGGCCGG + Intergenic
1073058253 10:100715692-100715714 AGCCCCGCCCCAGCCGCCGCCGG + Intergenic
1074377420 10:112951367-112951389 CGCCCCGACCGGGCCGGCGCAGG - Intronic
1074814471 10:117134234-117134256 CCCCCCGGCCCGGCGGGCCCGGG + Exonic
1075080705 10:119381751-119381773 CTCCCCTCCCCGCCAGGTGCAGG + Intronic
1075590174 10:123685408-123685430 CAGCCAGCCACGGCAGGCGCAGG + Intronic
1075645464 10:124093335-124093357 CGCCCAGCCCCGGCCGCCGCCGG + Intronic
1075740581 10:124693625-124693647 CGCTCCGCTCCAGCAAGCGCAGG + Intronic
1076096365 10:127737309-127737331 GGCCCCGCCCGGCCAGGCCCAGG + Exonic
1076722213 10:132397575-132397597 CCCCCCGCCCCGGCCCGCCCCGG - Intronic
1076878697 10:133229899-133229921 CCTCCCGCTCCGGAAGGCGCTGG - Intergenic
1077013833 11:391403-391425 AACCCCGCCCCTGCAGGCGGTGG + Intergenic
1077021963 11:420907-420929 CGCCCAGCCCCGGGAGCCCCAGG - Intronic
1077064869 11:636691-636713 CGCCCCCCCCCCGCAGCCTCTGG - Intergenic
1077103668 11:832903-832925 CGCCCCGCCCCGCCCCGCCCCGG - Exonic
1077223435 11:1427294-1427316 CGCCCGGCCCAGGCAGGAGAAGG + Intronic
1078246128 11:9574220-9574242 GTCCGCGCCCGGGCAGGCGCCGG - Exonic
1078594322 11:12674130-12674152 CGCCCCGCCCCGCCCCGCCCCGG + Intergenic
1078800904 11:14643681-14643703 CGCCCGGCCGGGGCAGTCGCGGG + Intergenic
1080601976 11:33829335-33829357 CCCCCCGCCTTGGGAGGCGCTGG - Intergenic
1080860173 11:36144959-36144981 CGCCCCGTCCCGGAAGGAGGTGG + Intronic
1080889648 11:36398360-36398382 AGCGCTGGCCCGGCAGGCGCGGG - Intronic
1081854964 11:46297159-46297181 CGCCCCCAGCCGGCAGGCCCGGG + Intronic
1081871680 11:46385564-46385586 CGCCCCTCCCCTGCAGCCGCGGG - Exonic
1082206002 11:49434599-49434621 GGCCACGCCGCGGAAGGCGCGGG - Intergenic
1083033571 11:59615774-59615796 CGCCCCGCCCGGCCAGCCGCGGG + Exonic
1083303265 11:61749825-61749847 CTCACCGCCCCCGCAGGGGCTGG - Intergenic
1083747649 11:64744659-64744681 CCCCCCGCCCAGGGCGGCGCGGG - Intronic
1083758399 11:64803198-64803220 CGCCCCGCGCCGCCCCGCGCCGG - Exonic
1083955137 11:65978717-65978739 ACCCCTGCCCCGGCAGGCACAGG - Intronic
1084083361 11:66843355-66843377 CGCCCCGCCCCGCCCCGCCCGGG - Intronic
1084189814 11:67493837-67493859 CGCCCCGCCCCGTGGGCCGCAGG - Exonic
1084506092 11:69569477-69569499 CCCCCAGCCCCGCCAGGCACTGG + Intergenic
1084524503 11:69687145-69687167 CTCCCAGCCCCGGCAGGTGTCGG + Intergenic
1084774137 11:71364474-71364496 GGCCCAGCCCTGGCAGGGGCAGG + Intergenic
1084935491 11:72584496-72584518 GGACCCGCCCCGCCCGGCGCAGG + Intronic
1086337155 11:85811247-85811269 CTCCCCGCCCCGGCCCGCCCCGG + Intergenic
1086449951 11:86906138-86906160 CCCCCGGCCCCGCCAGGCCCTGG - Intronic
1086653331 11:89319083-89319105 CGCCCTGCTTCGGCTGGCGCAGG + Intergenic
1086889866 11:92245328-92245350 CGCCACCCCCCGACAGGCCCCGG - Intergenic
1086980995 11:93197792-93197814 CTCGCCGCCCCGGCAGCCGCCGG + Exonic
1089428622 11:118401814-118401836 CATCCCGCCCCGGCACCCGCAGG - Exonic
1089525557 11:119094624-119094646 GGCCTCCCCCCGGCAGGCTCGGG + Exonic
1089713823 11:120336817-120336839 CTCCCCGCCGCGGCAAGGGCCGG - Intergenic
1090194044 11:124800072-124800094 CGACATGCCCCGGCAGGCGGCGG + Exonic
1090363681 11:126189724-126189746 GGCCCCTCCCCAGCAGGCCCTGG + Intergenic
1090406421 11:126478136-126478158 AGCCCGGCCCCGGAAGGAGCTGG - Intronic
1091259715 11:134224740-134224762 GGACCCCACCCGGCAGGCGCAGG + Exonic
1202824435 11_KI270721v1_random:83346-83368 CGCCTGGCCCGGACAGGCGCCGG + Intergenic
1093435302 12:19129624-19129646 CCCGCCGCCCCGGCAGGGTCCGG - Intergenic
1093734637 12:22606535-22606557 CCCCCCACCCCGACAGGCCCTGG - Intergenic
