ID: 976100029

View in Genome Browser
Species Human (GRCh38)
Location 4:81551398-81551420
Sequence CTGTAGATTTTCAGGGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 1, 2: 0, 3: 18, 4: 290}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976100029 Original CRISPR CTGTAGATTTTCAGGGAGAA AGG (reversed) Intronic
903685921 1:25131947-25131969 CTGTAGAGTTTTGGGGAGATGGG - Intergenic
904056189 1:27671932-27671954 TTGGAGATTTTTAGGGAGATGGG - Intronic
904709093 1:32414919-32414941 CTTTAAAGTTTCAGGGTGAAAGG - Intergenic
910360396 1:86409918-86409940 CTGCTGATTGTCAGGGATAAAGG + Intergenic
911032855 1:93508440-93508462 CTGTAGTTTTTCAGGTTGCAGGG + Intronic
911759085 1:101596325-101596347 CTGTTGTGTTTCAGGGAAAAGGG + Intergenic
912714313 1:111971622-111971644 CTGGAGCTTAGCAGGGAGAAAGG - Intronic
915723834 1:158003482-158003504 TGGTAGATTTCCAGGGAGAGTGG - Intronic
917036155 1:170749310-170749332 CTCTAGATAAGCAGGGAGAAGGG + Intergenic
917215847 1:172677235-172677257 CTGTAAATTTAAAGGGGGAAAGG - Intergenic
917254427 1:173099136-173099158 CTGTAGATTTTTAAGAAGATGGG - Intergenic
920331250 1:205210416-205210438 CTTTAGATTGGAAGGGAGAAGGG - Intronic
923221952 1:231903409-231903431 CTGTAGATTTACATGGAGTAAGG + Intronic
923240726 1:232082958-232082980 CTGCAGATGTGCTGGGAGAATGG + Intergenic
923276011 1:232396986-232397008 CTGGAGATTTTCAGGGAATAAGG - Intergenic
923366416 1:233266125-233266147 CTGAAAATTTTCTGGAAGAAAGG + Intronic
923372257 1:233326871-233326893 CTGTGGGTTTCCAGGGAGACTGG + Intergenic
924584151 1:245346997-245347019 CTGTAGTTTTGCAAGGAGAGTGG - Intronic
1063501602 10:6560134-6560156 ATGGATATTTTCAAGGAGAAGGG - Intronic
1063984897 10:11491769-11491791 GTTCAGATTTTCAGGAAGAAAGG + Intronic
1064632402 10:17329979-17330001 CTGGAGAGTTTCATGCAGAAGGG + Intronic
1064648101 10:17480925-17480947 CTACAGGGTTTCAGGGAGAAAGG - Intergenic
1065100955 10:22333297-22333319 CTTGAGATTTGCAGGGAGATCGG - Intergenic
1066028573 10:31392458-31392480 CTGTTGGTTTTCAGTGATAAGGG + Intronic
1066486969 10:35855677-35855699 CTGTATATTTAAAGGGGGAAAGG - Intergenic
1066996955 10:42572741-42572763 CAGTAGATCTTCAGGGATCAAGG + Intergenic
1067462705 10:46469367-46469389 CTCTCCATTTTCAGGGAGTATGG + Intergenic
1067624490 10:47915270-47915292 CTCTCCATTTTCAGGGAGTATGG - Intergenic
1068159031 10:53239822-53239844 CTGCAGAGTTTCAGAGAGGAAGG - Intergenic
1068282354 10:54890863-54890885 CTGTAGTTTTTCAGAGAAAGAGG - Intronic
1072782690 10:98261186-98261208 CTGCAGATCTTCATGCAGAAAGG + Intronic
1074161296 10:110838559-110838581 CTGTACATTATCAGAGAGACTGG + Exonic
1075899690 10:126030823-126030845 TTTTAGATTTACAGGGGGAATGG + Intronic
1077154081 11:1083793-1083815 CTCTCGATGTTCAGGGAGCAGGG - Intergenic
1078261513 11:9713825-9713847 CTGGAGATTTACAGGGAAAGTGG + Intronic
