ID: 976106048

View in Genome Browser
Species Human (GRCh38)
Location 4:81618623-81618645
Sequence CTTTGGAAGGCCAAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274879
Summary {0: 52, 1: 2206, 2: 28156, 3: 83347, 4: 161118}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976106048_976106053 -8 Left 976106048 4:81618623-81618645 CCTTCCACCTTGGCCTTCCAAAG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118
Right 976106053 4:81618638-81618660 TTCCAAAGTGCTGGTATTTCAGG 0: 2
1: 174
2: 14709
3: 325060
4: 262185
976106048_976106055 11 Left 976106048 4:81618623-81618645 CCTTCCACCTTGGCCTTCCAAAG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118
Right 976106055 4:81618657-81618679 CAGGCATGAGCCACTGTGCCTGG 0: 7444
1: 30963
2: 79445
3: 137491
4: 151300

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976106048 Original CRISPR CTTTGGAAGGCCAAGGTGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr