ID: 976096193

View in Genome Browser
Species Human (GRCh38)
Location 4:81510730-81510752
Sequence TGGTAAGCCCAGAAATGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 199}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976096193 Original CRISPR TGGTAAGCCCAGAAATGGAG TGG (reversed) Intronic
900090311 1:917354-917376 AGGCAAGACCAGAAAAGGAGGGG - Intergenic
903691796 1:25179355-25179377 TGGTAAGCAGAGAACTGGCGGGG + Intergenic
903954476 1:27015559-27015581 TTGAAAGCTAAGAAATGGAGGGG + Intergenic
904762144 1:32813111-32813133 TGGTTTGCCCAGAAAGGGGGTGG - Intronic
905641669 1:39594294-39594316 TGGTAAGCACAGTCATGGATTGG - Intergenic
906478865 1:46187495-46187517 TGCTGAGCCCAGAAAGGAAGAGG + Intergenic
907146497 1:52238182-52238204 TTGTAATCGCAGACATGGAGGGG - Exonic
911680442 1:100709459-100709481 TGGTAAGACCAGCAGTGGAGGGG - Intergenic
912078085 1:105902715-105902737 TGGAAAGCCCAGACATGTTGTGG - Intergenic
913382462 1:118226910-118226932 TGATATGCCTTGAAATGGAGTGG - Intergenic
915727025 1:158025281-158025303 TGTTAGGCCCAGGAATGAAGAGG + Intronic
915952644 1:160199757-160199779 GGGTCAGCCCAGGGATGGAGAGG - Intronic
916303988 1:163308284-163308306 TGGTAAACACTGAAATGGGGAGG - Intronic
917849140 1:179045501-179045523 TAGGGAGCCCAGAAATGGAAGGG + Intronic
918524854 1:185454152-185454174 TGTTAAGCCCAGAGATTAAGTGG - Intergenic
918849917 1:189674483-189674505 TGGTAACTGCAGTAATGGAGGGG - Intergenic
919774230 1:201183823-201183845 TGGGAAGCCCAGCCATGGGGAGG - Intergenic
919831696 1:201545662-201545684 CAGTAAGCTCATAAATGGAGTGG - Intergenic
920307999 1:205031236-205031258 GGTTAAGCCCATAACTGGAGGGG - Intergenic
920959508 1:210651942-210651964 TGAGAGGCCCAGAAATGGTGTGG + Intronic
923210018 1:231795490-231795512 TGGACACCCCAGAAATGGACTGG + Intronic
923994812 1:239481788-239481810 TGGTACCCACAGAGATGGAGAGG + Intronic
924404898 1:243732360-243732382 TGGTAGGCTCAGCAAGGGAGTGG - Intronic
924593425 1:245424652-245424674 TGATAAGTATAGAAATGGAGAGG + Intronic
1063824777 10:9883299-9883321 TTTTAAGTCCAGATATGGAGTGG + Intergenic
1064594178 10:16926561-16926583 TGGTAGCAACAGAAATGGAGAGG + Intronic
1066671562 10:37845720-37845742 TGAAAAGCCTAGAAATGAAGGGG + Intronic
1066742733 10:38575253-38575275 TGGAAAGGACAGAAATGGAATGG + Intergenic
1067010844 10:42712114-42712136 TGGTAGCAACAGAAATGGAGAGG + Intergenic
1067312669 10:45129095-45129117 TGGTAGCAACAGAAATGGAGGGG - Intergenic
1067723835 10:48751152-48751174 GGGCAGGCCCAGAAATTGAGAGG + Intronic
1067769551 10:49113699-49113721 TGGTCAGTCCCAAAATGGAGAGG + Intronic
