ID: 976093861

View in Genome Browser
Species Human (GRCh38)
Location 4:81487068-81487090
Sequence GGCTGCAATTAAATGGACTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 90}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976093857_976093861 8 Left 976093857 4:81487037-81487059 CCCTAAGGCTTCGGCTTGTACTA 0: 1
1: 0
2: 0
3: 0
4: 41
Right 976093861 4:81487068-81487090 GGCTGCAATTAAATGGACTATGG 0: 1
1: 0
2: 0
3: 3
4: 90
976093858_976093861 7 Left 976093858 4:81487038-81487060 CCTAAGGCTTCGGCTTGTACTAA 0: 1
1: 0
2: 0
3: 1
4: 37
Right 976093861 4:81487068-81487090 GGCTGCAATTAAATGGACTATGG 0: 1
1: 0
2: 0
3: 3
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976093861 Original CRISPR GGCTGCAATTAAATGGACTA TGG Intronic
907817469 1:57934222-57934244 GGCTAAAATTAAAAAGACTAGGG - Intronic
908594784 1:65675729-65675751 GGCTGAAATTTATTGGTCTATGG + Intergenic
910588961 1:88908691-88908713 GGGTGTAATTAAATAGATTATGG - Intergenic
911820243 1:102410128-102410150 AGCTGCATTTAGATGAACTATGG + Intergenic
918769365 1:188534666-188534688 GACTGAAATTAAATGGAACAAGG - Intergenic
919100199 1:193086777-193086799 AGGTCTAATTAAATGGACTAGGG + Intronic
1068257413 10:54531173-54531195 GGGTGAAATTAAATAGATTAAGG - Intronic
1070830423 10:79414906-79414928 GACTGCAAGTAACTGGCCTAAGG + Intronic
1071411356 10:85400022-85400044 GGTTGCCATTAAGTGGACTGAGG + Intergenic
1074035809 10:109737257-109737279 GGCAGGAATTAAATGGACCTTGG + Intergenic
1076170379 10:128314447-128314469 GTCAGCAATGAAATGGACCAAGG - Intergenic
1080845867 11:36026234-36026256 AGCTTCAATTAAATGAACTAGGG - Intronic
1084316698 11:68349805-68349827 GGCTGCAAGAAAAGGGACAAAGG - Intronic
1090701131 11:129296560-129296582 GGATGCCATGAAATGGACTCAGG - Intergenic
1092770586 12:11892839-11892861 GGGTGCAAACAGATGGACTATGG + Exonic
1094686691 12:32723744-32723766 AGCTGCATTTAGATGAACTACGG + Intronic
1098457068 12:70686531-70686553 GGCAGAAATTAAATAGAATATGG + Intronic
1104004560 12:124882927-124882949 GGCTGCAATCACAGGGACCAGGG - Intergenic
1104004753 12:124884198-124884220 GGCTGCAATCACAGGGACCAGGG - Intergenic
1109758958 13:66800698-66800720 GGCTAGATTTAAATGTACTAAGG - Intronic
1116594662 14:46825020-46825042 GGCTGCAGTTATATGAACTTTGG + Intergenic
1120842420 14:89097494-89097516 GGCTGTAATGGAATGGACCAGGG - Intergenic
1127759621 15:62125822-62125844 GGCAGCAATTAAATAAACTTGGG - Intergenic
1133783903 16:8960707-8960729 GGCTGGAATTTAGTGGACTCTGG - Intronic
1135904106 16:26494730-26494752 GGTTGCAATTATATGGAAAAGGG + Intergenic
1138803606 16:60065461-60065483 GCCTGCAATTATGTGGAATATGG - Intergenic
1139639533 16:68281039-68281061 GGCTCCTTTTAAATGGAGTATGG + Intronic
1150662777 17:67098894-67098916 GACTGCAATGAAATGGATTCTGG + Intronic
1156758578 18:40558760-40558782 GCCTTTAATTAAATGGTCTATGG + Intergenic
1158864167 18:61620958-61620980 GGCTATAATTAATTGGCCTAAGG + Intergenic
1159856813 18:73598592-73598614 GGCTGAAAATAGATGGAGTATGG + Intergenic
1163930410 19:20385153-20385175 GGCTGAATGTAAATGGAATAGGG - Intergenic
1165217100 19:34282943-34282965 GCCTGCAGTTAAATAGACTGTGG + Intronic
933255987 2:80081256-80081278 GCCTGCTATAAAATGGAATAGGG - Intronic
936282719 2:111156593-111156615 GGCTGGGATTATGTGGACTATGG + Intronic
936449625 2:112624438-112624460 GGCTTTAATTAAGTGGTCTATGG - Intergenic
939087790 2:137742553-137742575 GGCTGGAATTAAAGAGACTGAGG - Intergenic
939456475 2:142443673-142443695 ACCTGCAATTAAATGGATTCGGG + Intergenic
939471962 2:142633973-142633995 AACTGCGATTAAATGGGCTAAGG - Intergenic
941133382 2:161682677-161682699 GGCTGCAGTTATCTGGAATAGGG + Intronic
942864429 2:180655965-180655987 GGCTAACATTAAATGGACAAGGG - Intergenic