1094041804 12:26126524-26126546 CGGCCCGCCCCGCCGGGCACGGG + Intronic
1094125939 12:27022440-27022462 CTCCCCGCCCCGTCAGGAGTGGG - Intergenic
1094573085 12:31659210-31659232 CGCCGCGGCCCGGCAGGGGGCGG - Intronic
1095099161 12:38163191-38163213 GCCCCCGCCCCGGCTGGAGCTGG + Intergenic
1097192189 12:57224929-57224951 CGCCCCGCCGCGGCCGGAGCGGG + Exonic
1098186298 12:67900369-67900391 CGCCCCGCTTCGGCTCGCGCAGG - Intergenic
1098550373 12:71755140-71755162 CGCCCCGCCGCCGCCGCCGCCGG - Exonic
1100399110 12:94212479-94212501 CCCCACCCCCCGGCAGGCCCCGG + Intronic
1101504054 12:105330644-105330666 CGCCCCGCCCGGGGACCCGCCGG - Exonic
1102151125 12:110689466-110689488 CGCCCCGCTCCAGCCGGCGGAGG - Intronic
1102339214 12:112108602-112108624 CGCGCGGGCCGGGCAGGCGCAGG - Intronic
1102559644 12:113753192-113753214 TGCCCAGCCCCTGCAGGCACTGG + Intergenic
1102887511 12:116533329-116533351 CGCCCCGCCCCCTCCGGCGTGGG + Intergenic
1102962109 12:117099521-117099543 CGCCCCGGCCCGGAAACCGCCGG + Intergenic
1102973551 12:117190155-117190177 TGCCCGGCCCCGGGGGGCGCGGG + Intronic
1103886956 12:124209439-124209461 CGCTCTGCCACGGCAGGAGCGGG + Intronic
1104066950 12:125314065-125314087 CACGCCGCCCAGGCAGGTGCTGG - Intronic
1104108330 12:125684039-125684061 CGCCCCGCCCCTGCAGGACGCGG - Intergenic
1105317745 13:19282711-19282733 CCCCCAACCCCGGCAGGCCCTGG - Intergenic
1105405242 13:20127876-20127898 CGCCACGCCACGGCCGGTGCCGG - Intergenic
1106602630 13:31200441-31200463 CGCCCCGAACCGGCGGGCGACGG + Intronic
1107467563 13:40664876-40664898 CGCCCCGCGCGGCCAGGCGCCGG + Intronic
1108542063 13:51453625-51453647 CGCGCCGCCCCGGCGCGAGCGGG + Intronic
1110199158 13:72828430-72828452 CCCCACTCCCCGACAGGCGCCGG + Intronic
1110436399 13:75481873-75481895 CGCCGCTCCCAGGCAGGCGCGGG - Exonic
1111396228 13:87672429-87672451 CTCCCCGCCCCGCCCGGCTCCGG + Intergenic
1112344423 13:98577467-98577489 CACCCCGCCCCGGCGGCCTCTGG + Intronic
1113493625 13:110712410-110712432 CGCCCCGCTGCGGCCGCCGCGGG - Intronic
1113494027 13:110713941-110713963 CGGCCCGCGCCCTCAGGCGCTGG + Intronic
1115217288 14:31026119-31026141 GGCCCCTCCCCGGCAGCAGCAGG - Exonic
1115651169 14:35403984-35404006 CCCGCGGCCCCGGCGGGCGCCGG + Intronic
1116905181 14:50396929-50396951 GGCCCCGCCCAGGCAGACCCGGG - Intronic
1117377408 14:55129180-55129202 CGCCCCGCCTCGGGAGAGGCGGG + Exonic
1118366749 14:65102714-65102736 CCCCCCTCCCCGGGACGCGCAGG - Intergenic
1121199671 14:92106634-92106656 CGCCCCTCCCCGGCCCGCCCCGG + Intergenic
1122207633 14:100156033-100156055 TCCCCCTCCCCGGCAGGAGCTGG + Intronic
1122690240 14:103528815-103528837 CCCCCCGCCCCGCCGGCCGCGGG - Intergenic
1122779898 14:104139142-104139164 CGCCCTGCTCCCGAAGGCGCCGG + Exonic
1122812436 14:104295718-104295740 CGCGCCGCCCGGCCAGGCTCAGG - Intergenic
1122967633 14:105138726-105138748 GGCCCTGCCCCGCCAGTCGCCGG + Intergenic
1123178539 14:106445023-106445045 CTCCCCACCCCGACAGGCCCTGG + Intergenic
1124291538 15:28456867-28456889 CGCCTGGCCCCTGCAGGAGCGGG + Intergenic
1124629197 15:31327438-31327460 CGCTCCGCCGGGGCGGGCGCCGG - Exonic
1124922233 15:34038640-34038662 CGCCCGTCCCGCGCAGGCGCCGG + Intronic
1125500935 15:40240030-40240052 CTGCCAGCCCCGGCAGGCCCAGG + Intronic
1126940388 15:53759719-53759741 CGCCCCGCCCCGCCCCGCCCCGG + Intronic
1128099868 15:64989823-64989845 CGCCCCGCCCCCTCAGAGGCCGG - Exonic
1128156636 15:65395702-65395724 CGCCCCGCCCGGGCCTGCGCTGG + Intronic
1129189044 15:73927080-73927102 CCACGCGCCCCGGCAGGGGCAGG - Exonic
1129483344 15:75844188-75844210 CGCCCCGCCCCGCCCCGCCCCGG - Intronic
1129592754 15:76931887-76931909 TGCGCCGCCGCGGCCGGCGCCGG + Exonic