1067972018 10:50982995-50983017 TGTTAATAGCAGAAATGGAGTGG - Intergenic
1068086297 10:52377197-52377219 TGGAAAGCCAAGAAATGAAAAGG - Intergenic
1068231643 10:54174980-54175002 GGTTTAGCCAAGAAATGGAGTGG + Intronic
1068812645 10:61273966-61273988 TGGTAATGCAAGAGATGGAGGGG - Intergenic
1070441419 10:76448668-76448690 TGGGAAAACCAGAAAAGGAGAGG - Intronic
1072416609 10:95251898-95251920 TGGACATCCCAGACATGGAGCGG + Intronic
1073424161 10:103446180-103446202 TGAATAGCCCAGATATGGAGAGG - Exonic
1074791002 10:116887655-116887677 TGGTAAGTCCAACAAGGGAGAGG - Intronic
1074898023 10:117793829-117793851 TGGAAAGCCTAGAAGGGGAGAGG + Intergenic
1075189706 10:120295665-120295687 TGGTGAGCCCAGAAATACAATGG + Intergenic
1075275092 10:121086054-121086076 TCGTAACCCCAGACCTGGAGAGG - Intergenic
1079715158 11:23734233-23734255 TGGAAAGCACAGAAAAGCAGTGG + Intergenic
1080896368 11:36451798-36451820 TGGTACCTACAGAAATGGAGTGG - Intronic
1082561151 11:54622561-54622583 TGGAAAGCCAAAAAATGCAGGGG - Intergenic
1087736422 11:101839473-101839495 GGGTAGGCACATAAATGGAGTGG - Intronic
1088164833 11:106921779-106921801 TGGTAACCCCTAAAATGGAAGGG - Intronic
1090131995 11:124153114-124153136 CTGTAAGCCCAAAAATGGAAAGG - Intergenic
1094651323 12:32379226-32379248 TGGGTGGCACAGAAATGGAGTGG + Intronic
1096009037 12:48197784-48197806 TAGTAAGCCCAGAAAGGGGTAGG + Intergenic
1096047103 12:48571949-48571971 TGGAATGCGGAGAAATGGAGTGG - Intergenic
1098802160 12:74974917-74974939 TGTAAAGCACAGAAATGGAGAGG + Intergenic
1100755986 12:97751303-97751325 TGGAAAAACCAGAAAGGGAGAGG + Intergenic
1100793982 12:98160485-98160507 TGTTAAGCCCAGAAACTGATGGG + Intergenic
1101464301 12:104931873-104931895 TGGGAAGAACAGGAATGGAGTGG - Intronic
1101648700 12:106655219-106655241 TGGAGAGCCCAAAAATGGAGTGG + Intronic
1104294773 12:127502081-127502103 TGATAAGCCCAGAAACCAAGAGG - Intergenic
1104625177 12:130346955-130346977 TAGTAAGACCCGGAATGGAGAGG + Exonic
1106111764 13:26783702-26783724 TGGGAACCCCAAAACTGGAGGGG - Intergenic
1107618549 13:42199172-42199194 TGTTAAGTGTAGAAATGGAGGGG + Intronic
1108172007 13:47751302-47751324 TGCTTACCCCAGAAATTGAGGGG + Intergenic
1109577499 13:64281063-64281085 TAGAAAGCCCAGAAATAAAGTGG + Intergenic
1114265989 14:21072877-21072899 TGATGAGCCCAGAACAGGAGTGG - Intronic
1117278458 14:54213459-54213481 TGGAAAGCCCAGAGGTGGGGTGG - Intergenic
1118064083 14:62171605-62171627 TTGTAAGGTCAGCAATGGAGTGG - Intergenic
1121125271 14:91402621-91402643 TGTTAACCCCAGGAAGGGAGAGG + Intronic
1124171575 15:27378345-27378367 GAGTAGGCCCAGATATGGAGTGG + Intronic
1124928273 15:34093675-34093697 TTGTAAGCTTGGAAATGGAGGGG - Intronic
1128306572 15:66602973-66602995 TGGTTTGCCCAGGACTGGAGTGG + Intronic
1129601127 15:76999060-76999082 TGGGAAGCCCAGAGAAGGAAGGG + Intronic
1134098241 16:11433808-11433830 TGGTGAGCCCAGAGAGGGCGGGG + Intronic
1135737216 16:24941719-24941741 TGGTAAGCCCTGCAGTGGAACGG - Intronic
1135886930 16:26318632-26318654 TGGGGTGCCCAGAGATGGAGAGG - Intergenic
1135902860 16:26481581-26481603 TGGTAAGCCAACAAATTGAATGG + Intergenic
1138935146 16:61710597-61710619 TGGTAAGACGAGAAATAGACAGG - Intronic
1139967365 16:70753291-70753313 AGGTGAGCCCAGAGATGTAGAGG - Intronic
1140215462 16:73003775-73003797 TGGTATGGTCAGAAATGCAGAGG + Intronic
1141048946 16:80743267-80743289 TGGTAAGCGCAGACATTGTGAGG + Intronic
1141898938 16:86977518-86977540 TGGTCAGCCCAGTACTGAAGAGG + Intergenic
1145341525 17:21958879-21958901 TGGAATGCACTGAAATGGAGTGG + Intergenic
1146087660 17:29844948-29844970 TGGAAAGCCCTGAAAAGGAAAGG - Intronic
1150034393 17:61778039-61778061 TTGTATGCCAGGAAATGGAGTGG + Intronic
1151391893 17:73793020-73793042 TGATAAGCCCAGCCAGGGAGGGG + Intergenic
1151491684 17:74435401-74435423 TGGTTCCCCCAGAAATGGAAGGG - Intronic
1157596141 18:48865026-48865048 GGGTGAGCCCAGAAAGTGAGTGG + Intergenic
1157963869 18:52186564-52186586 TTGCAGACCCAGAAATGGAGTGG + Intergenic
1158847428 18:61459490-61459512 TACTAAGCCCAGAAATGGCCAGG + Intronic
1163776965 19:19224571-19224593 TGGAAAGCTCAGAAAATGAGTGG - Intronic
1163872511 19:19834141-19834163 CGGTAAGCCCAGAAATTTAGTGG + Intergenic
1163876978 19:19879777-19879799 TGGTAACTCCAGAAATTTAGTGG + Intronic
1163901470 19:20104593-20104615 TGGTAATTCCAGAAATTTAGTGG + Intronic
1163936681 19:20451918-20451940 TGGTAATTCCAGAAATTTAGTGG + Intergenic
1163956388 19:20646032-20646054 TGGTAATTCCAGAAATTTAGTGG - Intronic
1164021410 19:21309930-21309952 TGGTAATTCCAGAAATTTAGTGG - Intronic
1164057931 19:21638328-21638350 TGGTAATTCCAGAAATGTAGTGG + Intergenic
1164102793 19:22073194-22073216 TGGTAATTCCAGAAATTTAGTGG + Intronic
1164224586 19:23231601-23231623 TGGTAATTCCAGAAATTTAGTGG - Intronic
1166456993 19:42949973-42949995 GGGTAGGCCCAGGAAGGGAGGGG - Intronic
1166486742 19:43220457-43220479 GGGTAGGCCCAGGAAGGGAGGGG - Intronic
1166493853 19:43283904-43283926 GGGTAGGCCCAGGAAGGGAGGGG - Intergenic
1166857723 19:45791638-45791660 TGGTGATCCCAGAAATGATGGGG - Intronic
1168431878 19:56287962-56287984 TGGTCTGCCCAGAACTGAAGGGG - Intronic
929251149 2:39757035-39757057 AGGGAAGCCAAGAAATGAAGAGG + Intronic
929349266 2:40928995-40929017 TGGTCAGAGCAGAAATGGAGAGG + Intergenic
