ID: 976104880

View in Genome Browser
Species Human (GRCh38)
Location 4:81605974-81605996
Sequence AGAGATCTGGAGAGGATGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 659
Summary {0: 1, 1: 0, 2: 1, 3: 54, 4: 603}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976104880 Original CRISPR AGAGATCTGGAGAGGATGGC TGG (reversed) Intronic
900091383 1:922226-922248 AGTGATTTGGAGAGGGAGGCTGG - Intergenic
900491520 1:2951611-2951633 AGGGCTCTGGAGTGGGTGGCCGG - Intergenic
901746914 1:11379950-11379972 AGACATCAGAAGAGGATGGATGG + Intergenic
901791454 1:11655346-11655368 TGAGATCTTGAGAAGGTGGCTGG + Exonic
901904052 1:12392686-12392708 AGTTATCTGCAGAAGATGGCAGG + Intronic
902232104 1:15034692-15034714 AGGCATCTGGAGAGGACAGCTGG + Intronic
902992382 1:20197386-20197408 GGGGATCTGGAGAGCATGGGCGG + Intergenic
903565020 1:24258765-24258787 AGGGAGCTGGAAAGGATGCCAGG - Intergenic
903754900 1:25653828-25653850 TGAGAACTGGAGAAGATGGATGG - Intronic
903860769 1:26363207-26363229 AGAGATTTGGAGAGGACCTCAGG - Intronic
903883010 1:26524835-26524857 AGAGAGGTGGGGTGGATGGCAGG - Intergenic
904179494 1:28655973-28655995 AGTTATCTGCAGAAGATGGCAGG + Intergenic
904335931 1:29797984-29798006 AGTTATCTGCAGAAGATGGCAGG - Intergenic
904381921 1:30117211-30117233 AGAGCTCTGGAGAAGGAGGCTGG - Intergenic
904624769 1:31796279-31796301 AGAGATCTGGGCAGAATGCCAGG + Intronic
904714513 1:32457306-32457328 GGACATTTGGACAGGATGGCAGG - Intergenic
905203246 1:36327932-36327954 AGAGATCCGAAGCGGGTGGCTGG - Exonic
905301060 1:36986391-36986413 AGAGATGGGGACAGGATGGATGG - Intronic
905354066 1:37368785-37368807 AGTTATCTGCAGAAGATGGCAGG - Intergenic
906490728 1:46266542-46266564 AGAGGTGTGGAGAGAATGGGAGG + Intronic
906611597 1:47207844-47207866 AGAGATCTGGAGCTGATGCTGGG + Intergenic
907602084 1:55782149-55782171 AGTTATCTGTAGATGATGGCAGG + Intergenic
907629797 1:56069134-56069156 AGAGATCTGGACAGGAAGTCAGG + Intergenic
909301073 1:74014343-74014365 AGAGTTATGGAGAGGATTTCTGG + Intergenic
909576919 1:77185856-77185878 AGTTATCTGCAGAAGATGGCAGG - Intronic
910060178 1:83081523-83081545 ACAGAGCTGGAGAGGTAGGCAGG + Intergenic
910227940 1:84955521-84955543 AGGGGTCTGGAGAGGCAGGCAGG + Intronic
910370633 1:86512126-86512148 AGTTATCTGCAGAAGATGGCAGG - Intergenic
910948213 1:92616686-92616708 AGTTATCTGAAGAAGATGGCAGG - Intronic
911257327 1:95647366-95647388 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911265134 1:95734187-95734209 GTAGTTCTGAAGAGGATGGCAGG + Intergenic
911429925 1:97772885-97772907 AGATTTCTGAAGAGGATGGATGG + Intronic
911542173 1:99170655-99170677 AGAGATTTGCACAGAATGGCAGG - Intergenic
911738399 1:101361921-101361943 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911980425 1:104559419-104559441 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912129913 1:106588052-106588074 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912184331 1:107256709-107256731 AGAGAGCGGGAGAGGAAGACAGG + Intronic
912212251 1:107568892-107568914 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912252031 1:108021390-108021412 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912733324 1:112128831-112128853 AGTCATCTGCAGAAGATGGCAGG + Intergenic
912811552 1:112798976-112798998 AGAGATCTGGGGAAGATGTGGGG - Intergenic
913181952 1:116330737-116330759 TGAGCTCTGGAGAGGGTGGGAGG + Intergenic
915527495 1:156485055-156485077 GGAGCTCTGGAGGGGAGGGCGGG - Intronic
916350479 1:163844022-163844044 ACAGTTCTGGAGAGGCTGACTGG - Intergenic
916521483 1:165567341-165567363 AGGGATATGGGGAGGATGGAGGG + Intergenic
917149535 1:171929473-171929495 AGAGCATTGGTGAGGATGGCTGG + Intronic
917217216 1:172690915-172690937 AGTTATCTGCAGAAGATGGCAGG + Intergenic
917716061 1:177739267-177739289 AGAAGTCTGGAGAGGGAGGCTGG + Intergenic
918734470 1:188041274-188041296 AAAGATGTGGAGAGAATGGGAGG + Intergenic
918755717 1:188337811-188337833 AGTTATCTGGAGAAGATGGAAGG + Intergenic
918918233 1:190671881-190671903 AGTTATCTGCAGAAGATGGCAGG + Intergenic
919317970 1:195999360-195999382 AGTTATCTGCAGAAGATGGCAGG - Intergenic
919915760 1:202138143-202138165 GGAGAACTGGAGAGGAAGCCGGG - Intronic
919983005 1:202654030-202654052 AGGGACCTGGGGAGGAGGGCTGG - Intronic
920364528 1:205441057-205441079 AGAGATCTGCAGGGAAAGGCAGG + Intronic
920467918 1:206203803-206203825 GGAGATTTGGAGAGGGTGGAGGG - Intronic
920774190 1:208920192-208920214 ACTGCTCTGGAGAGCATGGCAGG + Intergenic
922068843 1:222170803-222170825 AGATATCTGCACAGGATGGGTGG - Intergenic
922147058 1:222957092-222957114 AGAAATCTGAAAAGGATGACAGG - Intronic
922560395 1:226565284-226565306 AGAGGTCTGGGCAGGATGGGAGG - Intronic
922697114 1:227736107-227736129 TGGGATCTAGAGAGGATGGTGGG + Intronic
922852765 1:228747847-228747869 AGAGATAGGGAGATGATGTCAGG + Intergenic
922910310 1:229210261-229210283 TGAGAGCTGGGAAGGATGGCTGG + Intergenic
923540704 1:234886186-234886208 AGGAAGCTGGTGAGGATGGCTGG - Intergenic
924400808 1:243678948-243678970 AGAGATGTGGAGCGGGTGGAAGG - Intronic
924840778 1:247707834-247707856 AGTTATCTGCAGAAGATGGCAGG + Intergenic
924847135 1:247785140-247785162 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1063823119 10:9860709-9860731 AAAGATCTGCACAGGATGACTGG - Intergenic
1064545690 10:16448137-16448159 AGTTATCTGCAGAAGATGGCAGG + Intronic
1065005324 10:21374162-21374184 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1065625764 10:27626920-27626942 AGAGATCTGGAGAGCTTGCAGGG - Intergenic
1067026695 10:42848356-42848378 AGTTATCTGCTGAGGATGGCAGG + Intergenic
1067125555 10:43512546-43512568 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1067306989 10:45073172-45073194 AGAGATCTGGACAGAATTGCCGG - Intergenic
1068102935 10:52579488-52579510 ACAGATCTGCAGAAGAGGGCTGG + Intergenic
1068447208 10:57138591-57138613 AGTTATCTGAAGAAGATGGCAGG - Intergenic
1068594099 10:58883739-58883761 AGAGGTCTGGAAAGGATGAGGGG + Intergenic
1068801592 10:61146599-61146621 AGAGATCTGGAAAGAAGTGCGGG - Intergenic
1068837218 10:61568380-61568402 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1069610188 10:69767775-69767797 TGAGCTATGCAGAGGATGGCTGG + Intergenic
1069790833 10:71019585-71019607 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1070130732 10:73653707-73653729 AGAGATCTGGAAGGGATGGAGGG + Intronic
1070447615 10:76523072-76523094 TGACATCTGGGGAAGATGGCTGG - Intronic
1071267088 10:83974004-83974026 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071364470 10:84884523-84884545 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071471004 10:85984068-85984090 GGAGAGATGGAGAGGAGGGCTGG - Intronic
1071942787 10:90607780-90607802 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1072540687 10:96396031-96396053 AGACATCAGGAGAGGAAGACGGG + Intronic
1072976116 10:100060148-100060170 AGAGTTCTGGAGATGAGTGCTGG + Intronic
1073085674 10:100887034-100887056 GGAGAGCTGGAGACGGTGGCAGG + Intergenic
1073830506 10:107378011-107378033 AGTTATCTGTAGATGATGGCAGG + Intergenic
1073918478 10:108432317-108432339 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1074183921 10:111085276-111085298 AGAATTCTGGAGGGGATGGGAGG + Intergenic
1074490932 10:113939005-113939027 AGAGGGCTGGAGAGGATGCAAGG - Intergenic
1074545823 10:114401748-114401770 TGAGGTCTGGAGATGATGGGTGG - Intronic
1075425728 10:122340514-122340536 AGAGAGCTAAACAGGATGGCAGG + Intergenic
1076479910 10:130778094-130778116 AGAGGTCTGCAGAGGCTGGGGGG + Intergenic
1076927417 10:133499228-133499250 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1076979035 11:195621-195643 AGAGGTGTGGAGAGGAGGGCCGG - Intronic
1076988082 11:253723-253745 CGAGGTCTGGAGAGGGTGGGTGG - Intergenic
1077009113 11:372375-372397 AGAGCTCCAGACAGGATGGCTGG - Intronic
1077375970 11:2205308-2205330 AGGGAGGTGGGGAGGATGGCTGG - Intergenic
1077404890 11:2378402-2378424 AGGGGCCTGGAGTGGATGGCAGG + Intronic
1078531030 11:12136927-12136949 TGAGATCTAGAGAGCATGGCGGG + Intronic
1078680099 11:13467805-13467827 AGAGCTATGAAGAGGATGCCTGG + Intergenic
1078735702 11:14018627-14018649 AGAGATCTGCAGAGCATGCTGGG + Intronic
1078740975 11:14065966-14065988 ATAGATGTGAAGAGGTTGGCAGG + Intronic
1080406091 11:31980556-31980578 AGGGATCAGGAGAGAATGGGAGG + Intronic
1080976678 11:37350570-37350592 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1081072774 11:38631093-38631115 AGATGTCTGCAGAAGATGGCAGG - Intergenic
1081317708 11:41650796-41650818 AGAAATCTAGAGAGGAAGTCTGG + Intergenic
1081609059 11:44547850-44547872 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1081718835 11:45271496-45271518 AGTCAGCTGGAGAGGAAGGCTGG + Intronic
1082671698 11:56043014-56043036 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1082830698 11:57614764-57614786 AGTGGTTTGGAGAGCATGGCAGG - Exonic
1083093143 11:60221099-60221121 AGTTATCTGCAGAAGATGGCAGG - Intronic
1083112258 11:60422849-60422871 AGTTATCTGAAGAGGATGGAAGG + Intergenic
1083478770 11:62930250-62930272 ACTGCTCTGGAGAGGAAGGCTGG - Intergenic
1083616880 11:64030630-64030652 AGAGATGTGGACATGTTGGCCGG + Intronic
1083733573 11:64667174-64667196 AGAGAGACGGAGAGGATGTCAGG + Intronic
1085925716 11:81018095-81018117 GTAGATCTGAAGAGCATGGCAGG + Intergenic
1087656616 11:100930871-100930893 AGACATCTGGAGAAGATGCTGGG - Intronic
1087827122 11:102778188-102778210 AGAGATCAGGAGAAAATGCCAGG - Intronic
1088836653 11:113583361-113583383 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1089396733 11:118141053-118141075 AGAGATGGGGAGGGGGTGGCAGG + Intronic
1089637956 11:119828475-119828497 AGGCATCAGGAGAGGGTGGCTGG + Intergenic
1090209495 11:124908075-124908097 AGTCATCTGCAGAAGATGGCAGG + Intergenic
1090221617 11:125031613-125031635 AGTTATCTGCAGAAGATGGCAGG + Intronic
1090332264 11:125941522-125941544 ACAGATCAGGAGAGGAAGGAAGG - Intergenic
1090534126 11:127621937-127621959 AGAGATGGAGAGAGAATGGCAGG + Intergenic
1090873210 11:130766326-130766348 AGTGATCTGCAGGGGAAGGCAGG - Intergenic
1091276729 11:134357821-134357843 AGAGATCTGCAGAGCTAGGCTGG - Intronic
1091413146 12:257484-257506 AGAGAACTTGACTGGATGGCAGG + Intronic
1091599970 12:1912186-1912208 GGAGATCGGGAGTGGTTGGCTGG - Intronic
1091773739 12:3170717-3170739 GGAGAGTTGGGGAGGATGGCAGG + Intronic
1091787047 12:3249365-3249387 ATTGATCTGGAGAGAATGGTGGG - Intronic
1092093281 12:5821623-5821645 AGTTATCTGCAGAAGATGGCAGG - Intronic
1092381558 12:8000911-8000933 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093036286 12:14335315-14335337 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093645725 12:21583643-21583665 AGTTATCTGCAGAAGATGGCAGG - Intronic
1094102526 12:26779235-26779257 AGTTATCTGCAGAAGATGGCAGG - Intronic
1094354052 12:29558649-29558671 AGAGATCTTTAGAGGAAGTCTGG + Intronic
1094378727 12:29819176-29819198 AGAGGCCTGGAGATGATGCCAGG - Intergenic
1095190258 12:39250137-39250159 AGCTATCTACAGAGGATGGCAGG - Intergenic
1095598990 12:43993542-43993564 AGAGACTTGGAGAAGATGGAGGG + Intronic
1095844402 12:46729995-46730017 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1095856243 12:46863702-46863724 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1096093503 12:48918965-48918987 AGGGATTTGGAAAGGATAGCGGG + Intronic
1096457472 12:51799464-51799486 AGTTATCTGCAGAAGATGGCAGG + Intronic
1097437843 12:59572281-59572303 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097564650 12:61252456-61252478 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1098733288 12:74065604-74065626 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099183382 12:79492615-79492637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1099375646 12:81893930-81893952 AGTAATCTGCAGAAGATGGCAGG - Intergenic
1099526360 12:83723084-83723106 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099689778 12:85938010-85938032 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099956147 12:89353809-89353831 AGAGATCTGGGGAGGGTGGGGGG + Intergenic
1099995069 12:89769557-89769579 AGTTATCTGAAGAGGATGGCAGG + Intergenic
1100165677 12:91914886-91914908 AGAGCTCTGGAGAGCAATGCTGG - Intergenic