1129854041 15:78811545-78811567 CGCCCCGCCCCGGCCGGCCCCGG + Intronic
1130411679 15:83653653-83653675 CGCCCCGCCTCAGCCGGAGCCGG - Intergenic
1132314334 15:100879535-100879557 CGCCGGGCCCCGGAAGTCGCAGG - Exonic
1132480641 16:164834-164856 CGCCCCGCCCCGCCGGGCCCCGG - Intronic
1132482219 16:172475-172497 CGCCCCGGCCTGGCACGCGCTGG - Intergenic
1132483067 16:176279-176301 CGCCCCGGCCTGGCACGCGCTGG - Intergenic
1132552887 16:560577-560599 CGCCCCTCCCCGCCCCGCGCCGG - Exonic
1132671246 16:1103030-1103052 CGCCCCGCCCCGTCCTGCTCCGG + Intergenic
1132827711 16:1913422-1913444 TGCCCAGCCCGGGCAGGCCCAGG + Intronic
1132945801 16:2530925-2530947 GGCCCAGCACAGGCAGGCGCTGG - Exonic
1133032917 16:3020299-3020321 AGCTCCGCCCCGGAAGGCGGGGG + Exonic
1133232098 16:4371783-4371805 GGGCCCGCCGCGGCAGGGGCGGG - Intronic
1133771515 16:8869209-8869231 CGCCCCGCCCCGCCCCGCCCCGG - Intergenic
1136451170 16:30355056-30355078 CGCCGGGCCCCGGCAGACCCAGG + Intronic
1136707240 16:32200803-32200825 CGCCTGGCCCCTGCAGGAGCGGG - Intergenic
1136760670 16:32728614-32728636 CGCCTGGCCCCTGCAGGAGCGGG + Intergenic
1136807433 16:33141772-33141794 CGCCTGGCCCCTGCAGGAGCGGG - Intergenic
1136909186 16:34132834-34132856 CGCAGCGCCCCGGCTGGAGCCGG - Intergenic
1137618010 16:49858225-49858247 CGCCGCGGCCCGGCCGGCCCCGG - Intergenic
1139954413 16:70686309-70686331 CGCCCTGCCCACGCAGGAGCGGG + Intergenic
1139974779 16:70800934-70800956 GGCGCGGCCCCGGCAGCCGCGGG - Exonic
1140097023 16:71883996-71884018 CGCCCCGGCCCGGCTGGCTTGGG - Exonic
1140223016 16:73057953-73057975 TGCCCCACCCCGAGAGGCGCCGG - Intronic
1140528993 16:75648074-75648096 GGCCCAGCCCGGGGAGGCGCTGG + Exonic
1141284669 16:82660425-82660447 CCGCACGCCCCGGCAGGCACAGG - Intronic
1141608566 16:85169190-85169212 CCCCACGCCTTGGCAGGCGCCGG + Intergenic
1141959177 16:87392781-87392803 CACCCCGCCGCGGAGGGCGCGGG - Intronic
1141972388 16:87492559-87492581 CGCCGCGCACCGGCCGCCGCTGG - Intergenic
1142234359 16:88914958-88914980 CACCCCGCCCCGGCAGCGGGCGG - Intronic
1142408919 16:89906398-89906420 AGCCCCGCCACGGCAGGGGCAGG + Intronic
1142421445 16:89972836-89972858 CGCTCCCCCGCGGCCGGCGCAGG - Intergenic
1203062822 16_KI270728v1_random:988928-988950 CGCCTGGCCCCTGCAGGAGCGGG + Intergenic
1142509418 17:385026-385048 CGCCCCGCCCCGCCCGACACCGG - Intronic
1142760917 17:2041594-2041616 CGCCCCGGGCCGGCCCGCGCGGG + Exonic
1143178080 17:4967962-4967984 CGCCCCGCCCCCGCAGACAGAGG + Intergenic
1143183510 17:4997954-4997976 CGCGCTGCCCGGGCGGGCGCCGG + Exonic
1143369006 17:6426805-6426827 CGCCCCACCCTGGCCGGCACTGG + Intronic
1143582371 17:7834628-7834650 CGCCCCGCCCCGCCCCGCCCTGG - Intergenic
1144340882 17:14309557-14309579 CGCCCCGCCCCCGCCGGTGTTGG + Intronic
1144515905 17:15917551-15917573 AGCCCTGCCCCCGCAGGCACTGG + Intergenic
1146787334 17:35731741-35731763 CGCCCCGACTGGGCAGGCGGGGG + Exonic
1147183673 17:38702407-38702429 CGCCCCGCCCCGCCCGTCCCCGG - Intergenic
1147440278 17:40443478-40443500 GGCCCGGCCCAGGCAGGCGGCGG - Exonic
1147653025 17:42072718-42072740 CGCGCCGCCCCCGCCGGCCCAGG + Intergenic
1148503253 17:48107681-48107703 CGCCCCGCCCCTACAGGCCCGGG - Exonic
1149647218 17:58249400-58249422 CGCCCACCCCCTGAAGGCGCGGG - Intronic
1149884568 17:60327732-60327754 CCCCCTGCCCCTGCAGGCTCAGG + Intronic
1150094653 17:62362975-62362997 CTCCACCCCCCGACAGGCGCTGG - Intergenic
1152410170 17:80119092-80119114 GGTTCCTCCCCGGCAGGCGCAGG - Intergenic
1152468368 17:80477753-80477775 CGCCCCGCCCCGCCCCGCCCCGG + Intronic
1152536923 17:80956156-80956178 CAGCCCTCCCAGGCAGGCGCAGG + Intronic