931706023 2:64946892-64946914 TGTTAAGCTCAGAGATGGACTGG + Intergenic
933991103 2:87634567-87634589 TGCTAATCCCAGCAGTGGAGAGG + Intergenic
936302736 2:111316256-111316278 TGCTAATCCCAGCAGTGGAGAGG - Intergenic
938753892 2:134362251-134362273 TGGTGTGCAAAGAAATGGAGAGG - Intronic
941126391 2:161589164-161589186 AGGTAAGATCAGAAATGAAGGGG - Intronic
942597401 2:177604555-177604577 TGGTCAGCAAACAAATGGAGGGG + Intergenic
943113554 2:183637696-183637718 TGGAGAGGCCAGGAATGGAGTGG + Intergenic
944701440 2:202249775-202249797 TGCTAAGCCATGAAATAGAGTGG - Intergenic
947083985 2:226430216-226430238 TCTTAAGCCCAGGAATGGAAAGG - Intergenic
1170436836 20:16338987-16339009 TGGAAAGGACAGAAGTGGAGTGG + Intronic
1171118296 20:22546291-22546313 TGGTGAGCACAGACATGGTGTGG + Intergenic
1171361221 20:24587659-24587681 TGCGAAGCCCAGGACTGGAGAGG + Intronic
1173297888 20:41775433-41775455 TGGCATGCCCTGAAATGGTGAGG + Intergenic
1175542220 20:59755014-59755036 TGGAAAGTCCAGACTTGGAGAGG + Intronic
1175975231 20:62707626-62707648 TGGGCAACCCAGACATGGAGGGG + Intergenic
1181309874 22:21938897-21938919 AGGGGAACCCAGAAATGGAGAGG - Intronic
1182005500 22:26956253-26956275 GGGTAAGGGCAGAAATGGAAAGG + Intergenic
1182396031 22:30036520-30036542 TGGTAGGCCCAGGTAAGGAGAGG - Intergenic
1182765080 22:32752881-32752903 TGGGAAGCAGAGAAATGGAGCGG + Intronic
1184984946 22:48124892-48124914 TGGTAAGTCGAGAAACAGAGTGG + Intergenic
949531141 3:4956655-4956677 TGCTAAGCCCAGAAAATGATGGG + Intergenic
950728223 3:14933368-14933390 TGGAAAACACAGAAAAGGAGAGG - Exonic
955067901 3:55548165-55548187 TGGTAACCCCTGGAATGTAGGGG - Intronic
955089114 3:55731955-55731977 TGGTATTCCCAGAAATTGTGAGG - Intronic
957411407 3:79846285-79846307 TGGTAATCCCAAAAAGGGGGAGG + Intergenic
958262391 3:91396905-91396927 TGGGAAGGTTAGAAATGGAGTGG - Intergenic
961331755 3:126146814-126146836 AGGTAAGGCCAGGAGTGGAGGGG - Exonic
962060030 3:131916077-131916099 TGGTATGCCGGGAAAAGGAGGGG - Intronic
963631159 3:147731807-147731829 TGGTAAGCACAGAAAGTGAGAGG - Intergenic
964534358 3:157703259-157703281 TGTGAATGCCAGAAATGGAGGGG - Intergenic
964686891 3:159405062-159405084 TTATAATCCCAGTAATGGAGTGG - Intronic
964841534 3:160998810-160998832 TGGTAAACCCAGAACTGAGGGGG + Intronic
966966654 3:185001510-185001532 TGGTAGGCCCAGAAAGGGCATGG - Intronic
968261889 3:197331950-197331972 TGGGAAGAGTAGAAATGGAGAGG + Intergenic
975662794 4:76704496-76704518 TGGTCAGCCAAGAAATGAATTGG + Intronic
976096193 4:81510730-81510752 TGGTAAGCCCAGAAATGGAGTGG - Intronic
982781299 4:159493744-159493766 TGGGAAGTCCAAAAATTGAGGGG - Intergenic
983944258 4:173568173-173568195 AGGTAACCCCAGCCATGGAGAGG - Intergenic
985219362 4:187686576-187686598 TGGCATGCCCAGTAATGAAGGGG + Intergenic
990267363 5:54091907-54091929 TGGCAAGCCCAGAAAGGCAGAGG - Intronic
992709236 5:79432267-79432289 GGCTAAGAACAGAAATGGAGGGG + Intronic
992925998 5:81587900-81587922 TGGCAAGCCCAGAAAATGATTGG - Intronic
996085525 5:119301099-119301121 TGGCAAGTCCAGGAATGGACCGG - Intronic
996215403 5:120859678-120859700 TGGTAATCTCAGGAATGCAGGGG - Intergenic
997650586 5:135515026-135515048 AGGTAAGTACAGAAATTGAGAGG - Intergenic
997699389 5:135885882-135885904 TTGTAAGTGCAGAAATGGAGGGG + Intronic
1001191946 5:169639468-169639490 TGGAAAGCTCAGAAATGGTCTGG + Intronic
1002690193 5:181045116-181045138 CGCTAAGCCCAGAAAAGGGGGGG + Intronic
1005424771 6:25691072-25691094 TGGAAGGCCCAGAAGTGGATGGG + Exonic
1005508323 6:26489776-26489798 TGGTATGCCCAGAAAGGGCATGG - Intergenic
1006010721 6:31040801-31040823 ACGGAAGCCCAGAATTGGAGTGG - Intergenic
1006583357 6:35089264-35089286 CGGGAACCCCAGAAATGGACCGG - Exonic
1006765301 6:36499688-36499710 CAGTAAGCCCAAGAATGGAGTGG + Intronic
1008705137 6:54148796-54148818 TTTTAAGCTCTGAAATGGAGTGG + Intronic
1008993026 6:57625972-57625994 TGGGAAGGTTAGAAATGGAGTGG + Intronic
1009181640 6:60525077-60525099 TGGGAAGGTTAGAAATGGAGTGG + Intergenic
1009501183 6:64416421-64416443 TAATAAGCTCAGAAATTGAGTGG - Intronic
1010182872 6:73108208-73108230 TCATTAGCCCAGAGATGGAGCGG - Intronic
1010816819 6:80367816-80367838 TGGGAAGGCCAGGAATGGTGGGG + Intergenic
1010925043 6:81734828-81734850 TCGTCAGCCCAGGAATGGAAAGG - Intronic
1014233272 6:118928152-118928174 TTGTAATCCCAGAACTGGGGAGG + Intronic
1014311290 6:119805385-119805407 TGTTAGGCCCAGAAATGGATGGG - Intergenic
1014386835 6:120814007-120814029 TGGAAAGCACATAAAAGGAGAGG - Intergenic
1017609959 6:156174920-156174942 TAGGAAGCACAGAAATGAAGAGG + Intergenic
1017726911 6:157282642-157282664 TGATGACCCCAGAAAGGGAGAGG - Intergenic
1017814393 6:158006159-158006181 TGGCAAGCAGAGAAATGGAGAGG - Intronic
1018312253 6:162523090-162523112 AGGTAACAGCAGAAATGGAGAGG - Intronic
1022384238 7:29886988-29887010 AGGGAAGACCAGAAAGGGAGAGG + Intronic
1022429677 7:30304178-30304200 TGCTTAGGCCAGAAAAGGAGAGG - Intronic
1022824531 7:33995528-33995550 TCCTAAGCTCAGAAATGGAAAGG + Intronic
1023205654 7:37746740-37746762 TGATAAGCCCCGAGATGGAGAGG - Intronic
1023751059 7:43373025-43373047 TGCTTAGGCCAGAAATGGAGAGG + Intronic
1023999954 7:45183539-45183561 AGGTCAGCCCAGGAAGGGAGGGG - Exonic
1024792110 7:52978268-52978290 TGTTAAGGTCTGAAATGGAGAGG + Intergenic