1100241155 12:92711635-92711657 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1100851834 12:98720053-98720075 AGACATCTGGAGAGGAAGAAAGG - Intronic
1101534670 12:105606131-105606153 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101543069 12:105682609-105682631 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1101731759 12:107432609-107432631 AGAGATGTTGAGAGGATGAATGG + Intronic
1102017466 12:109657174-109657196 TGAGCTCTGGAGAGCAGGGCTGG - Intergenic
1102046166 12:109831697-109831719 TGAGCTCCGGTGAGGATGGCTGG - Intronic
1102623454 12:114215379-114215401 AGAGATCTGGGGAGAATGGATGG + Intergenic
1103035609 12:117654036-117654058 AGTTATCTGCAGAAGATGGCAGG - Intronic
1103557428 12:121775045-121775067 CCAGAACTGGAGAGGAAGGCAGG - Exonic
1105546028 13:21351844-21351866 CAGCATCTGGAGAGGATGGCTGG + Intergenic
1105729046 13:23193247-23193269 ATGGAGCTGGAGAGGCTGGCTGG + Intronic
1106190185 13:27445674-27445696 AGAGATGTGGCAAGGATGGCAGG - Intronic
1106522052 13:30506666-30506688 AGAGAGCTGGAGAGAAGGGAAGG - Intronic
1107235956 13:38170958-38170980 ACAGATCAGGAGGGGATGGTAGG + Intergenic
1108708842 13:53014117-53014139 AGAGAGCTGGATAGGAAGACAGG - Intergenic
1110335659 13:74327330-74327352 GGAGAGCTGGAGAGGACGGATGG + Intergenic
1111317499 13:86581776-86581798 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1111331225 13:86763317-86763339 AGAGATCTGGAAGGGATGAGTGG + Intergenic
1111724035 13:91982065-91982087 AGAGAGCTGGAGAGGGAAGCAGG + Intronic
1112231129 13:97590191-97590213 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1112584468 13:100705999-100706021 GGAGATGCGGAGAGGATGGGTGG - Intergenic
1113432159 13:110260678-110260700 AGAGTTCTGGAGTGGATGGTGGG + Intronic
1114205868 14:20570742-20570764 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1115559283 14:34568720-34568742 AGAGATCTGGACAGAATCGCTGG - Intronic
1116531457 14:45978252-45978274 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1117111507 14:52461647-52461669 AGAGCTGTGAAGAGGATGTCTGG + Intronic
1117216840 14:53560148-53560170 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1117634130 14:57724346-57724368 AGTTATCTGCAGAAGATGGCAGG - Intronic
1118014276 14:61642543-61642565 AGGCAGCTGGAGAGGAAGGCAGG + Intronic
1118323439 14:64766593-64766615 AGGGATGTGGGGAGGATGGAGGG + Intronic
1118880777 14:69824045-69824067 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1119343064 14:73897230-73897252 AGAGATGGGGAGTGGATGGGAGG + Intronic
1119555773 14:75551222-75551244 AGATAAATGCAGAGGATGGCAGG - Intergenic
1120082027 14:80227557-80227579 AGTTATCTGCAGAAGATGGCAGG + Intronic
1120252202 14:82071496-82071518 ACAGATCTGCAGAGAATGACAGG - Intergenic
1121778868 14:96608871-96608893 AGAGCTGAGGAGAGGATGACAGG + Intergenic
1125427821 15:39567336-39567358 AAAGATCTGGAGAAGTCGGCCGG - Intergenic
1125481078 15:40081299-40081321 AGGCTTCTGGAGAGGAGGGCTGG - Intergenic
1126143276 15:45454777-45454799 AGAGATGTGGAGAGGAGGGCTGG + Intergenic
1127356911 15:58209162-58209184 AGTTATCTGCAGAAGATGGCAGG - Intronic
1129454637 15:75670158-75670180 AGAGGTCTGGGTAGGATGGGTGG + Intergenic
1129610392 15:77050062-77050084 TTAGAGCTGGAGAGGATGGTTGG - Intronic
1129665755 15:77578557-77578579 AGAGGTCTGGGCAGCATGGCTGG - Intergenic
1129710331 15:77817493-77817515 AGAGCTGTGCAGAGGATGACAGG + Intronic
1130338456 15:82978161-82978183 ACAAACCTGGAGAGGAAGGCAGG + Intronic
1130966089 15:88699112-88699134 AGTGTTCTGGAAAGGATGGAAGG - Intergenic
1131056486 15:89378213-89378235 AGACATCTGGAGCGGAGTGCGGG - Intergenic
1131724007 15:95202768-95202790 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1132796685 16:1727915-1727937 AGAAAGCTGGGGAGGATGGGAGG + Intronic
1133024468 16:2981954-2981976 AGAGACTTGGGGAGGATGGAGGG - Intergenic
1133987258 16:10677855-10677877 AGAGGTCTGCAGAGGATAGTCGG + Intronic
1135574888 16:23577888-23577910 GGAGATATGGTGGGGATGGCTGG + Intergenic
1135643060 16:24137648-24137670 ATGGATATGCAGAGGATGGCAGG - Intronic
1135689361 16:24523696-24523718 AGAGTTGGGGAGAGGAGGGCGGG + Intergenic
1136250938 16:29004564-29004586 AGTTATCTGCAGAAGATGGCGGG - Intergenic
1136297404 16:29311548-29311570 AGAGGTGTGGAGGGGCTGGCGGG + Intergenic
1136849616 16:33602905-33602927 AGAGAACGGGAGAGGAGGGGAGG - Intergenic
1138353325 16:56358294-56358316 TGAGATGTGGAGAGGATTCCAGG - Intergenic
1138399643 16:56735062-56735084 AGAGCTCAGGAGATGATGTCGGG + Intronic
1138868382 16:60850758-60850780 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1139064485 16:63295637-63295659 ACAGATATGAAGAGGATGGTTGG - Intergenic
1139544266 16:67642286-67642308 AGAGATCTGGACAGGCTTGCAGG - Intergenic
1139630459 16:68228951-68228973 AGAGGTCTGGTGATAATGGCTGG - Exonic
1140051267 16:71483542-71483564 AGATTACTGGAGAGAATGGCAGG - Intronic
1140219232 16:73031828-73031850 AGAGGTGTGGAGAGAATGGGAGG + Intronic
1140524907 16:75614545-75614567 ATACATCTGGAGAGGTTGGCTGG + Intronic
1140839664 16:78827092-78827114 GGAGTTCTGGAGAGGAGAGCAGG - Intronic
1141559546 16:84858065-84858087 AGTTATCTGCAGAAGATGGCAGG + Intronic
1141665060 16:85461763-85461785 GGAGATCTAGTGAGGCTGGCTGG - Intergenic
1142058959 16:88017625-88017647 AGAGGTGTGGAGGGGCTGGCGGG + Intronic
1142466525 17:140439-140461 AGAGGTGTGGAGAGGAGGGCCGG - Intergenic
1142920826 17:3184168-3184190 AGAGATAGGGAGTGGATGGTGGG - Intergenic
1142956149 17:3524111-3524133 TGAGATCTGGAGAGGAAGAGGGG - Intronic
1143244333 17:5469910-5469932 AGAGAACTTGAGAGTCTGGCTGG - Intergenic
1143968100 17:10771314-10771336 ACAGGTCTGGGGAGGAAGGCAGG + Intergenic
1144090273 17:11850153-11850175 GGGCATCTGGAGAGGATGGGTGG + Intronic
1145741534 17:27279047-27279069 AGAGAGGTGGAGAGGAGGGGGGG - Intergenic
1145957294 17:28863234-28863256 AGAGATGTGAAGAGGGAGGCTGG - Intergenic
1146070033 17:29671945-29671967 AGAGAGCTGGAGAGTCGGGCCGG + Exonic
1146127182 17:30238675-30238697 AGAGACCTGGAGAGGCCGGGAGG + Intergenic
1146237981 17:31185921-31185943 AGTTATCTGCAGAAGATGGCAGG - Intronic
1146895681 17:36540087-36540109 AGAGAGCTGGAGAGGCAGGCAGG + Intronic
