ID: 976093809

View in Genome Browser
Species Human (GRCh38)
Location 4:81486628-81486650
Sequence CAGAGCACACAGAAGGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 739
Summary {0: 1, 1: 2, 2: 4, 3: 62, 4: 670}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976093803_976093809 26 Left 976093803 4:81486579-81486601 CCAGCATATTGAAATGAGTCATT 0: 1
1: 0
2: 1
3: 17
4: 167
Right 976093809 4:81486628-81486650 CAGAGCACACAGAAGGAGGGAGG 0: 1
1: 2
2: 4
3: 62
4: 670

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976093809 Original CRISPR CAGAGCACACAGAAGGAGGG AGG Intronic
900302039 1:1982684-1982706 CCGGGCCCACAGGAGGAGGGCGG + Intronic
900371462 1:2334039-2334061 CAGAGCAGACAGAAGGCATGGGG + Intronic
900438374 1:2641901-2641923 CAGAGGACACAGAGAGAGGCAGG + Intronic
902107258 1:14048056-14048078 CAGATCACACAGCTGGAGAGTGG - Intergenic
903451293 1:23455470-23455492 CAGAGGACAAAGAGGGAGTGAGG + Intronic
903574546 1:24330797-24330819 CAGGGCACACAGAGGCAGGAAGG - Intronic
903943322 1:26946390-26946412 GAGAGGACACAGAAGGAGCTGGG - Exonic
904238861 1:29131227-29131249 AGGAGCCCACAGAGGGAGGGGGG + Intergenic
904272050 1:29356545-29356567 CAGAGCTAAGAGAAGGAAGGAGG + Intergenic
904317640 1:29676108-29676130 GAGAGCACTGAGAAGGAGGCTGG + Intergenic
904757248 1:32774696-32774718 CAGAGGACAAAGGAGAAGGGAGG + Exonic
905120664 1:35679428-35679450 CAGAGAAGCCAGGAGGAGGGAGG - Intergenic
905320427 1:37112690-37112712 CAGAGTACATAGAAAGAGGGAGG + Intergenic
905401641 1:37707954-37707976 CAGACCCCACAGAAGGATGAGGG - Intronic
905912798 1:41665165-41665187 CAGAGCTCAGAGAAAGAAGGTGG + Intronic
907762820 1:57378121-57378143 CAGAGCTCAGAGCAGGATGGAGG + Intronic
907886639 1:58598151-58598173 CAGAAGCCACAGAAGCAGGGAGG - Intergenic
907926053 1:58956145-58956167 CAGGCCACACAGCAGGAGGTAGG + Intergenic
907971504 1:59386587-59386609 CAGCCCACACATAAGGAGTGGGG + Intronic
909659064 1:78062372-78062394 CAGAGAACACAGAAGAAGGAAGG - Intronic
910049072 1:82955774-82955796 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
910247782 1:85160658-85160680 AATAGCACAAAGAATGAGGGGGG - Intronic
910262720 1:85307651-85307673 CAGAGGACAGAGGAGGAGAGAGG - Intergenic
910677977 1:89833911-89833933 GAGAGCCCAAAGTAGGAGGGGGG - Intronic
911506364 1:98757399-98757421 CTGAGGACACAGCAGGAAGGTGG - Intronic
911613154 1:99979244-99979266 CAGAGCAACCAGATGGAGTGAGG - Intronic
912190004 1:107327044-107327066 CTGAGTCCAGAGAAGGAGGGAGG - Intronic
913336151 1:117710458-117710480 CACTGCACAAAGAAGGAGGTGGG + Intergenic
913439977 1:118886963-118886985 GAGAACACACTGAAGGAGGTTGG - Intronic
914320651 1:146556412-146556434 TAGAGCAAACTGAAGAAGGGTGG - Intergenic
914767570 1:150652775-150652797 AATAGCACAAAGAAAGAGGGTGG + Intronic
914939237 1:152007430-152007452 CAGAGATCAAAGAAGGAGGCTGG - Intergenic
915038396 1:152947445-152947467 CTGAGCAGGGAGAAGGAGGGGGG + Intergenic
915196491 1:154193727-154193749 CATATCACACAGAAGCAGGCAGG + Intronic
915594527 1:156888532-156888554 CAGAACACACAGACAGGGGGAGG - Intergenic
915679244 1:157564306-157564328 CACAGCACACAAAAAGAGGATGG - Intergenic
916215374 1:162389106-162389128 CAGTGCAAACAGTAGCAGGGAGG - Intergenic
916312307 1:163410721-163410743 GAGAGCAGACTGAATGAGGGAGG - Intergenic
916338330 1:163698441-163698463 CAGAGCACACAGAAAGAGCTTGG - Intergenic
916684056 1:167128442-167128464 CAGAAAACAGAGAAGAAGGGAGG + Exonic
916894892 1:169151800-169151822 CAGAGGACATAGACAGAGGGAGG - Intronic
917202667 1:172533470-172533492 CAGAGAGCACAGAAAGAGGCAGG - Exonic
917359561 1:174160281-174160303 CTGAGCACTCACAAGGTGGGTGG - Intronic
917498450 1:175564239-175564261 CAGGGCAGGCAGCAGGAGGGAGG - Intronic
918105312 1:181411408-181411430 CAGTGCACAAAGGAGGAGAGAGG + Intergenic
918714690 1:187770692-187770714 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
920335944 1:205245202-205245224 CAGAGGGCACAAAATGAGGGAGG + Intronic
920396475 1:205649646-205649668 CAGGGCACACAAAAGGAGCCTGG - Intergenic
920503667 1:206501389-206501411 CAGAGCACAGAGGAGGAGACAGG + Intergenic
920525311 1:206661766-206661788 CAGAGCACAGTGTAGAAGGGTGG + Intronic
920808405 1:209257049-209257071 CAGAGCAGACAGCAGACGGGAGG + Intergenic
920948886 1:210554511-210554533 CAAATCACACACAGGGAGGGTGG - Intronic
921022371 1:211247804-211247826 CAGATCTCACAGAAGGCAGGGGG + Intergenic
921308142 1:213817306-213817328 CAGAGGCCAGAGAAGGAAGGCGG + Intergenic
921626101 1:217379514-217379536 GAGGGCAAACAGAAGCAGGGTGG + Intergenic
921671350 1:217927265-217927287 GAGAGCAAAGAGAAGGAGAGTGG + Intergenic
922236455 1:223726256-223726278 CAGACCCCACAGAAGAAGGGAGG - Intronic
922663032 1:227446962-227446984 AAGAGCAAACAGAAGGCTGGGGG - Intergenic
922707575 1:227797316-227797338 AAGAGGACACAGGAGGAAGGTGG + Intergenic
923113451 1:230912067-230912089 CAGAACACAGAGAAGGGGCGTGG + Intronic
923545385 1:234919627-234919649 AAGACCACACAGAAAGAGAGAGG - Intergenic
923600416 1:235397996-235398018 CAAAGCAGACAGAAGGAGCAAGG - Intronic
923922013 1:238577499-238577521 CAGAGAACACAGAAGCAGCTGGG + Intergenic
924246322 1:242088626-242088648 CAGAGCCCACAGCAGGTGGCCGG - Exonic
924876563 1:248111310-248111332 AAGAGCACACAGAAAAAAGGAGG - Intergenic
1063472326 10:6298053-6298075 CAGAACAGAAAGAAGGGGGGAGG + Intergenic
1064973407 10:21089047-21089069 CAGAGGAGACAGAAAAAGGGAGG + Intronic
1067089000 10:43257182-43257204 CAGAGGTCACAGCAAGAGGGAGG + Intronic
1069566065 10:69464335-69464357 CACAACCCACAGAAGGAAGGTGG - Intronic
1069729760 10:70602946-70602968 CAGGGCACACAGGCGGAGGAGGG + Intergenic
1069909555 10:71751129-71751151 CTGAGCCCAGAGCAGGAGGGAGG + Exonic
1069911140 10:71760666-71760688 CAGAGCAGATGGAAGGAGAGTGG + Intronic
1069913107 10:71771800-71771822 CAGAGCACCCAGTAGCAGAGAGG - Intronic
1069984779 10:72275572-72275594 CAGAGCAGCCGGAGGGAGGGGGG + Exonic
1070392792 10:75985716-75985738 CAGAACTCAGAGATGGAGGGAGG + Intronic
1070652641 10:78249013-78249035 CACAGCACACAGGAGGAAGGAGG - Intergenic
1070783624 10:79150913-79150935 GAGAGCACCCACCAGGAGGGAGG - Intronic
1070786538 10:79165413-79165435 CAGAGCTTCCAGAGGGAGGGAGG + Intronic
1070949370 10:80418657-80418679 CTAAGCACACAGAAGCAGGCTGG + Intronic
1071301325 10:84258037-84258059 CAGAGAACAAAGATGGAGAGGGG - Intronic
1071514962 10:86291231-86291253 CAGAGCACACAACAAGAGGCAGG + Intronic
1073112602 10:101071578-101071600 AAGAGGACACAGAAGAAGGAAGG - Intergenic
1073206886 10:101774371-101774393 CAGGGCCCACAAAAGGAGAGTGG - Intronic
1073499684 10:103925146-103925168 AATAGCACAAAGAAGGTGGGAGG - Intergenic
1073559026 10:104481395-104481417 CAGAGCAAACAGAAACTGGGAGG - Intergenic
1074439551 10:113464132-113464154 CAGAGAACCCAAGAGGAGGGAGG + Intergenic
1075257202 10:120934725-120934747 CAAAGCAGGCAGAGGGAGGGGGG - Intergenic
1075335291 10:121604509-121604531 CAGGGCACACAGAGGGATGATGG + Intergenic
1075702435 10:124478126-124478148 CAGAGGAGGCAGGAGGAGGGAGG + Intronic
1075791569 10:125087999-125088021 AAGAGCTCACCGAAGGAGGTGGG - Intronic
1075891358 10:125954004-125954026 GAGAGCACACCGAACGAAGGAGG + Intronic
1075918593 10:126190867-126190889 TAGAGCACGCAGCAGGTGGGAGG + Intronic
1076063868 10:127433357-127433379 CAGAGGCCACAGACAGAGGGCGG - Exonic
1076273167 10:129174488-129174510 CAGAGCAGAAAGAAGGAGGCAGG - Intergenic
1076309550 10:129494895-129494917 CACAGCACAGAGAAGGAAGTTGG - Intronic
1076802537 10:132837262-132837284 TGGAGGACACAGAAGGATGGAGG - Intronic
1076923142 10:133465940-133465962 CAGAGCACAGAGAATGGGAGTGG - Intergenic
1076990815 11:272615-272637 AAGAGGACAAAGACGGAGGGAGG + Intergenic
1077237658 11:1489554-1489576 CAGACCACACTGAAGGGGTGGGG + Intronic
1077311879 11:1892446-1892468 CAGAGCACACACAATGGGTGGGG + Intergenic
1077428395 11:2499017-2499039 GAGGGCACACAGAAGCAGGTGGG - Intronic
1077860822 11:6178272-6178294 CAGGCCACACAGAAGGAGTTGGG + Intergenic
1077890295 11:6413436-6413458 CTGAGAACACAGAGGGAAGGGGG - Intronic
1078061003 11:8043982-8044004 AAGAGCAGCCAGAAGAAGGGGGG - Intronic
1078654832 11:13229029-13229051 CAGAGCAAAGAGAAGGAGACTGG + Intergenic
1078932863 11:15926316-15926338 CAAAGCAGACAGAAGAAGGTGGG + Intergenic
1079523276 11:21354346-21354368 GAGAGTAGAAAGAAGGAGGGAGG - Intronic
1080120064 11:28666866-28666888 CAGTGAGCACAGCAGGAGGGAGG + Intergenic
1080515730 11:33017697-33017719 CAGAGCACACAGAAAGAGAATGG - Intronic
1080822159 11:35817841-35817863 CAGAGCAGAAGGAAGGTGGGGGG - Exonic
1081914432 11:46721644-46721666 CAGAACACAGTGCAGGAGGGAGG - Intronic
1082757052 11:57087731-57087753 GAGAGCAGAAAGCAGGAGGGAGG + Intergenic
1083670080 11:64294887-64294909 CAGGGCAGAGAGAGGGAGGGAGG + Intronic
1084582523 11:70032805-70032827 CAGAACACATAGGAGGAGGAGGG + Intergenic
1084924129 11:72498234-72498256 AATAGCACAAAGCAGGAGGGAGG - Intergenic
1085080738 11:73632113-73632135 AAGAGCAAACAGAAGGTTGGAGG + Intergenic
1085247605 11:75116247-75116269 CAAAGCAGGCAGAAGGTGGGTGG + Intronic
1085248928 11:75128735-75128757 GAGAGCACACAGCAGGAAGCTGG - Intronic
1085435090 11:76493115-76493137 CGGAGCAGACAGCAGGAGCGGGG - Intronic
1085454348 11:76657231-76657253 CTGAGCACAGAGAAGGGGAGGGG + Intergenic
1085529191 11:77181644-77181666 CCAAGGGCACAGAAGGAGGGAGG - Intronic
1085567147 11:77524550-77524572 CAGAGAACACAGAAGAGGGCAGG - Intronic
1085670526 11:78460081-78460103 CTGAAGACACAGAAGAAGGGTGG + Intronic
1085801382 11:79593251-79593273 CAGAGCACACAGCAGCATTGTGG + Intergenic
1086354469 11:85980234-85980256 CAGAGGATAGAGAAGGAGGATGG + Intronic
1087916035 11:103811983-103812005 TAAAGCACAAAGTAGGAGGGTGG + Intergenic
1088222124 11:107580501-107580523 CAGAGCACACTGCATGGGGGTGG + Intergenic
1088696258 11:112368591-112368613 CAGAGCACAGAGAATCAGGGTGG + Intergenic
1088717167 11:112558994-112559016 AAGATCACACAGAGAGAGGGGGG + Intergenic
1088846310 11:113671269-113671291 GAGACCAGACAGAAGGAAGGTGG - Intergenic
1089189483 11:116643765-116643787 CTGGCCACACAGAAGGTGGGTGG + Intergenic
1089558868 11:119333414-119333436 CAGGGCAGACTGAAGGAGGACGG + Intergenic
1090022674 11:123141524-123141546 CACAGCACAAGGAAGGAGGAAGG - Intronic
1090399928 11:126442693-126442715 CAGAGCAGGCAGAGGGAGGGGGG - Intronic
1090667866 11:128926874-128926896 CAGAGGACACAGAAGCGGGATGG - Intergenic
1090800451 11:130168202-130168224 AAGAGCAAACAGAATGAGGAAGG + Intronic
1090879911 11:130824413-130824435 GAGAGGACACAGAAGAAGAGAGG - Intergenic
1090970301 11:131636653-131636675 CAGAGCCCACGGAAGGAGAATGG + Intronic
1091215637 11:133899699-133899721 CAGAGTCCACAGAAAGAGAGGGG + Intergenic
1091719843 12:2804623-2804645 GAGAGCTCACAGTAGGAGAGAGG - Exonic
1092313289 12:7382606-7382628 CAGAGCCCACAGAAGCTGAGGGG - Intronic
1092629031 12:10358826-10358848 GAGGGCAAACAGAAGCAGGGTGG - Intergenic
1093081806 12:14821360-14821382 CAGAGCCCCCAGAGGGAGAGAGG - Intronic
1093268289 12:17026861-17026883 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1093314728 12:17634148-17634170 CAGAACAAACAGAATGAAGGGGG - Intergenic
1094764416 12:33575784-33575806 CAAAGCAAATAGAAGGAAGGAGG - Intergenic
1095698230 12:45164745-45164767 CAGAGCACCCAGTGGGAGGGGGG - Intergenic
1095912052 12:47437738-47437760 CAAAGCAAACAGAAGGAAGGAGG + Intergenic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096649800 12:53056661-53056683 GAGACCATACTGAAGGAGGGTGG - Intronic
1096795978 12:54077804-54077826 CAGGCCTCAGAGAAGGAGGGCGG + Intergenic
1096805912 12:54141032-54141054 CAGAGGCCAGAGCAGGAGGGAGG + Intergenic
1097695072 12:62767764-62767786 CAGAGCCTTCAGAAGGAGCGTGG - Intronic
1098150948 12:67545604-67545626 CACACAACACAGAAGGAGGGAGG + Intergenic
1098394420 12:70003088-70003110 CAGAGGAGAGAGGAGGAGGGAGG + Intergenic
1098840077 12:75467402-75467424 TAGAGCAAGCAGAAGCAGGGTGG - Intergenic
1099107809 12:78518769-78518791 GAGGGCAAACAGAAGCAGGGTGG + Intergenic
1099904321 12:88754021-88754043 CAGAGGCCACAGGAGGAGGATGG + Intergenic
1100035139 12:90241189-90241211 CAGACCTCAGAGAAAGAGGGTGG + Intergenic
1101010155 12:100441146-100441168 GAGAGCACAGAGAAGGTAGGAGG - Intergenic
1101145728 12:101838867-101838889 CAGAGCAAACAGAATAAGGGGGG - Intergenic
1101802636 12:108035570-108035592 CAAAGCACACAGAAGACAGGAGG + Intergenic
1101835092 12:108289429-108289451 CAGAGCAGCCAGAAAGAGGGAGG + Exonic
1102052956 12:109876503-109876525 CAGAGAAGAAAGAAAGAGGGAGG + Intronic
1102422532 12:112815195-112815217 CAGGGCACAGAGCAGGATGGAGG + Intronic
1103017286 12:117505273-117505295 TTGAGCACACTGAAGGTGGGTGG + Intronic
1103261612 12:119593704-119593726 CAGAGGACGCAGAAGGGGTGAGG + Exonic
1103478983 12:121238773-121238795 CAGAGCCCACACAAGCAGGCTGG + Exonic
1103896725 12:124278086-124278108 CAGAGCACGGAGCTGGAGGGAGG + Intronic
1104035520 12:125094668-125094690 GAGAGCAGGCAGAAGGAGGTGGG - Intronic
1104594275 12:130109839-130109861 CAGAGCCCACAGAAAGAGAGTGG - Intergenic
1105014354 12:132777123-132777145 CACAGCACACTGGAGGAGCGTGG - Intronic
1105645865 13:22316743-22316765 GAGAGCAAACTGAAGCAGGGTGG - Intergenic
1105899399 13:24742581-24742603 CAGAGCAGACAGGAGCAGGAGGG - Intergenic
1106672628 13:31922897-31922919 CACAGCACAGAGCAGCAGGGAGG - Intergenic
1107289913 13:38840250-38840272 GAGAGCAAGCAGAAGCAGGGTGG - Intronic
1107924248 13:45243193-45243215 TAAAGTACACAGAAGGATGGAGG - Intronic