1078952947 11:16155907-16155929 ATTTGGATATTCAGGGAGAAGGG - Intronic
1079549800 11:21680855-21680877 ATGTAGATTTTTAGAGAGATTGG + Intergenic
1079711676 11:23691612-23691634 TTGTTGTTTTTCATGGAGAATGG - Intergenic
1080284534 11:30594087-30594109 TTGTAGAATTTAAGAGAGAAGGG + Intergenic
1081530494 11:43955520-43955542 TTCCAGATTTTCAGGGAGATTGG - Intergenic
1086064299 11:82730972-82730994 CTGTAGAACTGCGGGGAGAAAGG - Exonic
1087891374 11:103541751-103541773 CTGCTGATTGTCAGGGATAAAGG + Intergenic
1088881484 11:113976649-113976671 CAGTAGCTTATCAGGGAAAAGGG + Intronic
1089179223 11:116569461-116569483 CTGGAGAGCTTCAGGGAGCAGGG + Intergenic
1090040059 11:123282973-123282995 TTGTAGATTTGCAGGCAGGAAGG - Intergenic
1092167581 12:6352381-6352403 CTGGAGATCTTTAGGAAGAAGGG + Intronic
1092667849 12:10824963-10824985 CTTTGGGTTTTCTGGGAGAATGG + Intronic
1093089154 12:14902210-14902232 CTTTAGACTTTCTGGGGGAAAGG - Intronic
1093122981 12:15295199-15295221 CTGCTGATTTTCAGGGACCAAGG - Intronic
1094313869 12:29115905-29115927 CTGTAGTCTTTCAGGGTGAAAGG - Intergenic
1094434914 12:30410458-30410480 CTGTATGTTTTCAGGGAGTGGGG + Intergenic
1095630947 12:44376676-44376698 TTGAAGATTTTCTGGAAGAAAGG - Exonic
1096035616 12:48467277-48467299 CTAAAGGCTTTCAGGGAGAATGG - Intergenic
1097751232 12:63355315-63355337 CTGTAGATTTAGAGTGAGATTGG - Intergenic
1101497971 12:105273741-105273763 CTGTATATTTTAAGAGGGAATGG - Intronic
1103114007 12:118309466-118309488 GGGTAGATTTGCAGGGAGGAGGG - Intronic
1104688541 12:130806736-130806758 TTTTAGAGTTTCAGGGAGATTGG - Intronic
1107421923 13:40255207-40255229 CTGTTGCTCTTTAGGGAGAAAGG + Intergenic
1107919991 13:45196461-45196483 GAATAGATTTTGAGGGAGAAGGG + Intronic
1108253346 13:48588431-48588453 CTCTGGATTTTCAGGGAGGCTGG + Intergenic
1108852599 13:54752098-54752120 CTGAACTTTTTCAGGGAAAAAGG - Intergenic
1108940149 13:55942967-55942989 CTGTAATTTTTAAGGGAGCATGG - Intergenic
1109681337 13:65756699-65756721 CTGTAGCTTTTCCAGGAGCATGG - Intergenic
1110132438 13:72023680-72023702 CTGCTGATTGTCAGGGATAAAGG - Intergenic
1110620172 13:77586010-77586032 ATGGAGAGTTTCAGGGAGGAGGG - Intronic
1111611543 13:90614029-90614051 CTGCTGATTATCAGGGATAAAGG + Intergenic
1111807954 13:93061614-93061636 CTGATGATTTTGAGGGAGAAGGG + Intergenic
1112991253 13:105516214-105516236 CTATAGATCTTCAGGCAGACAGG - Intergenic
1114996249 14:28355717-28355739 ATGTGGATTTTAAGGGTGAAGGG - Intergenic
1115921102 14:38374757-38374779 TTGTAAAATTTCAGGGAGATTGG - Intergenic
1116357291 14:43945475-43945497 CTGTAGATTTTAAGAGACAGTGG + Intergenic
1119181532 14:72608583-72608605 CCCTAGATTTTCTAGGAGAAGGG - Intergenic
1120053417 14:79895023-79895045 TCTTAGATTATCAGGGAGAAAGG - Intergenic
1120152749 14:81055483-81055505 CTGTAGATTTTCCAGGTGCATGG - Intronic
1120732870 14:88022685-88022707 CTGTAGATTTTTCTGGATAAAGG + Intergenic
1124394039 15:29285076-29285098 CTGAAAATATTCAGGCAGAAGGG + Intronic
1124438158 15:29667977-29667999 CTGTACAGTTTTAAGGAGAATGG - Intergenic
1127527941 15:59812425-59812447 TAGTAGCTTTTCAGGCAGAAGGG + Intergenic
1127720547 15:61694781-61694803 ATGTAGATTTTGAGGGGGATGGG - Intergenic
1131997143 15:98143803-98143825 CTGAAGAAGTTCAGGGAGAGAGG - Intergenic
1133842824 16:9425435-9425457 CTATACATTTTAAGGGTGAATGG + Intergenic
1135718514 16:24794171-24794193 ATATATATTTTTAGGGAGAATGG - Intronic
1135818892 16:25661603-25661625 CTGTATATATTCAGGGAGGAAGG - Intergenic
1137395427 16:48113634-48113656 CTGTGCCTTGTCAGGGAGAATGG - Intronic
1138451658 16:57096874-57096896 CAGTAGAGTTGTAGGGAGAATGG + Intronic
1139170436 16:64625089-64625111 CTGAGGTCTTTCAGGGAGAAGGG + Intergenic
1139254030 16:65523781-65523803 CTGAAGCTTTGCAAGGAGAAAGG + Intergenic
1146769734 17:35557602-35557624 CTGGAGCTTCTCAGAGAGAAGGG - Exonic
1147015920 17:37490972-37490994 CTGTAGAATGTCAGGGAGGACGG - Intronic
1151511477 17:74563176-74563198 ATGTTGATTTTCAGCGAGATGGG - Intergenic
1152010613 17:77711336-77711358 CTGTGGATGCTCAGGGAGACAGG - Intergenic
1152435592 17:80274356-80274378 CTGGACATGTTCAAGGAGAATGG + Intronic
1152878858 17:82804065-82804087 CTGTAGAGTTTAGGGGAGAGTGG + Intronic
1152878870 17:82804106-82804128 CTGTAGAGTTTAGGGGAGAGTGG + Intronic
1153214780 18:2809531-2809553 CTGTAGCTTTTCCAGGAGCATGG + Intergenic
1154358259 18:13639255-13639277 GAGAACATTTTCAGGGAGAAGGG - Intronic
1154477086 18:14771597-14771619 TTGTAGTGTTTCAGGGTGAAGGG + Intronic
1155959037 18:31978299-31978321 CTGTAGTTTTTAGGGGATAAAGG + Intergenic
1156245438 18:35293476-35293498 CTGTAGGTCTTCAGGGACCAGGG + Intergenic
1157210351 18:45736863-45736885 CTGTAGATGTTTAGGGGAAAAGG - Intronic
1157398965 18:47370765-47370787 GTCTAAATTTTCAGGGTGAAGGG + Intergenic
1159122512 18:64187248-64187270 CTGTGGAAACTCAGGGAGAATGG + Intergenic
1160354041 18:78211242-78211264 CAGTATATTTTCATGGCGAAAGG + Intergenic
1160462176 18:79047590-79047612 CGGAAGGTTTTCCGGGAGAATGG + Intergenic
1163087943 19:14996293-14996315 CTGCAGAGTTGCAAGGAGAATGG + Intronic
1163895629 19:20056336-20056358 TTGAAGATTTTCTGGGAAAAGGG + Intergenic
1163901463 19:20104476-20104498 CTGAAGATTTTCAGGAAAAGGGG - Intronic
1164774961 19:30845720-30845742 CTGTAGACCTTCTGGGTGAAGGG + Intergenic
1165284178 19:34825502-34825524 CTGCAGCTTTTCTGGGAGGATGG - Intergenic
1166879905 19:45922393-45922415 CAGTGGATTGACAGGGAGAATGG + Intergenic
1166987384 19:46669363-46669385 CTGTTGACTTTCAAGGGGAAAGG + Intergenic
925021601 2:574002-574024 CGGTGGGTTTTCAGGGAGGAGGG - Intergenic
925549569 2:5057275-5057297 CCTCAGATTTTGAGGGAGAAGGG + Intergenic
927280533 2:21301482-21301504 TTGTATATTCTCAGGGATAAGGG - Intergenic
927370505 2:22349300-22349322 CAGTAGATCTGCAGGGAGATGGG - Intergenic
928187029 2:29119870-29119892 CTATAGATTATGAGGCAGAATGG - Intronic
928728055 2:34198415-34198437 CTTTAATTTTTCAGTGAGAATGG - Intergenic
930155169 2:48099278-48099300 CTGTTGATACTCAAGGAGAAGGG - Intergenic
930267675 2:49219046-49219068 CTATAGGATTGCAGGGAGAAGGG + Intergenic
930568430 2:53053008-53053030 CTGTAGACTTTGAGTGATAATGG - Intergenic
930585563 2:53263445-53263467 CTGCAGATTTTCCAGGTGAATGG + Intergenic
930692323 2:54377184-54377206 CTGTTGTTTTTCAGGGAGCGTGG - Intronic
930897517 2:56463199-56463221 CTGTTGATTTTCTTGGGGAAAGG + Intergenic
931414623 2:62069376-62069398 TTGAAGATTTTCAGTGAGACAGG + Intronic
932177347 2:69614923-69614945 CTGGAGCTTTTGAGGGAGCACGG + Intronic
932342563 2:70975552-70975574 CAGGTGATTTTGAGGGAGAAGGG - Intronic
932890452 2:75591875-75591897 GTATATATTATCAGGGAGAAGGG + Intergenic
935599645 2:104909908-104909930 AAATAGATTTTCAGGGAAAATGG - Intergenic
936248420 2:110848562-110848584 CTGTGGATTTGCTAGGAGAAGGG + Intronic
939034939 2:137119715-137119737 CTGTAGATTTTTAAACAGAAAGG + Intronic
939261130 2:139810821-139810843 CTGAAAACTTTCAGGGAGTAAGG + Intergenic
939282361 2:140080589-140080611 CTGTAGATGATGAGTGAGAATGG + Intergenic
941484012 2:166056153-166056175 CTGTAGATTTTAAAGAAAAAGGG + Intronic
942007020 2:171713690-171713712 CTGTAAATTATCAGGGGAAAAGG - Intronic
943024140 2:182608203-182608225 TTTTAGATTTTCAGGGAAAAGGG - Intergenic
943183368 2:184573795-184573817 ATGCAGATTGTCATGGAGAAAGG + Intergenic
943784898 2:191866648-191866670 TTGTATGTTTTCAGTGAGAAGGG + Intergenic
944627208 2:201583336-201583358 CTGTAGATGTGATGGGAGAAGGG - Intronic
945140315 2:206679388-206679410 GTCTAGATTGTCAAGGAGAAGGG - Intronic
946642435 2:221799193-221799215 ATGTACACTTTCAGGGAGGAGGG - Intergenic
947068733 2:226261678-226261700 GTGTAAATCATCAGGGAGAAAGG - Intergenic
948686791 2:239675167-239675189 CTGAAGATTGTCTGGGGGAAAGG + Intergenic
1172591054 20:36118168-36118190 CAGTAGATTTTCCTGGGGAAAGG - Intronic
1172903360 20:38350803-38350825 CTGTGGATGTTCAGGCTGAAGGG - Exonic
1175021211 20:55851647-55851669 CTGTAGATTTTCAGATAAACAGG - Intergenic
1175151203 20:56935873-56935895 CTCTAGAATATCAGGGATAAAGG + Intergenic
1176304576 21:5116473-5116495 CTCTTAATTTTCAGGAAGAAAGG - Exonic
1176902058 21:14454280-14454302 CTGTATATTTTTAGGTACAAAGG + Intergenic
1179589241 21:42395160-42395182 CTGCAGAATCTCAGGGAGAAGGG - Intronic
1179852478 21:44145557-44145579 CTCTTAATTTTCAGGAAGAAAGG + Exonic
1181504859 22:23346496-23346518 ATGTAAATTTTCAGGCAGAATGG - Intergenic
1181709847 22:24676741-24676763 ATGTAAATTTTCAGGCAGAATGG - Intergenic
1182060495 22:27393796-27393818 CTGCGGTTGTTCAGGGAGAAAGG + Intergenic
1182642434 22:31779100-31779122 TTGTAGATTTGTAGGGTGAAGGG - Intronic
1182943259 22:34298422-34298444 CTGTAGGTTTTTAGGGTGTAAGG + Intergenic
1183370580 22:37429484-37429506 CTGGAGGTCTCCAGGGAGAAGGG - Intergenic
1184329044 22:43814395-43814417 CTGAAGTATTTCAGGCAGAAAGG - Intergenic
949511027 3:4767347-4767369 CTGGAGATATTCTGGGAGTAGGG - Intronic
949586481 3:5444196-5444218 TGCTGGATTTTCAGGGAGAAAGG + Intergenic
949959658 3:9301576-9301598 CTGTAGAATTACAGTGAGCACGG + Intronic
950321408 3:12058004-12058026 ATGTAGATTCTGATGGAGAAGGG - Intronic
951481493 3:23166809-23166831 TTGGAGGGTTTCAGGGAGAAAGG - Intergenic
952257078 3:31704941-31704963 CTGTTGATTTACAGTGGGAAAGG - Intronic
954213434 3:49111167-49111189 CTGGAGATTCGCAGGGAGAGAGG + Intronic
954792558 3:53143979-53144001 CTGTAGACTTTCAGAGAACAAGG - Intergenic
955578445 3:60392554-60392576 CTTTAGTTTTTCAGTCAGAATGG - Intronic
956864142 3:73352815-73352837 CTGTAAAATTTAAGGGAGAGGGG - Intergenic
957027561 3:75200568-75200590 CTGTAGATTGCCGTGGAGAAGGG + Intergenic
962323350 3:134409326-134409348 TTGTTGATTTTCAGGCTGAATGG + Intergenic
962492176 3:135905018-135905040 CAGTAAATATTCAGGGGGAATGG + Intergenic
962975179 3:140440053-140440075 CAGTAAATTCTCAGGGAGAGTGG + Intronic
963631261 3:147733210-147733232 CTAAAGATTTACAGGGAGAGAGG + Intergenic
964433196 3:156625955-156625977 CTGCTGATTGTCAGGGATAAAGG - Intergenic
965835691 3:172849540-172849562 CTGAAGCTTTTCTAGGAGAATGG + Intergenic
966096184 3:176206147-176206169 CTCAAGATTTTCTGTGAGAAAGG - Intergenic
966168031 3:177043409-177043431 CAGAAGATTTACAGGGAAAAAGG - Intronic
967953070 3:194855646-194855668 CTGTAGATTTTTAGAGAGTTAGG + Intergenic
968136480 3:196223456-196223478 ATGGAGATTTTCACGGAGCAGGG + Intronic
969128781 4:4975113-4975135 CTGCAGATTTTCCAGGAGCATGG - Intergenic
971976095 4:33689378-33689400 CTGGATATTTTTAGGGACAATGG - Intergenic
972141245 4:35962407-35962429 GAGTAGTTTTTCAGAGAGAATGG + Intronic
972291984 4:37697999-37698021 AGGTAGATTTCCAGGGATAAAGG - Intergenic
972722328 4:41712720-41712742 CTATAGATATTCTGGGAGAAAGG - Intergenic
974501906 4:62716000-62716022 TTGTTGATTTTGAGGAAGAAAGG + Intergenic
974794835 4:66735222-66735244 CTGTACATTTTCTGTGGGAAAGG + Intergenic
975821722 4:78277598-78277620 CAGCAGATTTTCTGGGAGATGGG + Intronic
976100029 4:81551398-81551420 CTGTAGATTTTCAGGGAGAAAGG - Intronic
976748916 4:88434054-88434076 CTATAGAGTTTCAGGAGGAAAGG - Intronic
977148693 4:93480890-93480912 CTGTAGAGATTCAGGGAGGTGGG - Intronic
977611757 4:99042309-99042331 ATTTAGATTTTCAGTAAGAATGG + Intronic
977746494 4:100555246-100555268 CTGTATATTTACTGGTAGAAGGG + Intronic
978221287 4:106278207-106278229 ATGAAGTTTTTCAGGCAGAAAGG + Intronic