1152782092 17:82231135-82231157 GGCCCCGCCCCGCCAGCCGCGGG - Intronic
1153457371 18:5295729-5295751 CGGGCCGCCCCGCCAGCCGCCGG + Intronic
1153636449 18:7117489-7117511 CAGCCCTCCCCGGCAAGCGCGGG + Intronic
1153636559 18:7117879-7117901 CGCCCCGCCCCGTCCCGCCCCGG + Intergenic
1155633733 18:27925706-27925728 CCCCCACCCCCGGCAGGCCCTGG + Intergenic
1155654638 18:28178200-28178222 AGCACCGCCCCGGCAGGTGGAGG + Intergenic
1155971930 18:32091793-32091815 CGCCCCGCCTCGCTAGGCCCGGG - Intergenic
1156448761 18:37254543-37254565 CTGCCCGCCCCGCCAGGCTCCGG + Intronic
1157496775 18:48162006-48162028 CCGCCCGCCCGGGCAGGCGCCGG - Intronic
1158931074 18:62325438-62325460 CCGCGCGGCCCGGCAGGCGCGGG - Intronic
1159369994 18:67516948-67516970 GGCCCCGCCCCGCCCGCCGCCGG - Exonic
1160415725 18:78709448-78709470 TGCCCCGCCCCAGCAGAAGCAGG + Intergenic
1160613950 18:80109701-80109723 CGGCCCGCCCCGCCCGCCGCCGG + Intronic
1160736098 19:663037-663059 CGGGCCTCACCGGCAGGCGCGGG + Exonic
1160768874 19:821649-821671 CGCCCCTCCCCCGCCGGCGCCGG - Intronic
1160869124 19:1269091-1269113 CGCCCCGCCCCGCCGCGCGCTGG + Intronic
1160930542 19:1567869-1567891 CGCCGCGCTCCGCCTGGCGCTGG - Exonic
1160948100 19:1652631-1652653 CGCCCCGCCCCGCCCCGTGCAGG + Intergenic
1160967546 19:1753304-1753326 CGGCCTGCCCCAGCGGGCGCGGG + Exonic
1161006779 19:1941158-1941180 CGCCCCCCGCTGGCAGACGCTGG + Exonic
1161063597 19:2227152-2227174 CCCCCCGCCCCGGCCCCCGCCGG + Intronic
1161087213 19:2340698-2340720 AGCCCGACCCGGGCAGGCGCTGG - Intronic
1161108786 19:2456980-2457002 TGCCCCGCCGCGGCGGGCGGCGG - Exonic
1161153594 19:2721449-2721471 CGCCCCGCCCCGCCCCGCCCCGG + Intronic
1161165564 19:2785492-2785514 CGCGCCGCCCCAGCATGCCCCGG + Exonic
1161210337 19:3062368-3062390 CGCCCGGCCCCGGCGCGCCCCGG + Intronic
1161729973 19:5953785-5953807 CGCCCCTCCCCAGGAAGCGCAGG + Intronic
1162328116 19:10010538-10010560 AGCCCCGCCTGGCCAGGCGCTGG - Intergenic
1162398365 19:10430811-10430833 GGCCCCGCCTCGGCGGGCGCTGG - Intronic
1162741364 19:12775565-12775587 CGCCCCGCCCCCCTAGGCGCAGG + Intronic
1162871391 19:13589380-13589402 CTCCCCAGCCTGGCAGGCGCCGG - Intronic
1162962540 19:14136467-14136489 CGCCGCGCCGCAGCAGGGGCAGG + Exonic
1163321337 19:16576764-16576786 AGCCCGGCCCCGCCAGCCGCTGG + Exonic
1163435427 19:17292504-17292526 CGCCCCGCCCAGGCAGCCTGGGG + Exonic
1163444553 19:17338938-17338960 CTCCCTGCCCCGCCAGGCTCTGG + Exonic
1163557630 19:18001587-18001609 CGCGCCGCCCCCGCAGCAGCCGG + Intronic
1163807004 19:19405676-19405698 CGCCCCGCCCAGCCGGGCGCGGG + Intronic
1164658579 19:29942485-29942507 CGCGCCGCCTGCGCAGGCGCTGG + Exonic
1165471518 19:36007196-36007218 GGCCCAGCCCCAGCAGGCACAGG + Exonic
1166139592 19:40799084-40799106 CGCCCCGCCCCGCGCGGCTCGGG + Intronic
1166215335 19:41331024-41331046 CGCCCCGCCCCGCCCCGCCCCGG - Exonic
1166218884 19:41353104-41353126 GGCCCCGCCCCTGCAGGGGCTGG + Exonic
1166218888 19:41353107-41353129 CCCCCAGCCCCTGCAGGGGCGGG - Exonic
1166366408 19:42280631-42280653 CGCCCCGCCGCGGCCCGCGTGGG + Intronic
1166660467 19:44643869-44643891 CGGCCAGTCCCGCCAGGCGCGGG - Exonic
1167251038 19:48398514-48398536 CGCCCCGCCGAGGCCGCCGCCGG - Exonic
1167263082 19:48469818-48469840 TCCCCGGCCCCGGCAGGCGCTGG - Intronic
1167471293 19:49677662-49677684 CGCCCCTCCCCGGCCGGGGGCGG - Intronic
1167594255 19:50418879-50418901 CTCCTCCCCCCGGCAGGGGCTGG + Intronic
925008866 2:467389-467411 CTCCCCGCCCCGCCCGGAGCTGG + Intergenic
925375285 2:3379733-3379755 CGCCGCGGCCCGGCACGCGCAGG + Exonic
925609710 2:5692757-5692779 CAACCTGCCCCGGGAGGCGCTGG + Exonic
926142341 2:10375177-10375199 TGCCCTGCCCCAGCAGGCCCTGG + Intronic