1108432763 13:50371031-50371053 CAGAGCACACAGAGGGGAGGAGG + Intronic
1108749094 13:53428743-53428765 CAGAGGACACAAGAGGAGCGGGG - Intergenic
1109119482 13:58436034-58436056 AAAAGCACAAAGAAGGAAGGAGG - Intergenic
1109709947 13:66146533-66146555 CAGAGCAAAAAGGAGGAGGACGG + Intergenic
1110035130 13:70673165-70673187 CAGAGCTCTCAGAGGGAGGGTGG - Intergenic
1110467146 13:75814950-75814972 ATGAGCACAGAGAAGGAGGTAGG + Intronic
1112011032 13:95294008-95294030 AAGAGCTCACACAATGAGGGAGG + Intronic
1113317586 13:109199252-109199274 CAGGGCACAGAGATGGAGCGAGG - Intronic
1114080774 14:19200273-19200295 CAGAGGACACAGAAGGAGGGAGG + Intergenic
1114307980 14:21440866-21440888 CAGAGGACACAGAAGCAGTTAGG + Intronic
1114645074 14:24251159-24251181 CTGAGCTCTCTGAAGGAGGGAGG + Intronic
1114701264 14:24680807-24680829 CAGAGGTCACAGAAGCAGTGGGG - Intergenic
1115339001 14:32272570-32272592 GAGGGCACACAGAAACAGGGTGG + Intergenic
1115448325 14:33517659-33517681 GAAAGCACAAAGAAGGAGTGAGG - Intronic
1116329013 14:43572692-43572714 TACAACACTCAGAAGGAGGGAGG - Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117061951 14:51972492-51972514 CACAGCACACTGAAGGAGACAGG - Intronic
1117481375 14:56148666-56148688 CAGAGAACACAGAAGAAAGGAGG - Intronic
1117710620 14:58525405-58525427 GAGAGCAAGCAGAAGCAGGGTGG + Intronic
1117750956 14:58923725-58923747 GAGAGCAAACAAAAGCAGGGTGG + Intergenic
1118840332 14:69505104-69505126 CACAGCACAGGGAAGGAGGGAGG + Intronic
1119076245 14:71642345-71642367 CAGAGCACAGAGAATCAGGGAGG + Intronic
1119316864 14:73703820-73703842 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1119893027 14:78197332-78197354 CAGAGAAGCAAGAAGGAGGGAGG - Intergenic
1120129990 14:80795322-80795344 CAGATAACACAGAAGGAAGAGGG - Intronic
1120878907 14:89399322-89399344 AAGAGCACACAGAGGGAGCTGGG + Intronic
1120943349 14:89970419-89970441 CATAGCACACAGGAGGAGTTTGG + Intronic
1121227331 14:92330705-92330727 CTGAGCACACAGCAAGAAGGTGG - Intronic
1121310661 14:92933502-92933524 CACAGCCCACAGGAGCAGGGGGG + Intronic
1121595766 14:95160984-95161006 CTGAGCCCAAAGAAGGAAGGTGG + Intergenic
1122289457 14:100672390-100672412 CAGAGCAGACAGCAGCAGAGGGG + Intergenic
1122293875 14:100694201-100694223 CAGGGCACACAGAGCGGGGGCGG + Intergenic
1122499989 14:102191083-102191105 CAGAGCACACAGAAGTATTTGGG - Intronic
1122501352 14:102202150-102202172 GAGAGCACAGGGAAGCAGGGTGG - Intronic
1122917935 14:104867354-104867376 CAGGGAACACAGAGGCAGGGCGG - Intronic
1123223451 14:106878032-106878054 CTGAGCACACAGAAGGCAGCAGG + Intergenic
1123830416 15:24130306-24130328 CAGGGCACGCAGAAGGGGTGTGG + Intergenic
1123850671 15:24352912-24352934 CAGGGCACGCAGAAGGGGTGTGG + Intergenic
1124006854 15:25801502-25801524 CAGAGCACTGAGAATGAGGGCGG + Intronic
1124085076 15:26542003-26542025 TACAGCAAACAGAAGGTGGGAGG + Intergenic
1124108983 15:26769766-26769788 CACAGAACAGAGAGGGAGGGAGG - Intronic
1124995054 15:34715603-34715625 CAAATCACACAGAAGGACAGAGG + Intergenic
1125145995 15:36469003-36469025 CAGACCAGACAGAGGGAAGGAGG + Intergenic
1125245836 15:37638045-37638067 CAGAGCAAACAGAAGGGAGGAGG + Intergenic
1125306205 15:38318577-38318599 CAGGGGAAAGAGAAGGAGGGAGG - Intronic
1125517710 15:40332001-40332023 GAGGGCACACAGGAGGAGGGAGG - Intronic
1125731605 15:41895346-41895368 GAGAGCACCCAGAGTGAGGGGGG - Intergenic
1126904508 15:53349917-53349939 CAGCTCACACATAAGGAGTGGGG - Intergenic
1127804806 15:62509665-62509687 CTGATCACACAGAACCAGGGAGG + Intronic
1128072916 15:64808359-64808381 CAAGGCTCACAGAAGGTGGGTGG - Intergenic
1128557979 15:68644706-68644728 CAGGGCCCACAGCAGGAGTGGGG - Intronic
1128562786 15:68679491-68679513 CAGAGCACAGAGGCAGAGGGAGG + Intronic
1128775239 15:70315509-70315531 AAGAGGACACAGAAGGATGTAGG - Intergenic
1129169796 15:73800666-73800688 AAAATCGCACAGAAGGAGGGAGG - Intergenic
1129185689 15:73904854-73904876 CAAAACACACAGATGGAGGGAGG + Intergenic
1129316193 15:74746245-74746267 CAGCCCACACCGAAGGAGTGGGG - Intergenic
1129464440 15:75716033-75716055 CAGAGCACAGGGTGGGAGGGAGG + Intergenic
1129720806 15:77876979-77877001 CAGAGCACAGGGTGGGAGGGAGG - Intergenic
1129868052 15:78924061-78924083 CAGAGCCCCCAGGAGGTGGGGGG + Intronic
1130936308 15:88473757-88473779 GAGAGCTCACAGAAGGAGGCAGG - Intronic
1131590768 15:93746548-93746570 GAGAGCAAACAAAAGCAGGGTGG + Intergenic
1131837154 15:96402267-96402289 AAAAGAACACAGAAAGAGGGAGG + Intergenic
1131846582 15:96495345-96495367 TAGGGCACAGAGAAGGAGGAGGG + Intergenic
1202975631 15_KI270727v1_random:290323-290345 GACAGCAGACAAAAGGAGGGGGG + Intergenic
1132739236 16:1403115-1403137 CAGAGCCCACAGCAGCAGGCAGG + Intronic
1132841995 16:1982590-1982612 AGGAGCATACAGATGGAGGGTGG - Exonic
1132919584 16:2379363-2379385 CAGAGCACACAGCAGCACGAAGG - Intergenic
1133064248 16:3194911-3194933 CAGAAGTCACAGAAGAAGGGCGG - Intergenic
1133103942 16:3494881-3494903 CAGAGGAGACAGCGGGAGGGTGG + Intronic
1133813326 16:9177904-9177926 AAGAGGACACAGCAGGAAGGTGG - Intergenic
1134303563 16:13012648-13012670 CAGGTCACAGAGAAGGAGGTGGG + Intronic
1134368660 16:13603307-13603329 CAGAGCTCCCAGAAGGAGAAAGG - Intergenic
1134384704 16:13760773-13760795 CTGAGCACATAGAATGAGGTGGG - Intergenic
1135060608 16:19268360-19268382 CACAGGACATAGAAGGTGGGAGG + Intergenic
1136066142 16:27760175-27760197 CAGAGCAGGCAGAAGGAAGCAGG - Intronic
1136114706 16:28087383-28087405 CAGAGCACACAGGCAGGGGGTGG + Intergenic
1136505861 16:30702644-30702666 CATTGCACTCAGAAGGAAGGAGG - Intronic
1137274355 16:46923763-46923785 CACACCACACAGACAGAGGGTGG + Intronic
1137696403 16:50464935-50464957 GACAGCACACAGAAGCGGGGTGG - Intergenic
1138282363 16:55781628-55781650 CAGAGCCCACCGCAGGCGGGCGG + Intergenic
1138652626 16:58469898-58469920 AAGAGCACACAGATGGTGAGTGG + Intronic
1138722155 16:59094882-59094904 CAGAAGAAACACAAGGAGGGAGG + Intergenic
1139923063 16:70471558-70471580 CAGAGCAGATGCAAGGAGGGAGG - Intronic
1140012882 16:71153693-71153715 TAGAGCAAACTGAAGAAGGGTGG + Intronic
1140031210 16:71340696-71340718 CTGAGCAGACAGGAGGTGGGAGG - Intergenic
1140363597 16:74364882-74364904 CAGAGAACAAAGAAGATGGGGGG + Intergenic
1141798953 16:86294400-86294422 AGGAGCACACAGAGGGAGGCTGG + Intergenic
1142075574 16:88115723-88115745 CAGAGCCCCCAGAAGGAGTACGG - Intronic
1142600670 17:1052176-1052198 CAGAACACACAGAACGGGGCTGG + Intronic
1142644027 17:1300663-1300685 CAGAGCACAGAGCAGGAGAAGGG + Exonic
1143796319 17:9339676-9339698 CAGAGTACACAGCAGGAATGAGG - Intronic
1143829327 17:9638404-9638426 CGGAGTACACAGAAGTAGAGAGG + Intronic
1144175917 17:12707407-12707429 AAAAGCACACAGAAGCAGGCTGG + Intronic