979270642 4:118756639-118756661 TTGTTGATGTTCAGGGAGACAGG + Intronic
979819216 4:125150461-125150483 CTGAAGGTTGACAGGGAGAATGG - Intergenic
980499482 4:133629836-133629858 ATGTAGAGTATGAGGGAGAAAGG + Intergenic
980720021 4:136683395-136683417 CTGTTGATTTTTAGGTAGAGAGG - Intergenic
980720368 4:136687284-136687306 CTGTGGCTTTTCCAGGAGAAAGG + Intergenic
980852591 4:138401135-138401157 GTGTTTATTTTCAGGGAGTAGGG - Intergenic
981356833 4:143798956-143798978 CTGTAGCTTTTCCAGGAGCATGG + Intergenic
981368361 4:143929553-143929575 CTGTAGCTTTTCCAGGAGCATGG + Intergenic
982042805 4:151411690-151411712 CTTTATATTTGCATGGAGAAAGG - Intronic
982195041 4:152903107-152903129 CTGTAGCATATCAGGCAGAATGG + Intronic
984690174 4:182717432-182717454 CTGTAGCTTTTCAGAGCTAAGGG + Intronic
984691852 4:182735084-182735106 CTGTAGGTTGTTAGGGTGAATGG - Intronic
985554296 5:548879-548901 CAGTAGAGTTTCAGGTAGATCGG - Intergenic
985554304 5:548953-548975 CAGTAGAGTTTCAGGTAGATCGG - Intergenic
985554312 5:549027-549049 CAGTAGAGTTTCAGGTAGATCGG - Intergenic
985554320 5:549101-549123 CAGTAGAGTTTCAGGTAGATCGG - Intergenic
985554328 5:549175-549197 CAGTAGAGTTTCAGGTAGATTGG - Intergenic
985554335 5:549249-549271 CAGTAGAGTTTCAGGTAGATTGG - Intergenic
986038473 5:3963249-3963271 CTTTGGATTTTGAGGGAGAAGGG + Intergenic
986089916 5:4493922-4493944 CTGGGGGTTTTCAGGGAGACTGG - Intergenic
986627265 5:9733977-9733999 ATCCAAATTTTCAGGGAGAAGGG - Intergenic
986905371 5:12488769-12488791 GTGTAGATTTTCTAGGGGAAGGG - Intergenic
988598263 5:32615504-32615526 GTGTAGTTTTTCAAGGGGAAAGG + Intergenic
990773391 5:59276935-59276957 GTGTAGATGTTCAGAGAGATAGG - Intronic
990985941 5:61641022-61641044 CTGTAGATGTCCAGAGGGAAAGG - Intronic
991276706 5:64857040-64857062 TGGTACCTTTTCAGGGAGAATGG - Intronic
992202170 5:74395328-74395350 CTGTATATTTTCATGGGGACTGG - Intergenic
992220501 5:74567450-74567472 TTGTGGATTGTGAGGGAGAATGG - Intergenic
992510754 5:77432147-77432169 CTGTAGGTTTTCTGTAAGAAGGG + Exonic
994409322 5:99386889-99386911 CAGTAGATTTGCAGGGGGAGGGG - Intergenic
994980824 5:106874148-106874170 CTGCTGATTGTCAGGGATAAAGG + Intergenic
995474628 5:112535106-112535128 CTGTAGATTTTCAGACAGTTGGG - Intergenic
995556504 5:113334979-113335001 CTTTAGATTTTCAGGGAATTGGG - Intronic
995576959 5:113547081-113547103 CAGTTTATATTCAGGGAGAAGGG + Intronic
995945086 5:117635424-117635446 TTGTAGAATTACAGGGAAAAGGG - Intergenic
996477318 5:123936568-123936590 CTCTAAAGTTTCAGGGTGAAAGG + Intergenic
997452019 5:133991377-133991399 CTGAAGAGTTACAGGGAGGAAGG - Intronic
998883746 5:146672426-146672448 CTGTGGATTTTCCTAGAGAAAGG + Intronic
999268596 5:150283146-150283168 CTGTAGATTGTCTGGAAGAGGGG - Intronic
1000335021 5:160235687-160235709 CTGGAGAGCTTCAGGGAGGAGGG - Intronic