926155004 2:10448616-10448638 CGCCCCGCCCCGCCCTGCGGCGG + Intergenic
927667513 2:25042531-25042553 CGCCCAGCACCGGCACGCGCCGG - Intronic
927881510 2:26692853-26692875 CGTCCCGCCCGGGCCGCCGCCGG - Exonic
927938147 2:27086721-27086743 CGCCCCGCCCCGCCCCGCCCCGG - Intergenic
929856702 2:45643643-45643665 CACCCCACCCCGGCCGGAGCCGG - Intergenic
931517776 2:63059785-63059807 CGCCGCGGCCCGGCAGGCCCTGG - Intergenic
931917911 2:66979213-66979235 CCCCCCGCCCCGACAGGCCCTGG - Intergenic
932716236 2:74102074-74102096 CGTCCCCACCCGGCAGGCACTGG + Exonic
932751545 2:74374597-74374619 CGCCAGGCTCCGGCAGGCACCGG + Intronic
932780211 2:74554637-74554659 CGGCCCCCGCCGGCAGCCGCTGG - Exonic
932780218 2:74554647-74554669 CGCCCCTCCCCGGCCCCCGCCGG - Exonic
932852589 2:75200843-75200865 CGCCGCTCCCCGGCTGGCGCGGG - Intergenic
933684598 2:85133395-85133417 CGCCCCTCCCCGGCGGGCCAGGG + Exonic
934518885 2:95007013-95007035 CGCCCCGCCCTGGCTGCAGCAGG - Intergenic
934563278 2:95323988-95324010 CTCCCCGCCCCATCAGGTGCAGG - Intronic
934566921 2:95346436-95346458 GGCCCCGCCCCGCCCGGCACGGG - Intronic
934566933 2:95346468-95346490 CGCCCTTCCCGGGCAGGCGCGGG + Intronic
934763942 2:96870048-96870070 CGCGCCACCACGGCGGGCGCCGG + Intronic
935746484 2:106194016-106194038 CTCCCCGCCCCGGGCGGGGCCGG - Intronic
936174249 2:110205066-110205088 CGCCCCGCCCGGGCCGGTCCCGG + Intronic
937236875 2:120436543-120436565 CGCCCCTCCCCTGCAGCAGCTGG + Intergenic
938017059 2:127876046-127876068 CGCCCCGCCCCCCCACCCGCTGG + Intronic
938288455 2:130137076-130137098 CCCCCTGCACGGGCAGGCGCAGG + Intergenic
938374757 2:130798083-130798105 TGCCCCGCCCCGGGGGACGCTGG - Intergenic
938423790 2:131167256-131167278 CCCCCCACCCCGACAGGCCCCGG + Intronic
939199064 2:139011493-139011515 CCCCACCCCCCGGTAGGCGCTGG - Intergenic
939400342 2:141684441-141684463 CCCCACCCCCCGGCAGGCCCTGG - Intronic
940751215 2:157628831-157628853 CGCCGCGCACCGCCAGCCGCAGG - Exonic
941951590 2:171161174-171161196 CGCCTCCCTCCGGCCGGCGCGGG - Intronic
942049291 2:172123855-172123877 CCCCCCTCCCCAGCAGGCCCCGG + Intergenic
942240808 2:173963721-173963743 CGCCCGGCCTCGGCGGGGGCGGG + Intronic
942462587 2:176178537-176178559 CGCAGCTCCCCAGCAGGCGCCGG - Intergenic
943639528 2:190343606-190343628 CGCCCGGCTCGGGCAGGCGTGGG + Exonic
946019927 2:216633874-216633896 CGAGCTGCCCCTGCAGGCGCTGG + Exonic
947155980 2:227163944-227163966 TGCCCCTCCCAGGCAGGTGCCGG + Intronic
947418482 2:229921706-229921728 GGCCCCGCCGCCGCCGGCGCCGG + Intronic
947992297 2:234497152-234497174 GGCCCCGCCCCGCCCGCCGCCGG + Intergenic
948463047 2:238139369-238139391 GGCCCCTCCCCAGGAGGCGCTGG - Intronic
949019724 2:241734470-241734492 AGCCCCGCCCCGACTGGCACCGG - Intergenic
1169073743 20:2749531-2749553 GGCCCAGCCCCGGCCGCCGCGGG + Intronic
1171767452 20:29297892-29297914 CGGCCAGCCCCGACAGGAGCAGG + Intergenic
1171904647 20:30891602-30891624 CGCAGCGCCCCGGCTGGAGCCGG - Intergenic
1172011496 20:31848559-31848581 CCACCCGCCCCCGCAGGTGCAGG - Intronic
1172118528 20:32584904-32584926 CGGCCCGCCCCCGAGGGCGCCGG - Intronic
1172274991 20:33674476-33674498 CGCCCCGCCCCCGCGGACGCCGG + Intergenic
1172320930 20:33994463-33994485 TGCCCCGCCCCGCCCGGCGAGGG + Intronic
1172474439 20:35226632-35226654 CGCCCCGCCCCGGTGGGGGGCGG - Exonic
1172764951 20:37346282-37346304 CCCCCCGCCCCGGCCAGCGCGGG + Intronic
1175367757 20:58467370-58467392 CGCGCAGTCCCGGCCGGCGCGGG + Exonic
1175439633 20:58981530-58981552 CGCCCCGCCCCCGCCCGCCCGGG + Intronic
1175873838 20:62220360-62220382 GCCCCCGCCCCGCCCGGCGCCGG + Intergenic