1147927386 17:43954042-43954064 AGCGATCTGGCGAGGGTGGAAGG - Intronic
1148052959 17:44778135-44778157 TGGGACCTGGGGAGGATGGCAGG - Exonic
1151037814 17:70821615-70821637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1151280127 17:73067480-73067502 AGAAATCTAGAGACCATGGCTGG - Intronic
1151684107 17:75636773-75636795 AGAGAGCTGGAGAGGAACCCCGG - Exonic
1151816226 17:76472771-76472793 AGGGACCTGGAGAAGCTGGCCGG - Exonic
1152109478 17:78349765-78349787 AGAGAATTGGAGGGGCTGGCTGG + Intergenic
1152380066 17:79937715-79937737 AGAGATCTGGGGAGGAAGCGAGG - Exonic
1152863553 17:82709477-82709499 AGGGACCGGGAGAGCATGGCAGG - Intergenic
1153217696 18:2835633-2835655 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1153434737 18:5057456-5057478 AGGGATGTGGACAGGAGGGCAGG + Intergenic
1154506169 18:15042859-15042881 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1155094715 18:22544591-22544613 AGAGAGCAGGAGAGAAGGGCTGG + Intergenic
1155356488 18:24958617-24958639 AGGGATCAGGAGAGGAAGGCAGG + Intergenic
1155420972 18:25655493-25655515 AGGGTTCTGGAGAGGTAGGCAGG - Intergenic
1155940704 18:31799567-31799589 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156186942 18:34674473-34674495 AGAGTCAGGGAGAGGATGGCTGG - Intronic
1156462158 18:37327226-37327248 AGAGACCTGCAGAGGCTGGTGGG - Intronic
1156582549 18:38394433-38394455 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1157319163 18:46620988-46621010 AGAGATCAGGAGACCAGGGCTGG + Intronic
1157341198 18:46779996-46780018 AGTTATCTGGAGAAGATGGCAGG - Intergenic
1157441457 18:47715015-47715037 AGACATCTGGTGAAGATTGCAGG + Intergenic
1157597183 18:48871007-48871029 AGAGATCTGGGGGAGATGCCGGG + Intergenic
1158450512 18:57559894-57559916 AGAGATTTGGAGGGGGAGGCAGG - Intronic
1158483319 18:57842130-57842152 AGAGCTCAGGAGAGGTTGCCTGG - Intergenic
1159498635 18:69239073-69239095 AGAAGTCTGGGGAGGAGGGCAGG + Intergenic
1159559108 18:69975382-69975404 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1160452740 18:78977147-78977169 AGAGATCTGGAGAGACTTGCGGG - Intergenic
1161164391 19:2778341-2778363 TGAGAACTGGACAGGGTGGCAGG + Intronic
1161321308 19:3642906-3642928 AGTCGTCTGGACAGGATGGCAGG - Exonic
1162497332 19:11030607-11030629 AGGGATCTGGGGATGCTGGCAGG + Intronic
1163241476 19:16066604-16066626 TGAGATCTAGAGAGGACAGCAGG + Intergenic
1163595451 19:18218697-18218719 AGAAATCTGGAGAGAAGAGCTGG - Intronic
1164806838 19:31123537-31123559 AGAGACCAGGAGAGCATGACGGG - Intergenic
1166292077 19:41869727-41869749 AGAGATCTGGACAGAATCGCCGG + Exonic
1166390464 19:42406431-42406453 AGAGGCCTGGGGAGGAGGGCAGG + Intronic
1167609913 19:50502039-50502061 AGGGCTCTGCAGAGGCTGGCGGG - Intergenic
1167654417 19:50754158-50754180 AGAAGTCTGGAGAGGCTGGCAGG + Intergenic
1167951576 19:53031895-53031917 AGTTATCTGCAGAGGATGGTAGG - Intergenic
1168106000 19:54166052-54166074 AGAGACCCAGAGAAGATGGCAGG + Intronic
1168539339 19:57197401-57197423 AGTTATCTGCAGAAGATGGCAGG + Intronic
1168545277 19:57244810-57244832 AGAAATCTGGAGGGGAAGGAGGG - Intronic
925492176 2:4407223-4407245 AGATATATGGTGAGGATGGTAGG + Intergenic
925835513 2:7941814-7941836 AGAGAAGTGGAGAGGAGGGATGG - Intergenic
927598042 2:24414741-24414763 AAAGATAAGGAGAGGATGGCTGG - Intergenic
928097402 2:28413061-28413083 GGAGTTCTGGAGATGATGACTGG - Exonic
928274868 2:29891352-29891374 GGAGACCTAGAGAGGATGCCGGG + Intronic
928347723 2:30516662-30516684 AGAGCTCTCAAGATGATGGCAGG - Intronic
928378302 2:30797113-30797135 AGAGATCTAGAGAGGTTTACTGG + Intronic
929086082 2:38168499-38168521 AGATATGTGGTGAGGATGGGGGG + Intergenic
931023804 2:58084375-58084397 AGAGAGGTGGAGAGGGTGGGAGG - Intronic
931381966 2:61762049-61762071 ATATCTCTGGAGAGGATGGCAGG + Intergenic
931710904 2:64988851-64988873 CGAGCTCTGGAGAGGAGCGCGGG + Intronic
932377978 2:71255125-71255147 AGAGATCTGGAAAGGATATGAGG - Intergenic
932603662 2:73148841-73148863 TGAGATCTGGGCAGGATGGCAGG - Intronic
932759663 2:74430941-74430963 AGGGATCTGGAGAGGTGGTCAGG - Intronic
934850147 2:97693996-97694018 AGAGTTCTGGAGATGAATGCTGG - Intergenic
934930500 2:98418501-98418523 AGAGATGTGGGGAGGATGAATGG + Intergenic
935048675 2:99504901-99504923 AGAGCACTGGACAGGAAGGCAGG - Intergenic
935564312 2:104590282-104590304 AGTTATCTGCAGAAGATGGCAGG + Intergenic
936826363 2:116586643-116586665 AGTGATCTGGAGAGATTGGCTGG + Intergenic
937531189 2:122829577-122829599 ATTTATCTGCAGAGGATGGCAGG - Intergenic
937785210 2:125887757-125887779 AGTTATCTGCAGAGGATGGCAGG + Intergenic
937974849 2:127576485-127576507 AGAGATGTGGAGCGGAGGCCAGG + Intronic
938210830 2:129464679-129464701 AGGGACCTGGAGAAGAGGGCAGG - Intergenic
938375535 2:130803352-130803374 AAAGATCCACAGAGGATGGCAGG - Intergenic
939069058 2:137517827-137517849 AGTTATCTGCAGAAGATGGCAGG - Intronic
939190146 2:138907760-138907782 ACAGAGTTGGAGAGGATGTCAGG + Intergenic
939213869 2:139212211-139212233 AGTTATCTGCAGAAGATGGCAGG - Intergenic
939633368 2:144551812-144551834 AGTTATCTGCAGATGATGGCAGG + Intergenic
939652831 2:144785711-144785733 AGAAATCTAGAGAGGAAGTCTGG - Intergenic
939755229 2:146101775-146101797 AGTTATCTGCAGAGGAAGGCAGG - Intergenic
939806237 2:146778445-146778467 AGTTATCTGCAGAAGATGGCAGG - Intergenic
941085818 2:161116583-161116605 AGAGGTCTGGAGAAGATGTGAGG - Intergenic
941594339 2:167456800-167456822 GGAGATCTTGAGAGGATGGTGGG - Intergenic
941668014 2:168261101-168261123 AGTTATCTGCAGAAGATGGCAGG - Intergenic
943006893 2:182395812-182395834 AGTTATCTGGAGAAGATGGCAGG - Intronic
943239222 2:185362601-185362623 AGTTATCTGCAGAAGATGGCAGG + Intergenic
943517601 2:188907271-188907293 AGTTATCTGCAGAAGATGGCAGG + Intergenic
944260673 2:197672883-197672905 AGAGATAAGGAGAGAATGGGAGG + Intronic
944809316 2:203312314-203312336 AGAGCTGGGGAGAGGAAGGCTGG + Intergenic
945221384 2:207488033-207488055 AGAAAACTGGAGAGGATGGGAGG - Intergenic
945544867 2:211138128-211138150 AGTTATCTGCAGAAGATGGCAGG - Intergenic
945717838 2:213380698-213380720 AGTTATCTGCAGAAGATGGCAGG + Intronic
945725848 2:213471524-213471546 AGTTATCTGCAGAAGATGGCAGG + Intronic
946392994 2:219427645-219427667 AGAGAATTGGAGAAGATGGGAGG + Intergenic
946527871 2:220539996-220540018 AGTTATCTGCAGAAGATGGCAGG + Intergenic
947440718 2:230118695-230118717 AGTTATCTGCAGAAGATGGCAGG + Intergenic
947440843 2:230120228-230120250 AGTTATCTGCAGAAGATGGCAGG - Intergenic
947859606 2:233349172-233349194 AGAGAGCTGGAGGGAAGGGCTGG + Intergenic
948323597 2:237092745-237092767 TGAAAGCTGGAGAGGATGTCGGG + Intronic
1169234845 20:3922652-3922674 AGAGGTGTGGAGAGCAAGGCCGG - Intronic
1169479608 20:5966981-5967003 AGAGAGCAGGAGTAGATGGCTGG - Intronic
1170092312 20:12604140-12604162 AGGTATCTGCAGAGGATGACAGG + Intergenic
1170678637 20:18505016-18505038 AGAGATCTGGGCAGAATTGCCGG + Intergenic
1172105545 20:32515221-32515243 AGAGCTCAGAAGAGGAAGGCAGG + Intronic
1172112829 20:32557455-32557477 GGAGACTTGGAGAGGCTGGCTGG - Intronic
1172434459 20:34919222-34919244 AGAGATGGGGGTAGGATGGCAGG + Intronic
1172574473 20:35997119-35997141 AAAGATCTGCAGAGGATGGAAGG - Intronic
1173000526 20:39102227-39102249 AGGGATCTGGAGAAGCTGTCAGG - Intergenic
1173690690 20:44958948-44958970 TGAAATCTGGAGAGGATGTGAGG + Intronic
1173954374 20:47019206-47019228 AGAGAGCTGGAGACGTTGGCTGG - Intronic
1174803544 20:53585805-53585827 GGAGACCTGGAGATGAGGGCAGG + Intronic
1175977620 20:62719513-62719535 AGAGCTCTGGAGAGGGAGGGTGG - Intronic
1176791684 21:13326165-13326187 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1177129687 21:17240904-17240926 AGAAATCTAGAGAGGAAGGCTGG - Intergenic
1177913172 21:27056181-27056203 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1177933700 21:27316962-27316984 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1177991074 21:28037167-28037189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178060758 21:28851167-28851189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1179415153 21:41192550-41192572 AGTTATCTGAAGAAGATGGCAGG + Intronic
1179628082 21:42659779-42659801 TGAGCTCCGGAGAGGCTGGCTGG - Intronic
1180591150 22:16938396-16938418 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1181368928 22:22401141-22401163 AGGGATCTGGAAAGGAAGGCAGG - Intergenic
1181420650 22:22795802-22795824 AGTTATCTGTAGAGGATGGCAGG - Intronic
1181559395 22:23691386-23691408 AGACATCTGGAGAGGCTCACTGG + Exonic
1181762458 22:25067632-25067654 AGAGAGGAAGAGAGGATGGCAGG - Intronic
1181770338 22:25120480-25120502 AGAGACCTGGAGTGAATGGAGGG + Intronic
1181829286 22:25546503-25546525 AGAGAGGGGGAGAGGATGGGAGG - Intergenic
1182156291 22:28076116-28076138 AGAGTTCTGGAAAGGATTGGGGG + Intronic
1182422860 22:30257024-30257046 AGAGCTCTGGACATGGTGGCTGG - Intergenic
1182459204 22:30472150-30472172 ACAGATCTGGAGGGGCAGGCGGG + Intergenic
1183160597 22:36110522-36110544 AGAGATTTGGACAGGAGGGAGGG + Intergenic
1183455243 22:37918969-37918991 AGTGATGTGAACAGGATGGCTGG + Intronic
1183534532 22:38390180-38390202 GGAGACCTGGAGATGAGGGCAGG + Intronic
1183745187 22:39687894-39687916 AGTGATCTGGAGAGGCTGCAGGG + Exonic
1183806904 22:40219480-40219502 TGAGTTCTGGAAAGGATAGCAGG + Intronic
1184171849 22:42764687-42764709 AGAGCTCTGGAGAGAGAGGCAGG - Intergenic
1184603564 22:45558404-45558426 AGTTATCTGCAGAAGATGGCAGG + Intronic
1185345245 22:50307898-50307920 AGAGAACCGGAGAGGAGGGGAGG + Intergenic
949125667 3:443175-443197 AGTTATCTGCAGAAGATGGCAGG + Intergenic
949155037 3:816934-816956 AGGGATCTGGAGAGGCAGTCTGG - Intergenic
949417595 3:3830912-3830934 AGTTATCTGCAGAAGATGGCAGG + Intronic
949445608 3:4131024-4131046 AGTTATCTGCAGAAGATGGCAGG - Intronic
949895064 3:8762565-8762587 AGTGATGTGGAGAGCATGGTGGG - Intronic
949898831 3:8793101-8793123 CTAGAACTGGAGGGGATGGCTGG - Intronic
949954512 3:9256646-9256668 AGGGATGGGGAGTGGATGGCTGG - Intronic
950198797 3:11028417-11028439 AGAGATATGTAGGGGATGGAGGG - Intronic
950638009 3:14329737-14329759 AGAGAGCTGGAGGGGATGCATGG - Intergenic
950923378 3:16716882-16716904 AGAACACTGGAGAGGGTGGCTGG + Intergenic
951122567 3:18945537-18945559 AGTTATCTGCAGAAGATGGCAGG - Intergenic
951384522 3:22027505-22027527 AGTTATCTGCAGAAGATGGCAGG - Intronic
951970766 3:28441895-28441917 AGTTATCTGCAGAAGATGGCAGG + Intronic
954054115 3:48007647-48007669 AGTTATCTGTAGAAGATGGCAGG - Intronic
954127993 3:48543485-48543507 AGGCATCTGGAGGGGAAGGCAGG - Intronic
955035581 3:55264062-55264084 AGTTATCTGCAGAGGATGGCAGG - Intergenic
956233666 3:67043243-67043265 AGAGATGTGGAGAGAAGGGGTGG + Intergenic
956306872 3:67835592-67835614 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956360449 3:68441408-68441430 AGTAATCTGCAGAAGATGGCAGG - Intronic
956509658 3:69980342-69980364 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956695941 3:71919574-71919596 AGAGAGCTGGAGAGAATGCCAGG + Intergenic
957247584 3:77733927-77733949 AGTTATCTGCAGAAGATGGCAGG + Intergenic
957754594 3:84469396-84469418 AGTTATCTGCAGAAGATGGCAGG - Intergenic
958123846 3:89329283-89329305 AGAAGTGTGGAGAGGATGGTGGG - Intronic
958177614 3:90016650-90016672 AGAGAGCTGGAGAGGCTGGTTGG - Intergenic
958487681 3:94732504-94732526 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959203655 3:103279275-103279297 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959590679 3:108076633-108076655 AGAGTTCTTGAGAGGATAACAGG + Intronic
959746017 3:109777303-109777325 AGTTATCTGCAGAAGATGGCAGG + Intergenic
960494749 3:118360810-118360832 AGTTATCTGAAGATGATGGCAGG + Intergenic
961060600 3:123825342-123825364 ATAGATCTGCAGAGGTTGGGTGG - Intronic
961355808 3:126339335-126339357 AGAGAGCTGGAAGGGATAGCGGG - Intergenic
961440992 3:126953086-126953108 AGAGCTGTTGAGAGGATGGCAGG - Intronic
961639545 3:128356517-128356539 AGATGTCAGGAGAGGATGGGAGG + Intronic
961787620 3:129357170-129357192 AGTGATGTGCAGAGGCTGGCAGG + Intergenic
963368670 3:144369532-144369554 AGTGCTCTGGTGGGGATGGCAGG - Intergenic
963805582 3:149718564-149718586 AGAGATCTGGAGATGGATGCTGG - Intronic
964030453 3:152132618-152132640 AGAGGTTAGCAGAGGATGGCTGG - Intergenic