1146442754 17:32911330-32911352 GAGAGAACACAGAAAGAGGTGGG + Intergenic
1146680631 17:34805217-34805239 CAGTCCACACAGCAGGAAGGAGG - Intergenic
1146798509 17:35800036-35800058 CAGTGCAGAGAGAGGGAGGGAGG - Intronic
1146945239 17:36869158-36869180 CAGAGGTCACAGAGGGAGGAGGG + Intergenic
1147214949 17:38893622-38893644 CAGACCACACAGCTGGTGGGCGG - Intronic
1147529496 17:41262120-41262142 CAGAACACACAGACACAGGGAGG + Intergenic
1147844823 17:43397751-43397773 CAGAGCACACAGTATGAATGAGG + Intergenic
1148018827 17:44540281-44540303 AAGAGCACAAAGAAGGGGGCTGG + Intergenic
1148063281 17:44851070-44851092 CAGAGGCCACAGAAGGAAGCAGG + Exonic
1148346697 17:46908193-46908215 CAGACCTCACAGAGTGAGGGGGG - Intergenic
1148546382 17:48522319-48522341 CAGAGCCAACAGGAGGAGGCTGG + Intergenic
1149268545 17:54953394-54953416 CAGGTTACACAGAAGAAGGGGGG - Intronic
1149664218 17:58354483-58354505 CAGAGCTCACCCAAGGAGGGAGG + Exonic
1149984236 17:61335196-61335218 CAGAGCACACACAAGGCCTGCGG - Intronic
1150193705 17:63271649-63271671 CAGAACACACAGACACAGGGAGG - Intronic
1150220846 17:63495221-63495243 CGGGGCACACAGAAGGAGAGGGG - Intronic
1150437465 17:65165115-65165137 CAGAGCAGACAGGAGGAAGAAGG - Intronic
1150502032 17:65660286-65660308 GAGAGAAAAGAGAAGGAGGGAGG - Intronic
1150563213 17:66313070-66313092 CAGAGGAAACAGAAGTAGAGAGG - Intronic
1150960488 17:69906835-69906857 CAGATCCCAGAGAAGCAGGGCGG - Intergenic
1151444965 17:74157475-74157497 CACAGCAGGCAGAAGGAGGTGGG + Intergenic
1151652103 17:75476398-75476420 AAGAGGAAAGAGAAGGAGGGAGG - Intronic
1151887652 17:76932615-76932637 CCGAGCACGCAGAAGGAATGGGG - Intronic
1151971632 17:77460456-77460478 CATAGGACCCAGAAGGAGAGGGG - Intronic
1152367467 17:79864881-79864903 CAGAGGCCACAGCAGGAGGAGGG - Intergenic
1203172210 17_GL000205v2_random:158546-158568 CAGAGCACAGAGTATTAGGGAGG - Intergenic
1154253724 18:12765616-12765638 CAGAGCAGGCAGGAGGAGGGCGG + Intergenic
1154470839 18:14699406-14699428 AACAGCACCCAGGAGGAGGGAGG - Intergenic
1154969079 18:21389054-21389076 CAGATCACACTGAAGGAGCAGGG + Intronic
1155025819 18:21939902-21939924 AAGAGCACAGAGAGGGAGCGAGG - Intergenic
1155585721 18:27362252-27362274 GTGAGCACACAGACAGAGGGCGG - Intergenic
1155589257 18:27406892-27406914 CAGAAAACAGAGATGGAGGGAGG + Intergenic
1155632715 18:27913061-27913083 CATAGCCCACAGAAGGCTGGTGG - Intergenic
1155783697 18:29873161-29873183 GAGAGCACACTGAAGTAAGGAGG - Intergenic
1156547881 18:37983881-37983903 CAGAGCTCACAGGAGGAAGAAGG - Intergenic
1156550477 18:38011143-38011165 CAAAGAAGACAGAAGGAGGGAGG + Intergenic
1156571687 18:38262732-38262754 CAAATCACACAGAAGGTGGCAGG - Intergenic
1157077466 18:44480809-44480831 CAAAGCCCAGAGAAGGATGGAGG - Intergenic
1157563363 18:48663836-48663858 CACACCACAGGGAAGGAGGGAGG - Intronic
1157779813 18:50428237-50428259 CAGAGCAAGCAAAGGGAGGGAGG + Intergenic
1157802069 18:50628733-50628755 CAGAGCCCACAGGAGGAATGTGG - Intronic
1157972460 18:52285944-52285966 CAGAACACCAGGAAGGAGGGAGG + Intergenic
1159114349 18:64095692-64095714 CAGAACACAAAGAAAGTGGGTGG + Intergenic
1159386052 18:67726322-67726344 GAGAGCAAATAGAAGCAGGGTGG - Intergenic
1159607022 18:70485425-70485447 CAGAGCACTGAGAGGGAGTGTGG - Intergenic
1159855027 18:73576244-73576266 CAGAGCAAACAGAACAAGGCTGG - Intergenic
1159985053 18:74831874-74831896 CACAGCACACGGAGGGTGGGAGG - Intronic
1160111260 18:76033987-76034009 TAGAGCACACAGAGGGAAGACGG + Intergenic
1160362847 18:78298360-78298382 CAAAGCACACTGAGGGAGAGGGG - Intergenic
1160675662 19:389974-389996 CGGAGGACAGAGAAAGAGGGAGG - Intergenic
1161185335 19:2914876-2914898 AACAGCACAGAGGAGGAGGGTGG - Intronic
1161688008 19:5713126-5713148 CATGGGACACAGAAGGTGGGTGG - Exonic
1161719707 19:5896046-5896068 CAAGGCACACAGAAGGAAGGCGG + Intronic
1161950221 19:7463678-7463700 CACGGCACACAGAAGGGGGCAGG + Intronic
1161970658 19:7578044-7578066 AAGAGGACACCGAAGGAGGAAGG + Intergenic
1163118318 19:15200930-15200952 CGGAGCCCAGGGAAGGAGGGAGG - Exonic
1163388552 19:17015509-17015531 CAGAGCAGACAGGAGGTGGGTGG - Intronic
1163815226 19:19460938-19460960 CAGAGCACACAGAGGGACGGGGG - Intronic
1163926760 19:20353257-20353279 AAGAGCACACAGAGGGGGGAGGG - Intergenic
1164648648 19:29876377-29876399 CAGGAGACACAGAAGGAGGCTGG - Intergenic
1164679115 19:30122157-30122179 CACTTCACACAGATGGAGGGAGG + Intergenic
1164982456 19:32624555-32624577 GAGAGAAGCCAGAAGGAGGGCGG + Intronic
1165749405 19:38251148-38251170 CAGAGGCCACAGGAGGAGAGAGG + Intronic
1166304928 19:41932302-41932324 CAGAGGACACAGTGGTAGGGTGG - Intergenic
1166663500 19:44662754-44662776 CAGACCACACAGAAGGGTGTGGG + Exonic
1166750361 19:45161595-45161617 CAGGGCACACAGAGGCAGGGCGG + Intronic
1166914906 19:46188738-46188760 CAGAGGACAAACAAGGAGTGAGG - Intergenic
1166921059 19:46229534-46229556 CATAGCACAGAGAAGGTGGAGGG + Intergenic
1167012221 19:46816186-46816208 CTGAGCACACAGGAGGTGGTCGG + Intergenic
1167046877 19:47054903-47054925 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1167200157 19:48059563-48059585 CAAAGCAGACAGAAGAAGGTGGG + Intronic
1167357097 19:49010815-49010837 CAGAGAACACAGGAGGGGAGAGG - Intronic
1167571344 19:50290822-50290844 CCTAGCACACAGAGGGAGGCTGG + Intronic
1168275681 19:55277073-55277095 CAGAGCTCACAGAAGGTTTGAGG - Intronic
1168296528 19:55379728-55379750 CAGTGAAGACAGAAGGAGGCCGG + Intronic
925191451 2:1887650-1887672 CATGGCACACAGACTGAGGGAGG + Intronic
925204785 2:1996661-1996683 CAGCCCACACTGAAGCAGGGTGG - Intronic
925204825 2:1996868-1996890 CAGTCCACACTGAAGCAGGGCGG - Intronic
925204851 2:1997002-1997024 CAGCCCACACTGAAGCAGGGCGG - Intronic
925204877 2:1997136-1997158 CAGCCCACACTGAAGCAGGGTGG - Intronic
925773435 2:7307285-7307307 TAGAACACAAAGAAGGAGGAAGG + Intergenic
925912906 2:8584591-8584613 GAGAGCACACAGTAGGTGCGCGG - Intergenic
926188897 2:10712557-10712579 CAGAGAGCACAGATGAAGGGCGG + Intergenic
926252471 2:11163286-11163308 CAGAATACACAGAATGAGGTGGG + Intronic
926266882 2:11331005-11331027 AGGAGCAGAAAGAAGGAGGGAGG + Intronic
926702837 2:15815308-15815330 CTGAGGAAACAGAAGGAAGGAGG - Intergenic
927374755 2:22400931-22400953 CAGAGCAGAGAGAAGTAGGCAGG + Intergenic
927433196 2:23044264-23044286 TAGAGCCCCCAGAAGGAGTGTGG + Intergenic
927571969 2:24167762-24167784 CAGAGTCCACAGTGGGAGGGAGG + Intronic
928032701 2:27795305-27795327 CAAACCACAAAGAAGCAGGGAGG + Intronic
928214319 2:29348732-29348754 CAGATCACATAGAAGGAATGAGG + Intronic
928320434 2:30278957-30278979 CAGAGGACACAGCAAGAGGTTGG - Intronic
929138697 2:38648689-38648711 CAGAGCACACAGAAAACAGGTGG + Intergenic
929995897 2:46826019-46826041 CAGACCACACAGAGGGATTGCGG + Intronic