1176086047 20:63296007-63296029 CGCCCCGGCCTGTCAGGCCCTGG - Intronic
1176130092 20:63493152-63493174 CGTCCTGCAGCGGCAGGCGCAGG + Exonic
1176379771 21:6106403-6106425 CACCCCGGGCAGGCAGGCGCTGG + Intergenic
1176380723 21:6111071-6111093 GGCCCCGCCCCGGCCCGCCCCGG - Intergenic
1178513836 21:33229904-33229926 CGCCGCGCCGCCGCCGGCGCGGG - Intronic
1178872045 21:36385359-36385381 GGCCCCGCCCCCGCATGGGCGGG - Exonic
1179626894 21:42653933-42653955 CGCCCCGCCGCGCCCGGCCCCGG - Intronic
1179713801 21:43277555-43277577 GGCCACTCCCCGGCAGGCCCTGG + Intergenic
1179742749 21:43427169-43427191 GGCCCCGCCCCGGCCCGCCCCGG + Intergenic
1179743703 21:43431834-43431856 CACCCCGGGCAGGCAGGCGCTGG - Intergenic
1180064251 21:45404948-45404970 CGCCCCGTCCTCGCAGCCGCAGG + Intergenic
1180064498 21:45405615-45405637 CGCCCCGCTCCGTCCGGCTCCGG - Intronic
1180151424 21:45950230-45950252 CACCCCGGCCCGTCAGGCCCAGG - Intergenic
1180338072 22:11597739-11597761 CGCAGCGCCCCGGCTGGAGCCGG - Intergenic
1180637908 22:17275506-17275528 CGCCCCGCCCCGCCCCGCCCAGG + Intergenic
1180960587 22:19760689-19760711 CGCCCCGCCCCGCCCCGCCCGGG - Intronic
1181514334 22:23402599-23402621 CGGCCCGCCCTGGCCGGCCCAGG - Intergenic
1181934585 22:26429500-26429522 CCTCCCGCCCCGGCAGCCCCCGG - Intronic
1182445548 22:30387387-30387409 CGCCCCGCCCCGTCCGGCAGCGG - Exonic
1183201477 22:36388007-36388029 CGCCCCGCCCTCGGAGCCGCGGG + Exonic
1183528125 22:38336275-38336297 CGCCCCGCCCCGCCCCGCCCCGG + Intronic
1183821069 22:40346472-40346494 CGCCCCGCCCCGTCCTGCCCTGG + Intergenic
1184395420 22:44233377-44233399 CCCCCAGCCCCGACAGGCCCTGG + Intergenic
1184557438 22:45240929-45240951 CGCCCCGCCCCGGCCCGGCCCGG + Intergenic
1184564645 22:45284887-45284909 CGCCCCGCCCCCGCCTGGGCTGG - Intergenic
1184569118 22:45310730-45310752 GGCCCTGCACCTGCAGGCGCGGG - Intronic
1184718769 22:46297015-46297037 GGCCGCGCCCCGCCAGGAGCCGG + Intronic
1184759741 22:46537595-46537617 CGCACCGCCCAGGCAGCAGCCGG - Intergenic
1185133167 22:49052103-49052125 GGCCCGGCCCCGGCAGACTCTGG + Intergenic
952830418 3:37560105-37560127 CGCCACCCCCCGACAGGCCCCGG + Intronic
954110368 3:48429819-48429841 CGCTCCGCACCCGCAGGTGCTGG + Intronic
954717533 3:52533921-52533943 CGCCCCGCCCCGCCGGGTCCGGG - Intronic
958675670 3:97265579-97265601 CCCCCTGCCCCTGCAGGCTCGGG - Intronic
962498416 3:135965706-135965728 CGCCCCGCCCAGCCACCCGCAGG - Exonic
964482798 3:157159634-157159656 CCCCCCGCCCCGGCACGCCCCGG + Intronic
965475442 3:169149549-169149571 CGCCTCTGCCCGCCAGGCGCCGG + Intronic
965590430 3:170356967-170356989 CGCCCCGCCCCGGAGGCAGCCGG - Intergenic
966182291 3:177197849-177197871 CGCCCCGCCCCCACCGCCGCGGG + Intergenic
966878433 3:184336404-184336426 CGCACAGCCCCGGGAGGGGCTGG + Intronic
968093015 3:195909694-195909716 CGCCCCGCGCCGGCCCCCGCAGG + Intronic
968562161 4:1289828-1289850 CGCCACGCGCCGGCCGGAGCAGG - Intergenic
968572078 4:1347186-1347208 CGCCCCGCCCCTTCCGGCGGGGG - Intergenic
968583612 4:1406012-1406034 CGCCGCGCCCTCGCCGGCGCCGG - Exonic
968831534 4:2934762-2934784 CGCGCAGCCGCGGCAGGTGCGGG - Intronic
968879888 4:3293299-3293321 CGCCCCGCCCCGCCCCGCGCCGG - Intronic
968907889 4:3463079-3463101 ACCCCCGCCCCGCCAGGCGCTGG + Intergenic
969285471 4:6199845-6199867 CGCGCCACTCCGGCAGGCACCGG + Intronic
972437102 4:39044926-39044948 CGCTCCGGGCCGGCCGGCGCCGG + Intergenic
973704133 4:53564791-53564813 CGCCCTGCTTCGGCTGGCGCAGG - Intronic
975166922 4:71187407-71187429 CGCCCGGCCCCGGCAGCTGCCGG + Intronic
975616436 4:76251884-76251906 GCCCCCGCCCCAGCAAGCGCGGG - Intronic
976092425 4:81471975-81471997 CGCCCCGCCCCGGCAGGCGCGGG + Intronic
976629154 4:87219924-87219946 CGCCCCGCCCCCGCAGGCCGCGG + Intronic
976996211 4:91437651-91437673 CGCCCTGCTTCGGCTGGCGCAGG - Intronic
977711596 4:100133013-100133035 CGCCCTGCCCTGACAGGCCCTGG + Intergenic
978629718 4:110730331-110730353 CTCCCCACCCCGACAGGCCCTGG + Intergenic
982042368 4:151409034-151409056 GGCCCCGCCCCCGCCGCCGCCGG - Intergenic
984857618 4:184208386-184208408 CGCCCCGCTTCGGCTCGCGCAGG - Intronic
985520992 5:373834-373856 CGCCCTGCCCGGGCGGGCGGGGG + Intronic
985726292 5:1517513-1517535 CGCTCTGCCCCTGCAGGCACAGG + Intronic
985749646 5:1667069-1667091 CGCCCCTTCCCTGCAGCCGCTGG - Intergenic
985783504 5:1882567-1882589 CGCCCCGCCCAGGCCACCGCAGG - Intronic
986085653 5:4442451-4442473 CACCCCGCCCCTGCAGTCACTGG - Intergenic
990553693 5:56909563-56909585 CGCCCCGGCCCGGGAGGAGAGGG - Exonic
992067462 5:73120719-73120741 CGACCCGCCGCCGCCGGCGCAGG - Intronic
992249957 5:74866522-74866544 GGCGCCGGCCCGGCAGGTGCGGG + Intronic
992732801 5:79689789-79689811 CGAGCCGCCCCCGCAGGGGCAGG + Intergenic
992837409 5:80654607-80654629 CCCCCCGCCCCGGCGCACGCAGG + Exonic
992922387 5:81539896-81539918 CCCCCCACCCCGACAGGCCCCGG + Intronic
996854404 5:127988931-127988953 CCCCCCACCCCGACAGGCCCTGG + Intergenic
998140501 5:139697185-139697207 CACCCCGCCCCAGGAGGGGCCGG - Intergenic
999322563 5:150624607-150624629 CGCCCCGCCCCGCCCAGCCCTGG - Intronic
1000345853 5:160312635-160312657 CCCCCCGCCCCGCGGGGCGCGGG - Intronic
1002057988 5:176609782-176609804 CGCCCCGCCCCGCCCCGCCCCGG + Intronic
1002485286 5:179530783-179530805 CGCAGAGCCCCGGGAGGCGCGGG - Intergenic
1005332202 6:24761292-24761314 CGCCCCATCCCTGCAGGCTCGGG - Intergenic
1011128557 6:84032363-84032385 CGCCCACCCCCGACAGGCCCCGG - Intergenic
1011398774 6:86937617-86937639 CGCCGCACCCCGGCGGGCACTGG + Exonic
1011601605 6:89065128-89065150 CGCCCCGCCTGGCCAGGGGCAGG - Intergenic
1011633896 6:89352811-89352833 AGCGCCGCCCCGGCCGGCGCCGG - Exonic
1014045235 6:116877196-116877218 CGCCCCGCCCCGCCCCGGGCTGG + Intronic
1015625767 6:135180504-135180526 CACCCCGCCCCGCCCGGCCCAGG - Intergenic
1016438802 6:144063780-144063802 CGCCCCGCCACGGTGGGCGTGGG - Intronic
1017282217 6:152637116-152637138 CGCCCGGCTCCGGGATGCGCCGG + Intronic
1019128738 6:169858800-169858822 CGGCCAGCCCCAGCAGGCCCTGG - Intergenic
1019536296 7:1531253-1531275 CGCCCCGCCCCGCCCCCCGCAGG - Intronic
1019706059 7:2497875-2497897 GGCCCCACCCCGGCAGGGTCTGG - Intergenic
1022553753 7:31270518-31270540 CCCAACGCCCCGGCAGGCCCTGG + Intergenic
1023791863 7:43758892-43758914 CGCCCCGCCCCGCCCGGGCCCGG + Intronic
1024965646 7:55020066-55020088 CACCCCTCCCCGGGAGCCGCAGG - Intronic
1026893048 7:73993606-73993628 CCCCCCGCCCCGGCAGCCTTTGG - Intergenic
1028616644 7:92776064-92776086 CCCCCCACCCCGACAGGCCCTGG + Intronic
1028629504 7:92919383-92919405 CCCCCCACCCCGACAGGCCCTGG + Intergenic
1029849381 7:103446244-103446266 CGCCCCGCCCCGCTAGGGCCAGG + Intergenic
1030584669 7:111402998-111403020 CCCCCCACCCCGCCAGGCTCAGG + Intronic
1033299817 7:140176342-140176364 CGCCCCGCCCCGCCGCGCCCGGG - Intronic
1033547130 7:142411855-142411877 CCCCCCGCCCCAACAGGCCCTGG - Intergenic
1033654396 7:143362878-143362900 CGCCCCGGCACGGCCGGAGCAGG - Intergenic
1033998493 7:147383607-147383629 CTCCCCACCCCGACAGGCCCCGG - Intronic
1034228010 7:149497753-149497775 CGCCGCGGCCCGGCAGACGAAGG + Exonic
1035609336 8:949537-949559 GGTCCTGCCCCGGCAGGCACTGG - Intergenic
1037589960 8:20303977-20303999 CGCCCCGCCCCGCCCCGCCCCGG - Intergenic
1037879309 8:22565388-22565410 CGCCCCGACCCTGCGGTCGCCGG - Intronic