964057978 3:152484763-152484785 AGATCTCTGGACAGGAGGGCTGG + Intergenic
964679249 3:159318944-159318966 AGTTATCTGCAGAAGATGGCAGG + Intronic
964724944 3:159804997-159805019 AGAAATCTGCTGAGGATGACTGG - Intronic
965708648 3:171534809-171534831 AGTTATCTGCAGAGGATGGCAGG + Intergenic
965893161 3:173540124-173540146 AGTCATCTGCAGAGGATGGCAGG + Intronic
966044333 3:175530951-175530973 AGTTATCTGCAGAAGATGGCAGG + Intronic
966445690 3:179998529-179998551 AGTTATCTGCAGAAGATGGCAGG - Intronic
967180883 3:186903102-186903124 AGACATGTGGAGAATATGGCTGG - Intergenic
969240956 4:5897189-5897211 AGAGATTTGAAGAGGAAGGAAGG + Intergenic
969464265 4:7345476-7345498 AGAGCACTGGAGAGGAAGCCAGG - Intronic
969516405 4:7650691-7650713 AGAGGGCTGGAGAGGGAGGCGGG - Intronic
969561131 4:7949103-7949125 AGGGAGTTGGAAAGGATGGCTGG - Intergenic
969602976 4:8188144-8188166 AGAGAGCTGGGGAGGCTGCCTGG - Intronic
969842337 4:9891773-9891795 AGAGATGTGGAGAGCTTGTCAGG + Intronic
970219500 4:13796349-13796371 GGAGATCTGCAGAGGATCCCTGG + Intergenic
970669857 4:18383887-18383909 AGAGTACTGGAGAGGAGGGAGGG + Intergenic
970870566 4:20812367-20812389 AGAAAGCTGAAGAGGATGGATGG + Intronic
971817226 4:31505045-31505067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
972201301 4:36717183-36717205 AGTTATCTGTAGAAGATGGCAGG + Intergenic
972771644 4:42202964-42202986 GGAAATCTGCAGAGGATGGATGG + Intergenic
972882965 4:43448184-43448206 AGTTATCTGCAGAAGATGGCAGG + Intergenic
973102922 4:46294720-46294742 AGTTATCTGCAGAAGATGGCAGG - Intronic
973118436 4:46489013-46489035 AGTTATCTGCAGAAGATGGCAGG - Intergenic
973305818 4:48648356-48648378 AGAGCTATGGAGAGCATGGTGGG - Intronic
973858347 4:55035693-55035715 GGAGATGAGGAGAGGAAGGCAGG - Intergenic
974070223 4:57116338-57116360 ACAGTTCTGGAGAGGAAGGAGGG + Intergenic
975024465 4:69531602-69531624 AGTTATCTGCAGAAGATGGCAGG - Intergenic
975748251 4:77495677-77495699 AGAGATGGGGAGAGGTTGGAAGG - Intergenic
975966646 4:79981096-79981118 AGAAATCTGGAGTGGATGATGGG - Intronic
976104880 4:81605974-81605996 AGAGATCTGGAGAGGATGGCTGG - Intronic
977266890 4:94866182-94866204 AGAGAGCTTGAGAAGATGGATGG - Intronic
977430763 4:96928182-96928204 AGGTATCTGCAGAAGATGGCAGG - Intergenic
977465998 4:97383344-97383366 AGTTATCTGCAGAAGATGGCAGG - Intronic
977626279 4:99192684-99192706 AGTTATCTGCAGAAGATGGCAGG + Intergenic
977930415 4:102743849-102743871 AGTTATCTGCAGAAGATGGCAGG + Intronic
978205509 4:106076098-106076120 ATAGCTCTGTAGAGGATGGCAGG + Intronic
978772155 4:112467810-112467832 AGTTATCTGCAGAAGATGGCAGG + Intergenic
979767017 4:124474565-124474587 AGTTATCTGTAGAAGATGGCAGG - Intergenic
980385790 4:132087061-132087083 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980405894 4:132353821-132353843 AGTTATCTGCAGAAGATGGCAGG + Intergenic
981764573 4:148233691-148233713 AGAGAGATGGAGGGAATGGCTGG + Intronic
982597778 4:157407056-157407078 AGTTATCTGCAGAAGATGGCAGG + Intergenic
982646047 4:158026544-158026566 AGAATTCTGGTGAGGTTGGCTGG - Intergenic
982724022 4:158886451-158886473 AGTGGTCTGGAGAGGGTGGCAGG + Intronic
983027387 4:162755265-162755287 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983185061 4:164691545-164691567 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983582673 4:169324782-169324804 AGTTATCTGCAGAAGATGGCAGG - Intergenic
984060287 4:174982054-174982076 AGTTATCTGCAGAAGATGGCAGG + Intergenic
984612325 4:181855816-181855838 AGAGAAAGGGAGAGGATGGAAGG + Intergenic
985990949 5:3560831-3560853 AGAGATGTGGGGAGGGAGGCAGG - Intergenic
986076838 5:4346731-4346753 AGTGATCTGGGGAGGAAGGCTGG + Intergenic
986421273 5:7586433-7586455 TGAGATCTGGAAAGGAAGACAGG - Intronic
986573418 5:9188822-9188844 AGTTATCTGGAGGGGATGGGAGG - Intronic
986742916 5:10719476-10719498 AGTTATCTGCAGAAGATGGCAGG - Intronic
987153171 5:15061636-15061658 AGTTATCTGCAGAAGATGGCAGG - Intergenic
987220900 5:15789646-15789668 AGAGAACTGGAGAGCCTTGCAGG - Intronic
987468192 5:18297014-18297036 AGTTATCTGCAGAAGATGGCAGG + Intergenic
987577066 5:19743575-19743597 AAAGATCTGCAGACAATGGCAGG - Intronic
987976588 5:25022484-25022506 AGAAATAGGGAGAGGAAGGCTGG + Intergenic
988056571 5:26105297-26105319 AGTTATCTGCAGAAGATGGCAGG + Intergenic
988099628 5:26660058-26660080 AGAGCTCCCAAGAGGATGGCGGG + Intergenic
988107755 5:26772517-26772539 AGTTATCTGCAGAAGATGGCAGG - Intergenic
988169205 5:27632867-27632889 AGCGATCTGCAGAAGATGGCAGG + Intergenic
988790119 5:34600125-34600147 AGAGATGTGGAGATAATGGCAGG - Intergenic
988950555 5:36254776-36254798 AGAGATCTGGGCAGGATGAATGG - Intronic
989097828 5:37797291-37797313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
989307506 5:39974650-39974672 AGCTATCTGAAGAAGATGGCAGG + Intergenic
989457647 5:41661797-41661819 AGTTATCTGCAGAAGATGGCGGG + Intergenic
990847573 5:60160784-60160806 AGAGATGTGGAGAGGAAGACAGG - Intronic
991946143 5:71900111-71900133 AGTTATCTGCAGAAGATGGCAGG - Intergenic
992242936 5:74789722-74789744 AGTTATCTGAAGAAGATGGCAGG - Intronic
992242952 5:74789838-74789860 AGTTATCTGCAGAAGATGGCAGG - Intronic
992600570 5:78394997-78395019 AGCGATTTGAAGAGGAAGGCTGG - Intronic
993367471 5:87050985-87051007 AGTTATCTGCAGAAGATGGCAGG + Intergenic
993780691 5:92062365-92062387 AGTTATCTGCAGAAGATGGCAGG - Intergenic
994855438 5:105113613-105113635 AGTTATCTGCAGAAGATGGCAGG + Intergenic
994984423 5:106915762-106915784 AGTTATCTGCAGAAGATGGCAGG + Intergenic
996392205 5:122973814-122973836 AGTTATCTGCAGATGATGGCAGG + Intronic
997351915 5:133236924-133236946 TGAGCTCTGCAGAGGAGGGCAGG + Intronic
997611681 5:135220079-135220101 AGGGATCCTGAGAGGCTGGCAGG + Intronic
998182874 5:139957480-139957502 AGAGGTCTGCAGAGGCTGGGAGG + Intronic
998206686 5:140162327-140162349 AGAGATCAGGAGAGGCAGCCTGG - Intergenic
999515091 5:152293620-152293642 AGAGATCGGGTGAGGATGGGAGG + Intergenic
1000029594 5:157390467-157390489 AGAGGTCGGGGGAGGAGGGCAGG - Intronic
1000223249 5:159234277-159234299 AGGTATCTGCAGAAGATGGCAGG + Intergenic
1001031344 5:168265591-168265613 CGAGCACAGGAGAGGATGGCAGG + Intergenic