930892079 2:56401635-56401657 GAGAGGACACAGTAGGAGTGGGG - Intergenic
930997443 2:57737503-57737525 CAGAGCAGAAAGAAGGAGACTGG + Intergenic
931077693 2:58734988-58735010 GAGAGGAGAGAGAAGGAGGGAGG - Intergenic
931199149 2:60080352-60080374 CATAGCACACAAAAGGAGTAAGG + Intergenic
931722487 2:65077429-65077451 CAGAGCAAAGACATGGAGGGAGG + Intronic
932123345 2:69121123-69121145 ATGAGCACACAAAAGGAGGAGGG - Intronic
932444323 2:71765781-71765803 CACAGCACAGTGAAGGAGAGAGG - Intergenic
932699122 2:73981503-73981525 TAGAGCAGACAGAGGGAGAGAGG - Intergenic
933639053 2:84740448-84740470 CAGGGCACTGAGAAGAAGGGTGG + Intronic
934059721 2:88282998-88283020 CAGAGCACACAGAATGAGGTGGG - Intergenic
934818188 2:97348472-97348494 CAGTGCAGACAGGAGGAGGCAGG + Intergenic
935795277 2:106634917-106634939 CAGACCACACACAGGGAGGAAGG + Intergenic
936444377 2:112584746-112584768 CAGATCTCCAAGAAGGAGGGAGG - Intronic
936459060 2:112698077-112698099 CAGAGGACAGAGAAGGTGGTAGG - Intergenic
936506882 2:113115292-113115314 TAGACCACACACAAGCAGGGGGG - Intronic
937726038 2:125167737-125167759 CAAAGCACAGAGAGGGAGAGCGG + Intergenic
938204573 2:129408297-129408319 TAAAGCACAAAGGAGGAGGGAGG - Intergenic
938219674 2:129554604-129554626 CAGAGCACACAGCTGGAGAGAGG - Intergenic
938261148 2:129895891-129895913 CAGGGCACACAGAGGAAGGAAGG + Intergenic
939323498 2:140655598-140655620 CAGAGCACAGAGAAGTAGCTAGG + Intronic
939956326 2:148530446-148530468 CAGAGGACACAGCAAGAAGGTGG + Intergenic
941641389 2:167992438-167992460 CAGAGCAGAAAGAAGGATGTGGG + Intronic
941957279 2:171217533-171217555 AAAAGCAGACAGCAGGAGGGAGG + Intronic
942196571 2:173526656-173526678 CTGAGCAAAAAGAAGGAGGCTGG - Intergenic
942243879 2:173989813-173989835 CAGAGCACTGGGAGGGAGGGGGG - Intergenic
942644532 2:178095934-178095956 CAGAGCACAGAGCAGCAGTGGGG + Intronic
943813034 2:192213216-192213238 CAGATAACACAGAAAGAGTGGGG - Intergenic
945020169 2:205562835-205562857 CAGAGAAGACAGGAGGAGGTAGG - Intronic
945223962 2:207512817-207512839 TGGAGCAAACAGAAGGAGAGTGG + Intergenic
945398314 2:209348794-209348816 CAAAGCAGACAGCAGGAGGGAGG - Intergenic
945482287 2:210357986-210358008 GAGGGCAAACAGAAGCAGGGTGG - Intergenic
945782300 2:214190756-214190778 GAGAGGACACAGAAAGAAGGTGG + Intronic
945965751 2:216184881-216184903 CAGGGCATACAGAAGAAGGGAGG - Intronic
946056091 2:216903187-216903209 CAGAGGACTCAGAAGAAGGCAGG - Intergenic
946359932 2:219213169-219213191 CAGAGCACTGAGAAGCAGGAAGG + Intronic
946617565 2:221526500-221526522 CTGAGCACACAGGAGAAAGGTGG - Intronic
947013160 2:225588458-225588480 CACAGCACAAAAAAGGAGAGAGG - Intronic
947344171 2:229173743-229173765 CAGGGCACACCGAAGTGGGGAGG - Intronic
947442812 2:230138009-230138031 CAGAAGACACAGAGGGAGGTAGG - Intergenic
947719802 2:232363509-232363531 CAGTGCACCCAGGAGGAGAGGGG + Intergenic
947760279 2:232599143-232599165 CAGAGCCCACCCAAGGTGGGGGG - Intergenic
947855259 2:233319637-233319659 CAGGGCACCCAGGAGGAAGGTGG - Intronic
948342745 2:237268434-237268456 AAGAGGACACAGTAGGAGGCAGG - Intergenic
948381983 2:237557055-237557077 GAGAGAACAGAGAGGGAGGGAGG - Intergenic
948549945 2:238764623-238764645 CAGAGCCAAGTGAAGGAGGGAGG + Intergenic
948611715 2:239173113-239173135 CAGAGAATACAAAAGGAGAGAGG + Intronic
948687354 2:239677563-239677585 CAGCGCACACCCAGGGAGGGAGG - Intergenic
1168805531 20:670310-670332 CAGAGCAGAAAGTAGGAGGCCGG - Intronic
1169078781 20:2781143-2781165 CTGAGTACAGACAAGGAGGGTGG - Intergenic
1169578267 20:6990434-6990456 CAGAGCCTCCGGAAGGAGGGTGG + Intergenic
1170747711 20:19115512-19115534 CAGAGGTCCCAGAAGGGGGGAGG + Intergenic
1170872066 20:20214877-20214899 CAGGGCAGGCAGAAGGAGAGTGG + Intronic
1171287572 20:23954373-23954395 CAGAGCATGCAGGAGGAGAGTGG - Intergenic
1172053965 20:32141289-32141311 TAGAGCCCAAAGGAGGAGGGTGG + Intronic
1172782913 20:37447783-37447805 CAGAGGAAACAGGAGAAGGGTGG - Intergenic
1173622546 20:44447930-44447952 CAGAGCAAACAGGAAGAGAGAGG + Intergenic
1173827898 20:46058852-46058874 CAGAGCACGGAGAAGGCGGCTGG - Intronic
1175247260 20:57589687-57589709 CATGGCACACAGCAGGAGTGGGG - Intergenic
1175839071 20:62015167-62015189 CAGACCCAACAGAGGGAGGGTGG + Intronic
1176193324 20:63824626-63824648 CAGAGCACCCAGAAGAACGGGGG - Intronic
1176424163 21:6537725-6537747 CTCAGCTCCCAGAAGGAGGGAGG + Intergenic
1176653463 21:9570408-9570430 CAGAGCAGACAGAAGGCAGGAGG - Intergenic
1176891697 21:14327002-14327024 GAGGGCACGCAGAAGCAGGGTGG + Intergenic
1177752255 21:25298743-25298765 CAGAACACACAGAAGAAGTAGGG + Intergenic
1177801108 21:25829898-25829920 CAGAACACCCAGAAGAAGGAAGG - Intergenic
1179699656 21:43146040-43146062 CTCAGCTCCCAGAAGGAGGGAGG + Intergenic
1179939600 21:44629017-44629039 CAGACCAGACAGCAGGAAGGAGG + Intronic
1180499999 22:15922412-15922434 CAGAGGACACAGAAGGAGGGAGG - Intergenic
1180831930 22:18910972-18910994 CAGAGCACACTGGAGAAGGCGGG + Exonic
1181067915 22:20315370-20315392 CAGAGCACACTGGAGAAGGCGGG - Exonic
1181550583 22:23636965-23636987 CAGAGCCCTCAGAAGGAGCCTGG + Intergenic
1181805003 22:25369439-25369461 CTGCGCCCACAGAAGGTGGGTGG - Intronic
1181968993 22:26676009-26676031 CAAAGCAGACTGAATGAGGGAGG - Intergenic
1182088836 22:27580335-27580357 CAAAGCCCAGAGAAGCAGGGAGG - Intergenic
1183226209 22:36551639-36551661 CAGAGCTCAGACAAGGAGAGAGG + Intergenic
1183279291 22:36923482-36923504 CAGAGGACAGAGGAGGAGGGAGG + Intronic
1183284305 22:36952775-36952797 CAGAGGACAGAGGAGGACGGAGG - Intergenic
1184001164 22:41674670-41674692 CAGAGCAGACAGAAGCAGGGTGG - Exonic
1184015526 22:41783078-41783100 CAGAGGACAGGGAAGGTGGGTGG - Intronic
1184105088 22:42362798-42362820 CAGAGCACAGGGAGGGAGAGGGG + Intergenic
1184428017 22:44424449-44424471 CAGAGCAGAAAGATGGAGAGAGG - Intergenic
1184947122 22:47811378-47811400 CAGCACACACAGAAGCAGGCAGG - Intergenic
1185117539 22:48946143-48946165 CAGGGCATACGGAGGGAGGGAGG + Intergenic
1203282008 22_KI270734v1_random:136243-136265 CAGAGCACACTGGAGAAGGCGGG + Intergenic
950211434 3:11126509-11126531 CAGACCACAAAGAGAGAGGGCGG + Intergenic
950495781 3:13333493-13333515 CAGAGCACAGAGGAGCTGGGAGG - Intronic
952360506 3:32625912-32625934 AAGAGCTCACGGAGGGAGGGGGG - Intergenic
953102438 3:39842755-39842777 GAGGGCAGACAGAAGCAGGGGGG - Intronic
953178493 3:40574247-40574269 CAAGGCACAGAGAATGAGGGAGG + Intronic
953903949 3:46858859-46858881 CACAGCACACAGAAGTACGGAGG - Intronic
953916402 3:46923559-46923581 CAGGACACACAGAAGCAGCGAGG + Intronic
954524862 3:51261260-51261282 GAGGGCAAGCAGAAGGAGGGTGG + Intronic
955454051 3:59100804-59100826 GAGAGCAATCAGAAGCAGGGTGG - Intergenic