1001174854 5:169458740-169458762 CTGTAGTTTTTCAGGGGACAGGG + Intergenic
1002871562 6:1171056-1171078 CAGTGGATTTTCAGGCAGGAAGG - Intergenic
1003348385 6:5292702-5292724 CTGGAGCTTTTAAGGGAGACTGG + Intronic
1003754332 6:9099785-9099807 CTTTAGTTTTTCATAGAGAAAGG - Intergenic
1005891846 6:30146774-30146796 CTGTAGATATTCAGAGAGTGAGG + Intronic
1007725667 6:43914323-43914345 CTGGGGATTTTCTGGGAGCAGGG - Intergenic
1008026325 6:46640218-46640240 CTGTAGATTTTGAGGGAGAAGGG - Intronic
1009602358 6:65818480-65818502 TTATACATTTTCAGGGAGTACGG + Intergenic
1012416584 6:99019897-99019919 CTGCTGATTGTCAGGGATAAAGG + Intergenic
1012860930 6:104558586-104558608 CAGTATCTTTTCAGTGAGAAAGG + Intergenic
1014365528 6:120536674-120536696 CTATAGATTTTCAGGCATCAGGG + Intergenic
1014693638 6:124592413-124592435 CTGTAAATTTCCAGGGTTAAGGG - Intronic
1016703852 6:147084152-147084174 AGGTATATTTTCAGGGGGAAGGG - Intergenic
1017080432 6:150663488-150663510 CAGTATATTTGCAGGAAGAAAGG + Intronic
1017551790 6:155517363-155517385 CTGGAGATTTTCTAGGAAAAAGG - Intergenic
1018244528 6:161809734-161809756 TTGTAGTTTTTCAGTGTGAAGGG - Intronic
1020690951 7:11353877-11353899 CTGTAAGTTTTGAGGGAGCAAGG + Intergenic
1020781119 7:12518194-12518216 GTGGAGATTTTCTGGGAAAAGGG + Intergenic
1020839658 7:13199638-13199660 CTGCACCTTTTCAGGGAGGAAGG - Intergenic
1021287276 7:18796041-18796063 ATGTTGATTTACTGGGAGAATGG - Intronic
1021293493 7:18874934-18874956 CTGTGCTTTTCCAGGGAGAATGG + Intronic
1021597977 7:22337136-22337158 CTTTAAATTTTCAGGGAGGCTGG - Intronic
1023044392 7:36198643-36198665 CTTTCGATTTTCAGGGAAGAAGG - Intronic
1024426246 7:49229580-49229602 CTGAAGGTTTTCAGGGAAAATGG + Intergenic
1026316847 7:69234570-69234592 ATGTAGAATTTCTGGGAGTAGGG + Intergenic
1026778014 7:73243539-73243561 CTGTCGATCTTCGTGGAGAACGG + Intergenic
1027018866 7:74796933-74796955 CTGTCGATCTTCGTGGAGAACGG + Exonic
1027069163 7:75149004-75149026 CTGTCGATCTTCGTGGAGAACGG - Exonic
1028573996 7:92325556-92325578 GTTTAGATGTTCAGGGAGAAAGG - Intronic
1028756587 7:94441935-94441957 ATATATATTTTCAAGGAGAAAGG - Intergenic
1030481137 7:110105156-110105178 CTACAGATTTTCAGGTAGAATGG - Intergenic
1030644612 7:112046194-112046216 GTGTAGATTATAAGGTAGAATGG - Intronic
1031257998 7:119481631-119481653 CTATTGATTTTCAGTGATAATGG - Intergenic
1031992939 7:128209671-128209693 CTGTGGAGGTTCAGGAAGAAAGG + Intergenic
1032354803 7:131200725-131200747 CTTTAGTTTTTCAGGAAAAATGG - Intronic
1034129432 7:148701343-148701365 CTGGGGTGTTTCAGGGAGAAGGG - Intronic
1035417302 7:158700894-158700916 CTGTAGAGTTTCAGATAAAAGGG - Intronic
1036194499 8:6702016-6702038 GTGAAGAGTTGCAGGGAGAAGGG - Intergenic
1037573092 8:20175211-20175233 ATGGAGATGTTCAGGGAGCAAGG - Intronic
1038012197 8:23483967-23483989 CTGGAGATCTTCAGGAAGATAGG + Intergenic
1039062510 8:33582878-33582900 GTCTAGATTTCCATGGAGAAAGG + Intergenic
1039960855 8:42246651-42246673 CTGCAGAATCTCAGAGAGAAGGG + Intergenic
1041800472 8:61792460-61792482 CTGGAGTGTTTCAGGGAAAAAGG + Intergenic
1042497015 8:69466604-69466626 CCTGAGATTTTCAGAGAGAAAGG - Exonic
1043293161 8:78629335-78629357 CTGTGGATTTTTTGGGTGAATGG - Intergenic
1043370513 8:79585261-79585283 CAGAAGCTTTTCAGGGAGAGTGG - Intergenic
1045778397 8:105834391-105834413 CTTGAGACTCTCAGGGAGAAGGG + Intergenic
1045892377 8:107172057-107172079 CGGTATATATTTAGGGAGAATGG + Intergenic
1046133770 8:109999530-109999552 CAGTTGATTTCCAGAGAGAATGG + Intergenic
1048677689 8:136802089-136802111 CTTTACATCTTCTGGGAGAATGG + Intergenic
1052751972 9:32501135-32501157 CTGTAGGTTTCCAGAGAGGATGG - Intronic
1053117659 9:35519669-35519691 CTTTAGATTTTCTGGGAAATTGG + Intronic
1054803403 9:69375499-69375521 CTGGAGACTTTAAAGGAGAAAGG + Intronic
1055836397 9:80447839-80447861 ATGAAAATTTTCAGGGAAAAAGG - Intergenic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1057930950 9:99192482-99192504 CTGAAGATCTTCAGGGCTAAGGG - Intergenic
1059074852 9:111181947-111181969 GGGTAGATTTGCATGGAGAAAGG + Intergenic
1059587207 9:115619442-115619464 CTGCAGCTTTTCCGGGAGCATGG + Intergenic
1060566812 9:124599947-124599969 CTGCAGATTTTGAGGCTGAAGGG + Intronic
1061436247 9:130564066-130564088 CTGTAGAATTTATGGGAGCAGGG - Intergenic
1188916178 X:35913838-35913860 CTTTGGAGATTCAGGGAGAAGGG - Intergenic
1189727857 X:43986515-43986537 CTTTAGAATTTAAGGGGGAAAGG + Intergenic
1189973907 X:46444009-46444031 CTGTGGATTTTCACAGGGAAGGG - Intergenic
1190366045 X:49695760-49695782 GTGTGGCTTTTGAGGGAGAAGGG - Intronic
1190644206 X:52509861-52509883 CAGTAGATTTTCAGGTGGGAAGG - Intergenic
1191151223 X:57222368-57222390 CTGTCGATATAGAGGGAGAAAGG - Intergenic
1193682728 X:84541712-84541734 CTGTAGCTTTTCAAGGTGCAGGG - Intergenic
1193682772 X:84541957-84541979 CTGTAGCTTTTCAAGGTGCAGGG - Intergenic
1193752998 X:85370617-85370639 TTGTAGACTTCCAGGGAAAAGGG - Intronic
1194007256 X:88510399-88510421 CTGAAGATTTTAAGGGACAATGG - Intergenic
1194584710 X:95718136-95718158 ATTTACATTTTCAGGGAGAGGGG + Intergenic
1195100182 X:101548375-101548397 CTGTATATTTGCAGGAAGAAAGG + Intergenic
1197492196 X:127131012-127131034 CTTTAGCATTTCTGGGAGAATGG - Intergenic
1197721642 X:129748970-129748992 TTGCAGATTTTAAAGGAGAAAGG + Intronic
1198995562 X:142569788-142569810 CTCCAGCTTTTCAGGGAAAAGGG - Intergenic
1199542224 X:148969631-148969653 CTGTATATGTTCAGTGCGAATGG + Intronic
1200337061 X:155361986-155362008 CTGGAGAGTTTTAGGGAGAGTGG + Intergenic
1200349409 X:155479241-155479263 CTGGAGAGTTTTAGGGAGAGTGG - Intergenic