1001173592 5:169444614-169444636 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1002214352 5:177619317-177619339 AGGGTTGTGGAGAGGTTGGCTGG - Intergenic
1002305869 5:178282511-178282533 AGACAGCTTGAGAGGCTGGCTGG + Intronic
1002382238 5:178839205-178839227 ACAGATCTGGAGGGGGTGGTGGG + Intergenic
1002498237 5:179630520-179630542 AGAGAGCTGGAAAGGATGCAGGG + Intronic
1002716660 5:181232348-181232370 TTAGATCTGGAGAGGAGGGAAGG + Intronic
1002997963 6:2304718-2304740 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1003405584 6:5824593-5824615 CAGCATCTGGAGAGGATGGCTGG - Intergenic
1003544792 6:7051006-7051028 AGAGCTCTGGGGAGGAAGGTTGG + Intergenic
1003695901 6:8406168-8406190 AGTCATCTGCAGAAGATGGCAGG + Intergenic
1004810580 6:19256626-19256648 AAAGATATGGAGAGGATACCAGG + Intergenic
1005185165 6:23157044-23157066 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1005308090 6:24533071-24533093 ACAGGTTTGGAGAGGATGGTTGG + Intronic
1006001553 6:30969047-30969069 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006062349 6:31433194-31433216 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006164405 6:32056184-32056206 GGAGATATAGAGAGGATGCCAGG + Intronic
1007705306 6:43787257-43787279 AAGGATCTGGTGAGGATGGGTGG + Intergenic
1007706360 6:43793750-43793772 TGAGATAGAGAGAGGATGGCAGG + Intergenic
1008079360 6:47178414-47178436 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1008131443 6:47724374-47724396 AGAAATGTGGAGAGGATGACAGG + Intergenic
1008266925 6:49439317-49439339 AGTTATCTGCAGAAGATGGCAGG + Intronic
1008400289 6:51055443-51055465 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1008649255 6:53546374-53546396 ACAGATCTGGTGAGGTTGGTGGG - Intronic
1009533225 6:64847241-64847263 ACAGAGATGGAGAGAATGGCAGG - Intronic
1009806492 6:68606924-68606946 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1009851928 6:69208986-69209008 AGTTATCTGCAGAAGATGGCAGG + Intronic
1010315823 6:74449025-74449047 TGAGATCTTGAGAGGAAGGTTGG - Intergenic
1011039347 6:83013302-83013324 AGTTATCTGCAGAAGATGGCAGG + Intronic
1012344585 6:98170291-98170313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1012394301 6:98778296-98778318 AGAGTCCTGAGGAGGATGGCTGG + Intergenic
1012730458 6:102874291-102874313 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1012820800 6:104082890-104082912 AGTTATCTGCAGAAGATGGCCGG - Intergenic
1012861419 6:104564418-104564440 AGTGATTTGGAGAGGATAGGTGG - Intergenic
1012920797 6:105219573-105219595 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1013406668 6:109849774-109849796 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1013611569 6:111800774-111800796 AGAGAACTGGAGATGTGGGCAGG - Intronic
1014534200 6:122596658-122596680 AGTTATCTGCAGAAGATGGCAGG + Intronic
1014882160 6:126736508-126736530 AGAGATGTGAAGAGGAAGGAAGG + Intergenic
1015080047 6:129212574-129212596 AGAGATCTGCAGTGGAAGTCAGG - Intronic
1015095453 6:129409629-129409651 AGTGATCTGCAGAAGATGGCAGG + Intronic
1015475746 6:133657463-133657485 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1015831550 6:137375452-137375474 AGAGCTGTGAAGAGGATGCCTGG + Intergenic
1016144287 6:140649374-140649396 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1017977121 6:159368085-159368107 AGTTATCTGCAGAAGATGGCTGG + Intergenic
1018803795 6:167243019-167243041 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1019454442 7:1118302-1118324 AAAGGTCTGCAGAGAATGGCAGG - Intronic
1019488287 7:1299398-1299420 AGAGGTCCGGAGAGGAGGGCTGG + Intergenic
1020710346 7:11597597-11597619 AGTTATCTGCAGAAGATGGCAGG - Intronic
1021491189 7:21221184-21221206 AGTGAGCTGGACTGGATGGCTGG + Intergenic
1021776204 7:24057722-24057744 AGAGGCCTGGAGAGCATGCCTGG - Intergenic
1021823152 7:24518182-24518204 AGACATCTGGAGAGGTAAGCTGG + Intergenic
1021928376 7:25554854-25554876 TAAGATGTGGAGAGGAAGGCAGG + Intergenic
1022393304 7:29961885-29961907 TGACATATGGAGATGATGGCTGG + Intronic
1022730043 7:33013727-33013749 AGAGATGTGGAGTGGGTAGCTGG + Intergenic
1023448776 7:40259150-40259172 AGAGGCCTGGGGAGGAGGGCAGG + Intronic
1023992058 7:45134348-45134370 AGAGGGCTGGGGAGGCTGGCAGG + Intergenic
1024040534 7:45550116-45550138 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1026232095 7:68493753-68493775 AGAGACCCAGAGAGGATGGCCGG - Intergenic
1026408413 7:70092982-70093004 AGAGATTTGGGGAGGAGGGGAGG - Intronic
1027357524 7:77372829-77372851 AGAAAGCTGGAGAGGCAGGCAGG - Intronic
1028582682 7:92423539-92423561 AGTCATCTGGAGAGGAAGGCTGG - Intergenic
1028689340 7:93633995-93634017 ATAGATGTGCAGAGGATGGGAGG - Intronic
1029442622 7:100595472-100595494 AGAGATCAGCTGGGGATGGCAGG + Intronic
1029851351 7:103464746-103464768 ATACAGCTGGAGAGGAAGGCAGG + Intergenic
1030099532 7:105933332-105933354 AGAGGCCTGGAGAGAATGTCAGG - Intronic
1030277455 7:107736085-107736107 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1032153107 7:129446987-129447009 AGTTATCTGCAGAAGATGGCAGG + Intronic
1032500105 7:132393699-132393721 AGGGAAGTGGAGAGGATGGTGGG + Intronic
1033248920 7:139741975-139741997 AGAGATCCAGAGAGACTGGCAGG + Intronic
1033754836 7:144389792-144389814 AGAGATGTGTAGAGTAGGGCAGG - Intergenic
1035185545 7:157123161-157123183 ACAGATCCTGAGAGGAGGGCAGG - Intergenic
1036008755 8:4696489-4696511 AGAGATCTGTAGAGGAAAACAGG + Intronic
1036597070 8:10223602-10223624 AGTGATTGGGAGAGAATGGCAGG + Intronic
1037319662 8:17631058-17631080 AGAGCTCTGGACAAGATGGCAGG - Intronic
1037364596 8:18108298-18108320 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1037659039 8:20911597-20911619 AGAGGTCAGCAGAGGATGACTGG - Intergenic
1038726505 8:30086917-30086939 AGAGATCGGGGGCGGGTGGCTGG - Intergenic
1042001067 8:64124026-64124048 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1042021429 8:64373956-64373978 AGGGATCTGAAGAGGAGGGAGGG + Intergenic
1042085615 8:65105668-65105690 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1042168216 8:65967207-65967229 AGAGAGCTGGAGAGGCTGCCAGG + Intergenic