955506116 3:59634872-59634894 CAGAAAACACAGAAGTAGGGTGG - Intergenic
955892371 3:63663662-63663684 CAGATCACACAGCAAGAGAGGGG - Intronic
956327994 3:68074293-68074315 TGGACCACACAGTAGGAGGGAGG - Intronic
956983411 3:74667741-74667763 AAGAGCACACTGAATGAAGGAGG + Intergenic
957713342 3:83892676-83892698 CACAGCATACAAAGGGAGGGAGG - Intergenic
957776415 3:84760854-84760876 CAGGGCAAGCAGAAGCAGGGTGG + Intergenic
959321898 3:104887170-104887192 CAGAGCCCATAGCAGGAGGAGGG + Intergenic
959950545 3:112175578-112175600 CAGAGCGCCCAGAGGGAGGGTGG - Intronic
961001557 3:123377506-123377528 CACAGCACTCAGAGGGAGGGAGG - Intronic
961048633 3:123727277-123727299 CAGACCACCCAGAAGGTGTGGGG + Intronic
961349114 3:126287748-126287770 CAGAGCTCACAGGAGGGGGCTGG - Intergenic
962496813 3:135948195-135948217 CAAACCACACATAAGGAGTGGGG + Intergenic
962739988 3:138356627-138356649 CAGAGATGATAGAAGGAGGGTGG + Intronic
962765633 3:138560207-138560229 GAGGGCAAACCGAAGGAGGGTGG + Intronic
963138560 3:141929586-141929608 CAGAGCCCGCGTAAGGAGGGAGG + Intergenic
963401818 3:144807281-144807303 GAGAGCGAACAGAAGCAGGGTGG - Intergenic
963935976 3:151053947-151053969 AAGAGCACAAAGAAAGAAGGTGG + Intergenic
964122172 3:153196329-153196351 CAGAGCACACAGAGGCTGGCAGG + Intergenic
964249937 3:154701665-154701687 AACAGCACAAAGAAGGTGGGTGG + Intergenic
964718529 3:159748554-159748576 CTGGGCACAGTGAAGGAGGGTGG - Intronic
965602377 3:170467984-170468006 GAGAGCACACAGAAGAAAGCAGG - Intronic
965614991 3:170585067-170585089 CACAGGAGAGAGAAGGAGGGTGG + Intronic
965622031 3:170651444-170651466 GAGAGCAAGCAGAAGCAGGGCGG - Intronic
965773092 3:172201291-172201313 GAGAGCAGCCAGAAGCAGGGTGG - Intronic
967279307 3:187806658-187806680 CAGGACACACAGAATGAGAGTGG - Intergenic
968505721 4:970452-970474 CAGAGCCCTTAGAGGGAGGGTGG + Intronic
968639218 4:1702909-1702931 CACCGCACACAGAAGGTCGGTGG + Intronic
968789577 4:2650331-2650353 TTGAGAGCACAGAAGGAGGGAGG + Intronic
969155385 4:5205458-5205480 CAGGGCACACAGAGACAGGGAGG + Intronic
969261352 4:6036118-6036140 CAGATCACACAGACAGAGGAAGG + Intronic
969307831 4:6335827-6335849 CAGAGCAGGCAGCAGGAGGAAGG + Intronic
969469834 4:7381323-7381345 CGGAGCACAGAGCTGGAGGGCGG + Intronic
969537855 4:7767699-7767721 CAGAGAGCACAGCAGGGGGGCGG + Intronic
969590761 4:8120636-8120658 CAGAGCACACAGATGGGGGCTGG - Intronic
970215152 4:13751167-13751189 CAGATCACAAAGAAGGAGAAGGG + Intergenic
970719838 4:18973540-18973562 CAGAGCACACAAAGCCAGGGAGG - Intergenic
971180275 4:24323767-24323789 CAGAGCAAAGAGCAGGAGGATGG - Intergenic
972169942 4:36333762-36333784 CCGTGCCCACAGAAGGAGTGTGG + Intronic
972171406 4:36350103-36350125 TTGAGTACACAGGAGGAGGGTGG - Intergenic
972336630 4:38112818-38112840 CAGGTCACACAGATGGAGTGTGG - Intronic
972589797 4:40473974-40473996 CAGTGCACAAAGACGGAGTGGGG - Intronic
973669365 4:53199908-53199930 CATGGCAGAGAGAAGGAGGGAGG + Intronic
973821218 4:54663266-54663288 CAGAGCACACAGCAGGGAAGAGG - Intronic
974385869 4:61201582-61201604 CAGAGAAAGCAGCAGGAGGGTGG - Intronic
975379713 4:73685014-73685036 GAGAGGACACAGAAGCAGGAAGG + Intergenic
975632782 4:76419519-76419541 CAGAGCCTCCAGAGGGAGGGAGG - Intronic
975635823 4:76446922-76446944 CAGAGCAGACAGATTGAGCGTGG - Intronic
976093809 4:81486628-81486650 CAGAGCACACAGAAGGAGGGAGG + Intronic
976781295 4:88761544-88761566 CACATCACACAGAAGGAAGGAGG + Intronic
976822893 4:89226933-89226955 CAGAGAACAAAGAAAGAGTGTGG - Intergenic
978052684 4:104222037-104222059 CAAAGCACACAGTGGGAAGGTGG + Intergenic
978120617 4:105074703-105074725 CAAAGCAGAGAGAGGGAGGGAGG - Intergenic
978562357 4:110046539-110046561 CAGAGCTCACAGATGGCAGGGGG - Exonic
979987585 4:127333983-127334005 CAGTGCAAACAGAGGAAGGGAGG - Intergenic
980093652 4:128467661-128467683 CAGAGTACAGGCAAGGAGGGCGG - Intergenic
980575925 4:134683072-134683094 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
981491915 4:145348679-145348701 CAGAGCCCACAGAAGGAGAATGG - Intergenic
981784497 4:148462162-148462184 CAGGCCACACAGCAGGAGGTAGG + Intergenic
982074273 4:151722820-151722842 CTGAGCTCAAAGGAGGAGGGAGG + Intronic
982138949 4:152299215-152299237 CAGAGCACACTGAAGAATGCTGG + Intergenic
982317736 4:154048309-154048331 CAAAGGATACAGGAGGAGGGTGG + Intergenic
982412723 4:155097374-155097396 GAGATCACACAGAAAGAGAGTGG - Intergenic
982755699 4:159216144-159216166 GAGACCACACAGTAGGAGTGTGG - Intronic
983176722 4:164596855-164596877 CAGAACTCACAGAAGCAGAGTGG + Intergenic
983274977 4:165605782-165605804 CAGAATACAGAGAAGGAGGAAGG + Intergenic
984541023 4:181036975-181036997 CCAAGCACACATAAGGAGTGTGG - Intergenic
985052100 4:186001092-186001114 CAGTGCTTACAGAAAGAGGGAGG - Intergenic
985657890 5:1141490-1141512 GAGAGCACAGAGAGGGAGGCAGG - Intergenic
985720183 5:1484840-1484862 CTGAGCCCACAGCAGGAAGGGGG - Intronic
985986068 5:3517467-3517489 CAGAGCAGAAAGACGGGGGGAGG - Intergenic
986283831 5:6345593-6345615 CAGAGAACAGAGGAGGAGGGAGG + Intergenic
986496827 5:8350867-8350889 CAGCCCACAGAGAAGCAGGGAGG + Intergenic
986512017 5:8517428-8517450 CAGAGCAAGCAGAAGCAGGGTGG - Intergenic
987075897 5:14381428-14381450 CAAAGGACACAGATGAAGGGAGG - Intronic
987576030 5:19730019-19730041 CAAAGCAGAAAGAAGGTGGGAGG - Intronic
987962772 5:24831934-24831956 CAGAGAACACAGCAGGAGCTAGG - Intergenic
988731574 5:33977762-33977784 CAGAGCACAGAGAATGTGGAAGG + Intronic
988977234 5:36527323-36527345 CAGAGTACACAGTAACAGGGGGG - Intergenic
989182201 5:38589752-38589774 TCGAGGACAAAGAAGGAGGGAGG - Intronic
990435215 5:55783610-55783632 CAGACCAAAAGGAAGGAGGGAGG + Intronic
990987009 5:61649890-61649912 CAGATGACACAGAAGGAGAGGGG - Intronic
991405081 5:66293672-66293694 GAGAGCACTCAGATGGTGGGGGG - Intergenic
991692383 5:69237501-69237523 CAAAGCATAGGGAAGGAGGGAGG - Intronic
994016738 5:94975429-94975451 CTGAGCACACAGCAGGAAGGTGG + Intronic
994831727 5:104792234-104792256 CATAGGAGAAAGAAGGAGGGGGG + Intergenic
995253549 5:110019885-110019907 CAGAGCACTGAGAAGGAGTATGG + Intergenic
995987037 5:118189581-118189603 ATGAGCACAAAGAAGGAAGGTGG + Intergenic
996192910 5:120567434-120567456 CAGAGTACACAGAGGGTGGTAGG + Intronic
997127706 5:131244810-131244832 CAGATCACTCTGAAGGGGGGTGG + Intergenic
997217924 5:132129718-132129740 GAGAGCAAGCAGAAGCAGGGTGG - Intergenic
997732780 5:136192978-136193000 CAGAGCGCACGGAGGGCGGGTGG + Intergenic
997751076 5:136346444-136346466 CAGAACAGATAAAAGGAGGGAGG - Intronic
997846029 5:137286683-137286705 CAAATCACAGAGCAGGAGGGTGG + Intronic
998069105 5:139182777-139182799 CTGAGGACACAGGAGCAGGGGGG + Intronic