1038543921 8:28411690-28411712 AGCCCCGCGCCGGCCGCCGCCGG + Intronic
1039620954 8:38996749-38996771 CGCCCCGCCCCGTCGGCTGCCGG - Intronic
1040355876 8:46617689-46617711 AGCCCCGCCTCTGCACGCGCTGG - Intergenic
1043053370 8:75408007-75408029 CGCACCGCCCCGGCGGCTGCCGG + Intronic
1044428733 8:92084086-92084108 CCCCCCACCCCGACAGGCCCCGG - Intronic
1045098931 8:98825862-98825884 CGCCCCGCCCCCGGCCGCGCCGG + Intronic
1045516473 8:102864395-102864417 CGCAGCTCCCCGGCAGGCGAAGG + Exonic
1048865829 8:138760863-138760885 CGCCCTGCTCCTGCAGGAGCTGG - Intronic
1049090721 8:140511689-140511711 CGCCCCGCCCCGCCGGGCTCTGG + Intronic
1049225528 8:141448851-141448873 AGCCCCGCCCCGGTCGGCCCTGG - Intergenic
1049409169 8:142464833-142464855 CTCGCCGCCCAGGCAGGCGCAGG - Exonic
1049641062 8:143716259-143716281 CCCCCGCCCCCGGCAGGCCCCGG - Exonic
1049663050 8:143829049-143829071 CGCCCCGCCCCGCCGGAAGCTGG + Intronic
1049673171 8:143878544-143878566 CGCCCCGCCCCGCCCCGCGTCGG - Intergenic
1050874016 9:10613099-10613121 GGCCCCGCTCCGGCGGGCGGGGG + Intergenic
1051734303 9:20182622-20182644 ACCCCCGCCCCGACAGGCCCTGG - Intergenic
1052290774 9:26837591-26837613 CGCCACTCCCCGACAGGCCCCGG - Intergenic
1055321594 9:75088205-75088227 CGCCCCGCCCCAACGGGGGCTGG - Exonic
1057716673 9:97501567-97501589 CGCCCCGCCCCGCCCGCCGCCGG - Intronic
1058885820 9:109320635-109320657 CGCGCCGGCCCGGCCAGCGCCGG + Exonic
1060952320 9:127612198-127612220 TGCCCCGCCCCCGCGCGCGCCGG + Intergenic
1061326827 9:129869259-129869281 CGCCCCGGCCAGGCAGGTGGAGG + Intronic
1061365788 9:130172097-130172119 CTCCCCGCCGCGGCGGGGGCCGG + Intergenic
1061807663 9:133145382-133145404 CCCCCCGCCCCGGCATGGCCTGG + Intronic
1061859368 9:133460253-133460275 CGCCCCGCCCCGGCGGCCCCAGG + Intronic
1061922052 9:133787807-133787829 GGCCCCGCCCCAGCAGCCACAGG + Intronic
1062314776 9:135961276-135961298 CGCCCCGCCCCGGCTCCCGTCGG + Exonic
1062327299 9:136018345-136018367 TGCCCCTCCCTGACAGGCGCTGG - Intronic
1062363696 9:136199120-136199142 CCTCCCACCCCGGCCGGCGCGGG + Intronic
1062535421 9:137019101-137019123 CTGCCCGGCTCGGCAGGCGCAGG - Intronic
1062592671 9:137281148-137281170 CGCTCCTCCCGGGCAGGCCCGGG - Exonic
1203772005 EBV:54223-54245 CGCCCCGCCCAGGCTGGCCTCGG - Intergenic
1185679909 X:1880016-1880038 CCCCACCCCCCGGCAGGCCCTGG - Intergenic
1187698113 X:21940917-21940939 CGCCCCAGCCCGCCAGGCGGCGG - Intronic
1188727864 X:33607370-33607392 CCCCCTGCCCCTGCAGGCTCAGG - Intergenic
1189197209 X:39162492-39162514 CTTCCCGCCCCAGCTGGCGCAGG - Intergenic
1189262528 X:39688876-39688898 CGCCGCGGCTCTGCAGGCGCGGG + Intergenic
1189310192 X:40013189-40013211 CGCCCCGCCGGGGCGGGAGCCGG + Intergenic
1189335584 X:40168924-40168946 CCGCCCGCCCTGGCCGGCGCAGG + Intronic
1190879424 X:54482417-54482439 TCCCCCGCCCCGGGAGGAGCTGG + Intronic
1192177408 X:68894657-68894679 CGCCCCGGCCAGGCTGGCACAGG + Intergenic
1192177429 X:68894726-68894748 CGCCCCGGCCAGGCTGGCACAGG + Intergenic
1192720490 X:73691741-73691763 CTCCCTGCCCCGACAGGCCCTGG + Intergenic
1195702675 X:107716648-107716670 CGCCCCGGCTCGGGAGGCGCCGG + Intronic
1196251745 X:113468852-113468874 CGCCACCCCCCGACAGGCCCCGG - Intergenic
1196517842 X:116634046-116634068 CCCCCCACCCCGACAGGCCCGGG - Intergenic
1197806312 X:130401897-130401919 CGCCACGCCCCGGTACGCCCCGG + Intergenic
1198807297 X:140504741-140504763 CCCGCAGCCCCGGGAGGCGCAGG - Exonic
1199699294 X:150364218-150364240 CGCCCGGCGCCGGCTAGCGCGGG + Intronic
1199772713 X:150984320-150984342 CGCCCCGCCCCGCCCCGCCCGGG - Intronic
1201291209 Y:12421643-12421665 CGCCCAGCCCTGGTAGGCGCGGG + Intergenic