1042885215 8:73541822-73541844 AGCAAACTGGAGAGGATGGAGGG + Intronic
1044150798 8:88773045-88773067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1044216204 8:89613718-89613740 TGAGATCTAGAGATGAAGGCAGG - Intergenic
1045221835 8:100207037-100207059 AGTTATCTGCAGAAGATGGCAGG - Intronic
1046540747 8:115579113-115579135 AGAGTTCTGGTGAGGATGAAAGG + Intronic
1047801314 8:128313564-128313586 AGAGATTTGGAGAGGATTCAAGG + Intergenic
1048373511 8:133801474-133801496 ACAGAGCTGGTGAGAATGGCAGG - Intergenic
1048937290 8:139367643-139367665 AGGGGTCTGGAGGGGCTGGCAGG - Intergenic
1050195943 9:3084902-3084924 CCAGATCTGGAGAAGAGGGCAGG + Intergenic
1050338571 9:4613395-4613417 AGAGAGCTGGAGTGGAGGCCTGG - Intronic
1050482671 9:6102573-6102595 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1051255702 9:15211039-15211061 AGAGATCTGGGGGGGATTTCGGG - Intronic
1051419942 9:16878817-16878839 AGAGATCGTTAGAGAATGGCTGG + Intergenic
1051882143 9:21850632-21850654 AGTTATCTGCAGAAGATGGCAGG - Intronic
1051923176 9:22291593-22291615 AGAAACCTGGAGAGGATTGAGGG + Intergenic
1052055802 9:23906098-23906120 AGAGAAGGGGAGAGGAAGGCAGG + Intergenic
1052847397 9:33349372-33349394 AGTAATGTGGAGAGGATGACAGG + Intronic
1053485974 9:38456573-38456595 AGAGGTCTGGGGAGGTGGGCGGG + Intergenic
1053496103 9:38549260-38549282 AGAGATCAGGAGAGTTTGGAGGG - Intronic
1054160706 9:61670557-61670579 CCACATCTGGAGAGGCTGGCAGG + Intergenic
1054969670 9:71070658-71070680 TGAGGTTTGGAGAGGATGACAGG + Intronic
1055301748 9:74889858-74889880 AGAGATCTGGGTAGGGTGGTTGG - Intergenic
1055863371 9:80782363-80782385 AGAAATCTGGACAGAATTGCAGG - Intergenic
1055903944 9:81271234-81271256 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1056095285 9:83246905-83246927 TGAGTTCTGGTGAGGCTGGCAGG - Exonic
1056263780 9:84875766-84875788 AGACATCAGGAGAGGAAGGAAGG - Intronic
1056353876 9:85778348-85778370 AGTTATCTGCAGAAGATGGCGGG + Intergenic
1056780382 9:89544602-89544624 TGTGATCTGGAGAGGGAGGCAGG - Intergenic
1057150529 9:92792339-92792361 GGTGATCTGGGGAAGATGGCCGG + Intergenic
1058019893 9:100076050-100076072 AGTTATCTGCAGAAGATGGCAGG - Intronic
1058045133 9:100350447-100350469 ATAAAGCTGGAGAGGATGGATGG - Intronic
1058259260 9:102809698-102809720 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1058803188 9:108564940-108564962 AGAGATGGGGAGATGAGGGCAGG + Intergenic
1059329144 9:113524190-113524212 GGGGGTATGGAGAGGATGGCAGG - Intronic
1059408389 9:114116560-114116582 ACAGAGCTGCAGAGGATGGATGG - Intergenic
1059822944 9:117994229-117994251 GGAGAGCTGGAGAGGAAGGAGGG - Intergenic
1060155073 9:121313900-121313922 AGAGAGATGGAGAGGAAGGGTGG - Intronic
1060268171 9:122124349-122124371 GGATGTCTGGAGAGGATGTCTGG - Intergenic
1061678038 9:132229390-132229412 AGAGACTTGGAGCGGATGGAGGG - Intronic
1061940662 9:133882143-133882165 AGAGCTCTGCAGGGCATGGCTGG - Intronic
1061999311 9:134207832-134207854 GGACAGCTGGAGAGGATGGGGGG - Intergenic
1062135467 9:134924993-134925015 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1186279492 X:7977088-7977110 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1186384097 X:9091792-9091814 AGTTATCTGCAGAAGATGGCAGG + Intronic
1187039575 X:15579511-15579533 AGTGAGCTGGAGAGGATAGTGGG + Intronic
1187604862 X:20871832-20871854 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1188673472 X:32909899-32909921 AAAGATATGGGGTGGATGGCAGG - Intronic
1189128594 X:38475011-38475033 AAAAGTCTGGAGAGGAAGGCAGG - Intronic
1190220743 X:48511048-48511070 GGGGAGCTGGAGAGGGTGGCAGG - Intronic
1191119759 X:56891055-56891077 AGGAATCTGGAGAGGAAGTCTGG - Intergenic
1191719244 X:64215740-64215762 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1191759358 X:64629893-64629915 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1191988762 X:67009910-67009932 AGAGCACTGGGGAGGCTGGCTGG - Intergenic
1192225488 X:69224508-69224530 AGAGAGCTTGAGAAGGTGGCAGG - Intergenic
1192297714 X:69868047-69868069 AGTTATCTGCAGAAGATGGCAGG + Intronic
1192531689 X:71893168-71893190 AGTTATCTGCAGAGGATGGTAGG + Intergenic
1192898700 X:75471878-75471900 AGTTATCTGCAGAAGATGGCAGG - Intronic
1192996189 X:76515546-76515568 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1193904483 X:87225799-87225821 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194179594 X:90695967-90695989 AGTTATCTGAAGAAGATGGCAGG + Intergenic
1194210275 X:91062322-91062344 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194520150 X:94908968-94908990 AGAGCTCTGGCGAGGGTGGCTGG - Intergenic
1194849249 X:98852206-98852228 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1195593933 X:106666347-106666369 AGAGACTTGGAAAGGCTGGCTGG - Intronic
1195682017 X:107554331-107554353 AGAGATCTGGAATCAATGGCTGG - Intronic
1196135972 X:112209875-112209897 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1196145014 X:112306933-112306955 AGAGATCCTGAGAGGAGGTCAGG - Intergenic
1197245049 X:124159026-124159048 AGTTATCTGCAGAAGATGGCAGG + Intronic
1197395573 X:125923040-125923062 AGAAATCTGGAGAGGCAGTCTGG + Intergenic
1198169999 X:134096222-134096244 AGTTATCTGTGGAGGATGGCAGG - Intergenic
1198429862 X:136554439-136554461 AGAAGTCTGGAGAGGTAGGCAGG + Intronic
1198727078 X:139689527-139689549 AGAGATTTGGAGAGGTAGGAGGG - Intronic
1199008504 X:142730855-142730877 AGTTATCTCCAGAGGATGGCAGG - Intergenic
1199040588 X:143111068-143111090 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1200526256 Y:4278136-4278158 AGTTATCTGAAGAAGATGGCAGG + Intergenic
1201234414 Y:11895694-11895716 AGAGATATGGAGAGAAGGGGTGG + Intergenic
1201849520 Y:18462665-18462687 CTAGATCTGGAGAGATTGGCAGG - Intergenic
1201883798 Y:18857710-18857732 CTAGATCTGGAGAGATTGGCAGG + Intergenic
1202164324 Y:21970227-21970249 CTAGATCTGGAGAGACTGGCAGG + Intergenic
1202227032 Y:22616145-22616167 CTAGATCTGGAGAGACTGGCAGG - Intergenic
1202316090 Y:23579509-23579531 CTAGATCTGGAGAGACTGGCAGG + Intergenic
1202554674 Y:26090557-26090579 CTAGATCTGGAGAGACTGGCAGG - Intergenic