998870052 5:146542987-146543009 GAGAGCACACAGTTGGAAGGGGG + Intergenic
999258185 5:150221559-150221581 CAGGGCAGAGAGGAGGAGGGAGG - Intronic
999477342 5:151912664-151912686 CAGAGCCAATAGAAGGAGGATGG + Intronic
1000154744 5:158539411-158539433 CAGAGCTAACAGAAGGAAAGAGG - Intergenic
1002299968 5:178252469-178252491 CAGAGCAGACAGGAAGAGGGAGG + Intronic
1002319377 5:178365897-178365919 CAGTGAACACAGCAGGAAGGGGG + Intronic
1002594595 5:180313723-180313745 CAGAGCAGGCCGGAGGAGGGCGG + Intronic
1002764631 6:228295-228317 CAGAGCACGAGGAGGGAGGGAGG + Intergenic
1003051695 6:2786409-2786431 CACTCCAGACAGAAGGAGGGAGG - Intronic
1003141755 6:3477698-3477720 CAGGCCACACAGCAGGAGGTGGG - Intergenic
1003536354 6:6978855-6978877 TAGAGCACAAAGAGGAAGGGAGG + Intergenic
1003790704 6:9544201-9544223 CAGAGGAAACAGAAATAGGGTGG + Intergenic
1003794187 6:9581614-9581636 TAGAGCCTACAGAAGGAGAGGGG + Intergenic
1004082068 6:12404522-12404544 CAGACAAGACAGAAGGAGAGAGG - Intergenic
1004180556 6:13377484-13377506 CAGGGCACACAGCAGGAAAGTGG - Intronic
1004224148 6:13770822-13770844 CAGAGCTCACAGATGGTGGCTGG - Intergenic
1004991022 6:21138898-21138920 AAGGGCACACAGAAGGAGAAAGG - Intronic
1005061115 6:21777889-21777911 CAAACCTCACAGAGGGAGGGAGG - Intergenic
1005083454 6:21980596-21980618 CAGAGCAGGAAGAAGGAGGCAGG - Intergenic
1005658175 6:27965390-27965412 CAGAGCCCAGAGAAGCAGAGAGG - Intergenic
1005674690 6:28141753-28141775 CACAGCACACAGCAGGTGAGGGG + Intergenic
1005893033 6:30155256-30155278 CACAGATGACAGAAGGAGGGCGG - Intronic
1006371924 6:33650146-33650168 AAGGGCAGAGAGAAGGAGGGTGG - Intronic
1006449690 6:34098935-34098957 CCCAGCCCACAGAGGGAGGGAGG - Intronic
1007229239 6:40336868-40336890 CAGAGCAACCAGAAGGATGGGGG + Intergenic
1008025233 6:46628634-46628656 CAGAGTACAAAGTAGGAGAGAGG + Intronic
1009195930 6:60684371-60684393 AAGAGAAGAGAGAAGGAGGGAGG + Intergenic
1009413799 6:63394952-63394974 CAGTGCACACAGAGGGAAGAAGG - Intergenic
1009950252 6:70387147-70387169 AAGAGCAAAAAGAAGCAGGGAGG - Intergenic
1010289879 6:74123070-74123092 AAAAGCACAAAGAAGGAGGTGGG - Intergenic
1010290708 6:74133312-74133334 GAGGGCACACAGTAGGAGGTGGG + Intergenic
1010849517 6:80754821-80754843 CTGAGCAAAAAGAAGGAAGGTGG - Intergenic
1011020784 6:82809787-82809809 GAGGGCAAACAGAAGCAGGGTGG - Intergenic
1011380599 6:86738574-86738596 CAGCCCACACTGAAGGAGTGGGG + Intergenic
1011744600 6:90397290-90397312 CAGAGCAATTAGCAGGAGGGAGG - Intergenic
1012160956 6:95885652-95885674 ATGAGCACACAGAAAGAAGGTGG - Intergenic
1012441964 6:99269172-99269194 CAGACCACACAGAAGGTAGAAGG - Intergenic
1013376361 6:109518964-109518986 CAGAACACCTAGAAGGAGGAGGG - Intronic
1014183180 6:118407456-118407478 CAGAGAACACTGACGGGGGGAGG - Intergenic
1015577806 6:134691180-134691202 AAGAGGAGAAAGAAGGAGGGAGG + Intergenic
1016417298 6:143846176-143846198 CAGTGCACACAACAGGAGAGAGG + Exonic
1016650662 6:146455964-146455986 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1017492987 6:154960269-154960291 CAGAGGTCTCAGAAGAAGGGAGG - Intronic
1017595933 6:156028558-156028580 CAAAGCACACGGAAGCAGGCTGG - Intergenic
1017658107 6:156649140-156649162 CTGAGCAGACAGAAGCTGGGAGG + Intergenic
1017955388 6:159173419-159173441 CAGTGCACAAAAAAGGAGAGAGG - Intronic
1018949377 6:168369232-168369254 CAGTACATACAGAAGGAGGGAGG - Intergenic
1019122531 6:169814347-169814369 CAGACCACACTGATGGATGGAGG + Intergenic
1019328153 7:449523-449545 GGGAGCTCACAGTAGGAGGGGGG - Intergenic
1020632511 7:10656617-10656639 CAGAGAACTAAGAAGGCGGGTGG + Intergenic
1021496003 7:21275556-21275578 CAGCGCACCCAGACTGAGGGGGG + Intergenic
1021575545 7:22102655-22102677 CAGAGCTCTCAGAAGGAGCCAGG - Intergenic
1022232116 7:28424066-28424088 CAGAGAAGACAGAAGAAGGAGGG - Intronic
1022237090 7:28472790-28472812 CAGAGCACAGAGAAGCACTGAGG - Intronic
1022289419 7:28986589-28986611 AAGAGAACAGGGAAGGAGGGAGG + Intergenic
1022505676 7:30907583-30907605 CAGAGAACCCTGATGGAGGGTGG - Intergenic
1022822969 7:33979458-33979480 CTAAGCACAGAGGAGGAGGGAGG - Intronic
1023366399 7:39468284-39468306 CGGAGCAGGCAGCAGGAGGGAGG + Intronic
1023382590 7:39623585-39623607 CAGAGCCGCCAGGAGGAGGGTGG + Exonic
1023623573 7:42095685-42095707 GAGAGGACACAAGAGGAGGGAGG + Intronic
1023768139 7:43531055-43531077 TAGAGCATACAGAATGAGGAAGG - Intronic
1023842030 7:44103517-44103539 CAGAGGACCCAGAAGGCAGGTGG - Intergenic
1024242726 7:47447995-47448017 CAGAGAAGACAGCAGGAGGCTGG + Intronic
1024292999 7:47819203-47819225 CAGAGCACCCAGAGGCAGTGAGG + Intronic
1024481097 7:49864254-49864276 AAGAAGACAAAGAAGGAGGGAGG + Intronic
1024886657 7:54149746-54149768 CAGAGCAGACAGAAGCCTGGGGG + Intergenic
1025012444 7:55408323-55408345 GAGAACACACAATAGGAGGGAGG + Intronic
1025207036 7:56999923-56999945 ACCAGCAAACAGAAGGAGGGGGG - Intergenic
1025664903 7:63576979-63577001 ACCAGCAAACAGAAGGAGGGGGG + Intergenic
1027140168 7:75651098-75651120 CTGCCCACACAGGAGGAGGGAGG + Intronic
1029806387 7:103001620-103001642 CAAAGCAGGCAGAAGGAGGTGGG + Intronic
1031903065 7:127430581-127430603 GAGAGCAAGCAGAAGCAGGGTGG - Intronic
1031923508 7:127618174-127618196 CAGAGGAGAGAGGAGGAGGGAGG + Intergenic
1032016614 7:128384108-128384130 CAGAGCACACAAGGGGAGGGAGG + Intergenic
1032210707 7:129911396-129911418 CAGAACAAACAGGATGAGGGAGG + Intronic
1033669623 7:143478585-143478607 CAGAGCATAAAGAATGAGGAAGG - Exonic
1034405865 7:150902105-150902127 CAGGACACACAGAAGGAAGGAGG + Intergenic
1035014735 7:155755285-155755307 CAGGACACACAGAAGGACAGGGG - Intronic
1035114705 7:156514953-156514975 AAAAGCACACTGAAGGAAGGAGG - Intergenic
1035589503 8:802149-802171 CAGAGGACCCAGGAGGAGTGCGG - Intergenic
1035741359 8:1930598-1930620 CAGAGCAGAGAGAACGGGGGTGG - Intronic
1036047065 8:5155187-5155209 CAGTGCACATATAAGGAGTGGGG - Intergenic
1036639160 8:10571533-10571555 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1037316695 8:17605958-17605980 CAGACAACACAAAGGGAGGGTGG + Intronic
1037753875 8:21699260-21699282 AGGAGCAGACAGGAGGAGGGAGG + Intronic
1037953992 8:23039231-23039253 CAGGCCACACAGCAGGAGGTGGG - Intronic
1038213154 8:25538870-25538892 CAGATCACACTGATGGCGGGGGG + Intergenic
1039102618 8:33957452-33957474 CAGAGCTCCCAGTAGGAGTGGGG - Intergenic
1039428339 8:37505491-37505513 CACATCCCACAGAAGGAGGGAGG + Intergenic
1040000910 8:42575484-42575506 AGGAGCCCACGGAAGGAGGGAGG - Intergenic
1041442508 8:57912201-57912223 CAAAGCACACAGAAGCTTGGGGG + Intergenic
1041457018 8:58072008-58072030 CACAGCAGGCAGAGGGAGGGAGG - Intronic
1041464217 8:58142755-58142777 CAGAGAACACAGCCTGAGGGTGG - Intronic
1041644101 8:60233937-60233959 CAGTGCACACTTAAGGAGTGGGG - Intronic