1026124596 7:67568525-67568547 TAGGAAGCCCAGAAATGGCTCGG - Intergenic
1030815202 7:114027204-114027226 TGGTAAGCCCTGTATTAGAGGGG - Intronic
1033609486 7:142952376-142952398 TGGAAAGCCAAGACATGGAGGGG + Intronic
1034445958 7:151114601-151114623 CGGCAAGCCCAGACCTGGAGAGG - Intronic
1035840720 8:2809832-2809854 TGGTATGGCCAGAAGTGGGGAGG - Intergenic
1035944196 8:3941963-3941985 TGGTAATGCCAGCAATGGGGAGG - Intronic
1040971658 8:53142202-53142224 TGATATGCCTAAAAATGGAGTGG + Intergenic
1041890325 8:62861065-62861087 TGCTAAGCCCAGAAGAGGACTGG - Intronic
1042237939 8:66634140-66634162 TGAAAAGCCTACAAATGGAGGGG - Exonic
1048776058 8:137947829-137947851 TGGACAGCCCAGGAATGGACAGG - Intergenic
1049055844 8:140236922-140236944 CTGTAATCCCAGAAATTGAGAGG + Intronic
1049953933 9:673979-674001 TGGGAAGACCAGAGAGGGAGGGG - Intronic
1050189411 9:3009380-3009402 AGGTGAGACCAGAAATGGCGGGG - Intergenic
1050386804 9:5099592-5099614 TGGTAGGCCTAGAATTGTAGGGG - Intronic
1050938288 9:11425803-11425825 TGGAAAGCTCAGAAAAGGACAGG - Intergenic
1058583985 9:106487054-106487076 AGGAAAGCCCACAAATGAAGTGG - Intergenic
1059508704 9:114823699-114823721 AGGGAAGCCCAGAAATGAATGGG - Intergenic
1203347721 Un_KI270442v1:47027-47049 TGGTATGCCATGGAATGGAGTGG + Intergenic
1186240666 X:7561955-7561977 TGGGGAGGCCAGAAATGGAGAGG + Intergenic
1186489339 X:9959411-9959433 TCGTGAGACCAGAAATGGGGTGG - Intergenic
1187420513 X:19129892-19129914 GGGGAAGGCCAGAAATGGATTGG + Intergenic
1188243974 X:27819778-27819800 TGAGAAGCCCATGAATGGAGTGG + Intronic
1188619417 X:32201707-32201729 TGGACAGCCCATAAATGGAATGG - Intronic
1189626453 X:42902396-42902418 TGGGCAGCCCACAATTGGAGTGG - Intergenic
1190773812 X:53536802-53536824 AGGACAGCCCAGAAATGGGGTGG + Intronic
1190787175 X:53662968-53662990 AGGAAAACCCAGCAATGGAGAGG + Intronic
1191897738 X:66011510-66011532 TTGGAGGCCCAGAAAGGGAGAGG + Intergenic
1192213095 X:69140031-69140053 AGGTAAGCTCAGGAGTGGAGGGG + Intergenic
1192591751 X:72366155-72366177 TGGAAAGCTCAGGAAGGGAGGGG - Intronic
1192754027 X:74026540-74026562 TGGTAAGCTCTGAAAAGCAGAGG + Intergenic
1195576947 X:106461996-106462018 AAATAAGCCCTGAAATGGAGTGG - Intergenic
1201064891 Y:10088533-10088555 TGGGAAGTAGAGAAATGGAGAGG + Intergenic
1201109393 Y:10788066-10788088 TGGTATGGCAGGAAATGGAGTGG - Intergenic
1201113776 Y:10820189-10820211 TGGAAAGCCATGAAATGGAATGG - Intergenic
1201127777 Y:10930028-10930050 TGGAATGGACAGAAATGGAGTGG - Intergenic
1201617783 Y:15920827-15920849 TGGTAAGCCCAGTGAAGCAGGGG - Intergenic
1201957955 Y:19647025-19647047 TGGCAAGGCCTGAAATGCAGAGG - Intergenic