1173665196 20:44758036-44758058 GGCTGGTTTCAAATGGACTAGGG - Intronic
1176752664 21:10703160-10703182 GACTGGAATCAAATGGAATACGG - Intergenic
1177535755 21:22424724-22424746 GGCTGTGATTATATGGACAATGG + Intergenic
1179586974 21:42379615-42379637 GGCTTCATTTGCATGGACTATGG + Intronic
1180597856 22:16990665-16990687 GTCTGCATATAAATGGACTCTGG - Intronic
953463706 3:43101944-43101966 GGCCACAGCTAAATGGACTAAGG + Intronic
956260786 3:67338188-67338210 GGCTCAAAGTAAAGGGACTAAGG + Intergenic
965068190 3:163879421-163879443 GGCTGAACTTAAGTGGACCATGG + Intergenic
967170005 3:186815667-186815689 TGCTGCAATAAAATGGGCTTTGG + Intergenic
969544509 4:7816469-7816491 GGAAGAAATTAAATGGACTATGG - Intronic
971958119 4:33449649-33449671 GGTTGCAAGTACATAGACTAAGG - Intergenic
972412729 4:38809254-38809276 GGCTGCTGTTAACTGGACTTAGG - Intronic
976093861 4:81487068-81487090 GGCTGCAATTAAATGGACTATGG + Intronic
978173164 4:105698381-105698403 GGCTAAAATTAAATGGACCTGGG + Intronic
978971662 4:114815112-114815134 GGCTGCCATTAAATTGAGGAAGG + Intergenic
980125378 4:128769423-128769445 GGCTGCCATGAAATAGACTATGG - Intergenic
983644351 4:169974459-169974481 GGCTGCACTTGACTGGACTCTGG - Intergenic
984692525 4:182743804-182743826 ACCTGATATTAAATGGACTAAGG + Intronic
985322770 4:188733421-188733443 GGCTGCAAATAAATGCTCTTTGG - Intergenic
985519443 5:366171-366193 TCCTGCCATTAAAAGGACTAGGG + Intronic
986495789 5:8340394-8340416 GGCTGCCAGTGAATGAACTATGG - Intergenic
988364754 5:30282391-30282413 GTGTGCATTTTAATGGACTAAGG - Intergenic
989272207 5:39546656-39546678 GGCTGATATTATATGGGCTAAGG - Intergenic
990266609 5:54083902-54083924 TGCTAAAATTAAATGGAGTAGGG + Intronic
993369483 5:87074746-87074768 GGCTGAAATTGCATGGAGTAAGG - Intergenic
996215630 5:120861852-120861874 GTTGGCAATTAAGTGGACTATGG - Intergenic
997409430 5:133679819-133679841 GGCTGCATTTTCCTGGACTATGG + Intergenic
1002948575 6:1786227-1786249 GGCTGCAATTTAATGAATTTTGG - Intronic
1003184591 6:3820014-3820036 GGCTGAAATTAATTGGGCTGGGG - Intergenic
1003748685 6:9031561-9031583 GGCTTCAATGAAATGGATTGGGG - Intergenic
1005197472 6:23305216-23305238 GGATACAATTAAAGGGACTGTGG + Intergenic
1006885021 6:37374394-37374416 GGCGGCCACCAAATGGACTAGGG - Intronic
1007307242 6:40916796-40916818 GTCTGCAAGTAAAGGGACGATGG - Intergenic
1008815339 6:55558031-55558053 GGCTCCATTTAAATGGAGAAAGG + Intronic
1016092957 6:140000758-140000780 AGCCACAATTACATGGACTATGG - Intergenic
1018561791 6:165107468-165107490 GCCTCCAGTGAAATGGACTATGG + Intergenic
1032762923 7:134961463-134961485 GGATGCAATTAAATGCACAGAGG - Intronic
1037688129 8:21161165-21161187 GGCTGCAATCCAAGGCACTAAGG - Intergenic
1042103575 8:65299618-65299640 GGCAGCAGTTACATGGAATAAGG + Intergenic
1042865395 8:73352439-73352461 GGCTGCTATTAAATAAATTATGG + Intergenic
1043776243 8:84273230-84273252 GGCTGCAATTAAATCATCTCAGG + Intronic
1051566271 9:18502465-18502487 GGATGAATTTAAATGGGCTATGG + Intronic
1054830880 9:69623249-69623271 GGCTGCAATGAAATAGATAAGGG + Intronic
1060668237 9:125446045-125446067 TGCTTCAATTAAAAGGACAACGG - Intronic
1061424197 9:130488984-130489006 GCCTGTAATTAAAGCGACTACGG - Intronic
1203348887 Un_KI270442v1:59661-59683 GACTGGAATCAAATGGAATAAGG + Intergenic
1187543198 X:20219693-20219715 GGATGAAATGAAATGGAGTAAGG - Intronic
1188186427 X:27121382-27121404 GGCTGCAAACGAATGGACTTAGG - Intergenic
1196532607 X:116806526-116806548 GGCTGAGAGTAAGTGGACTAGGG - Intergenic
1198065779 X:133095307-133095329 GGCTGCCATTTAATGGAATTTGG - Intronic
1198269232 X:135038846-135038868 GCTTGCAATTATATGAACTAAGG - Intergenic
1198429680 X:136553123-136553145 GGCTCCAAGTAAAAGGACAATGG + Intronic
1199854395 X:151748417-151748439 AGCTGCATTTAGATGAACTATGG + Intergenic