1041783256 8:61602091-61602113 CAGACCCCACAGAAGGAGTTGGG - Intronic
1042021311 8:64373230-64373252 GAGAGAACGCAGAGGGAGGGAGG + Intergenic
1043727454 8:83629110-83629132 TAGAGCTCCCAGAGGGAGGGAGG - Intergenic
1044595927 8:93958319-93958341 AAAACCACAGAGAAGGAGGGAGG - Intergenic
1045320154 8:101076285-101076307 CAGACCACACTCAAGGAGAGCGG - Intergenic
1045640172 8:104241074-104241096 CAGAGCACAGTGAAGGAGTCAGG - Intronic
1045680337 8:104652969-104652991 CTGAGCAAACAGCAAGAGGGCGG - Intronic
1047381135 8:124364354-124364376 GAGAGCACTGAGGAGGAGGGAGG + Intronic
1047767666 8:128002636-128002658 GAGAGGACACAGGAGGATGGAGG - Intergenic
1047767772 8:128003306-128003328 CAGAGGAGACAGAAGGGGAGGGG - Intergenic
1048194533 8:132321506-132321528 GAGAGCAAACAGAAGCAGGAGGG - Intronic
1048498709 8:134956920-134956942 CAGGGCAAACAGAAGGGAGGTGG + Intergenic
1049288125 8:141787571-141787593 CAGAGAACAGAGAGGGAGGGAGG + Intergenic
1049343915 8:142128456-142128478 CAGAGGCCACAGAAGCTGGGTGG + Intergenic
1049958023 9:711351-711373 CAGAACCCACAAAAGAAGGGAGG - Exonic
1050194288 9:3064457-3064479 CAGAGGTTACAGAAGTAGGGTGG - Intergenic
1050985865 9:12081205-12081227 CAGAGCACACTTAAGGATTGTGG - Intergenic
1051298200 9:15618802-15618824 GAGAGCAAGCAGAAGCAGGGTGG - Intronic
1051849596 9:21490973-21490995 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1052470110 9:28883142-28883164 CAGAGCACAGAGAGTGAAGGAGG - Intergenic
1052766896 9:32650669-32650691 TGGAGCACCCAGCAGGAGGGTGG + Intergenic
1053377979 9:37624336-37624358 CAGGGCACACAGCAGGAGACAGG + Intronic
1053618802 9:39795411-39795433 CAGCCCACACATAAGGAGTGGGG - Intergenic
1053785591 9:41650480-41650502 CAGGCCTCAGAGAAGGAGGGCGG + Intergenic
1054174310 9:61864446-61864468 CAGGCCTCAGAGAAGGAGGGCGG + Intergenic
1054265352 9:62912018-62912040 CAGCCCACACATAAGGAGTGGGG + Intergenic
1054449168 9:65393491-65393513 CAGGCCTCAGAGAAGGAGGGCGG + Intergenic
1054663228 9:67716345-67716367 CAGGCCTCAGAGAAGGAGGGCGG - Intergenic
1054959122 9:70947630-70947652 CAGAGCTCAGAGAAGGTGGGGGG + Intronic
1055199002 9:73634156-73634178 CAGAGAACACTGAAGCAGGAAGG + Intergenic
1056302713 9:85258445-85258467 CATGGCAAACAGAAGCAGGGTGG - Intergenic
1057336516 9:94159897-94159919 CTGAGCACACAGAAAATGGGAGG + Intergenic
1057500100 9:95590031-95590053 CAGAGAAGACAGAAGGACCGAGG - Intergenic
1057547153 9:96027246-96027268 CACACCACACAGGAGGCGGGAGG - Intergenic
1058111228 9:101032462-101032484 AGGAGCACACAGAAGAAGGAAGG - Intronic
1058903680 9:109463080-109463102 CACACCACACAGAAGGGCGGGGG + Intronic
1059373330 9:113861649-113861671 CAGAGAACTCAGCAGGAGGATGG - Intergenic
1060192682 9:121603091-121603113 CAGAGGCCACAGTAGGAGGATGG - Intronic
1060667264 9:125439344-125439366 CAGGTCACACAGCAGGTGGGAGG - Intronic
1061577662 9:131517616-131517638 CAGAGCACAGAGACGGCGAGTGG - Intronic
1061756285 9:132814719-132814741 CACAGCAGACTGAAGGAGAGGGG + Exonic
1061787359 9:133037938-133037960 CAGAGCACACGGAACAAAGGAGG + Intronic
1061846131 9:133389436-133389458 CAGAGCAGCCAGCAGGATGGTGG - Intronic
1061949212 9:133926842-133926864 CAGAGCACACAGAAGCAGAGAGG + Intronic
1062447275 9:136600225-136600247 CAGAGCAGACAGAGGCTGGGAGG - Intergenic
1062560119 9:137137896-137137918 GAGAGCCAACAGAAGGAGTGAGG + Intergenic
1203433910 Un_GL000195v1:120084-120106 CAGAGCACAGAGTATTAGGGAGG + Intergenic
1203631183 Un_KI270750v1:73855-73877 CAGAGCAGACAGAAGGCAGGAGG - Intergenic
1186053695 X:5626847-5626869 AAGAGCAGACAGAGGGAGGAAGG + Intergenic
1186940605 X:14503234-14503256 CAGAGGACAGAGCAGTAGGGTGG + Intergenic
1186962608 X:14752928-14752950 CAGAGAAGAAGGAAGGAGGGAGG - Intergenic
1187185564 X:16981502-16981524 AGGAGCACACATAAGGAGTGGGG + Intronic
1187501245 X:19840869-19840891 CACAGCACACAGCTGGAGGGTGG - Intronic
1189818035 X:44843982-44844004 GAGAGGAGACAGAAAGAGGGTGG + Exonic
1190237342 X:48626564-48626586 CAGACCACACTCAAGGCGGGGGG + Intergenic
1191132703 X:57031301-57031323 GAGAGCAAGCAGAAGCAGGGTGG - Intergenic
1191764488 X:64682365-64682387 CAGGGGACACAGGAGGAAGGGGG + Intergenic
1191824779 X:65353106-65353128 CTGAGCACTAAGAAGGAGGCCGG - Intergenic
1192157011 X:68754190-68754212 CAAAGCAGACAGTATGAGGGAGG - Intergenic
1192207568 X:69106415-69106437 CAGAACAGGCACAAGGAGGGGGG - Intergenic
1192451695 X:71248854-71248876 GAGAGCACACAGAAGGTGTAAGG + Intronic
1192495840 X:71616286-71616308 CAGAGCCGGCAGAGGGAGGGAGG + Exonic
1192960561 X:76126613-76126635 GAGAGCAAAGAGAAGCAGGGTGG + Intergenic
1193085271 X:77443314-77443336 CAAAGAAAACAGAAGGAGAGAGG + Intergenic
1193269737 X:79515291-79515313 GAGAGGACAGAGAAGGAAGGAGG - Intergenic
1193742982 X:85241274-85241296 GAGAGGAGAGAGAAGGAGGGCGG + Intergenic
1194771714 X:97915103-97915125 GAGAGCAAGCCGAAGGAGGGTGG + Intergenic
1195462693 X:105145432-105145454 TTGAGTACACAGAAGGAGGCAGG + Intronic
1195977793 X:110546454-110546476 AAGAGGACACAGAAAGAAGGTGG + Intergenic
1196584144 X:117409678-117409700 CACAGCTCACAGTAGGTGGGAGG - Intergenic
1197072610 X:122317998-122318020 CAGAGATCACAGAAGGCTGGTGG - Intergenic
1197841541 X:130752927-130752949 GAGAACACACAGAAGGAGCAAGG - Intronic
1198054945 X:132984738-132984760 CAGAGCTCACAGGATGGGGGTGG - Intergenic
1198162316 X:134019820-134019842 GAGAGCACAGAGTAGGAGGTTGG - Intergenic
1198958747 X:142161395-142161417 CAGAGCCCTCAGAAGGATTGAGG + Intergenic
1199234463 X:145474957-145474979 CAGAGGACACCAAAGGAAGGAGG + Intergenic
1199374456 X:147090629-147090651 CAGAGCACACACGAGTAGGTAGG - Intergenic
1199417243 X:147599502-147599524 CAGGGCAGAGAGAGGGAGGGAGG - Intergenic
1199583469 X:149385575-149385597 AAAAGCACATAGAAGAAGGGGGG + Intergenic
1199613304 X:149635428-149635450 CACAGCACACTGGAGGAGTGTGG - Intergenic
1199716338 X:150509567-150509589 CAGAGTATGTAGAAGGAGGGAGG - Intronic
1199767872 X:150953873-150953895 AAGAAAACAGAGAAGGAGGGGGG - Intergenic
1199783169 X:151081943-151081965 CAGGACACACAGAAGGAGAATGG + Intergenic
1199998080 X:153039386-153039408 GAGAGGACACAGAAAGAGGCAGG - Intergenic
1200007361 X:153096387-153096409 CAGATTGCACAGAAGTAGGGAGG + Intergenic
1200182496 X:154159297-154159319 CTCAGCACCCAGGAGGAGGGAGG + Intergenic
1200188150 X:154196411-154196433 CTCAGCACCCAGGAGGAGGGAGG + Intergenic
1200193800 X:154233551-154233573 CTCAGCACCCAGGAGGAGGGAGG + Intergenic
1200199555 X:154271355-154271377 CTCAGCACCCAGGAGGAGGGAGG + Exonic
1200336290 X:155354247-155354269 CAGAGCTCCCGGAGGGAGGGAGG + Intergenic
1200350180 X:155486980-155487002 CAGAGCTCCCGGAGGGAGGGAGG - Intergenic
1201376662 Y:13330374-13330396 GAGGGCAAACAGAAGCAGGGTGG + Intronic