ID: 976106955

View in Genome Browser
Species Human (GRCh38)
Location 4:81629519-81629541
Sequence GTGAGGTTCTTGAGGACAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 220}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976106955_976106961 24 Left 976106955 4:81629519-81629541 CCCTTTGTCCTCAAGAACCTCAC 0: 1
1: 0
2: 2
3: 17
4: 220
Right 976106961 4:81629566-81629588 GGGTTATTATTACATAACTTTGG 0: 1
1: 0
2: 0
3: 7
4: 156
976106955_976106960 4 Left 976106955 4:81629519-81629541 CCCTTTGTCCTCAAGAACCTCAC 0: 1
1: 0
2: 2
3: 17
4: 220
Right 976106960 4:81629546-81629568 AGCGTGACAAACTAATTAATGGG 0: 1
1: 0
2: 0
3: 4
4: 89
976106955_976106959 3 Left 976106955 4:81629519-81629541 CCCTTTGTCCTCAAGAACCTCAC 0: 1
1: 0
2: 2
3: 17
4: 220
Right 976106959 4:81629545-81629567 TAGCGTGACAAACTAATTAATGG 0: 1
1: 0
2: 0
3: 5
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976106955 Original CRISPR GTGAGGTTCTTGAGGACAAA GGG (reversed) Intronic
902290879 1:15433859-15433881 GTGAGGTTCTAGACGACCCAAGG - Intergenic
902968836 1:20031989-20032011 GGGAGATTCTGGAGGATAAAGGG + Intronic
907113914 1:51951864-51951886 GTTAGGTCCTTGAGGGCAGAGGG + Intronic
907782939 1:57583743-57583765 GTGAGGCTCATGAGGGCAATTGG - Intronic
908138053 1:61153427-61153449 TTGAGGTCCTTGATGATAAAAGG - Intronic
908214437 1:61936373-61936395 GCTAGGTTCTTGAGGACAGTGGG - Intronic
908434981 1:64096877-64096899 GTGAGGTTGTGGAGAAAAAAAGG - Intronic
909272904 1:73646740-73646762 TTCAGGTTCTTGATGACAACTGG + Intergenic
911184448 1:94889064-94889086 GTTTGGTTCTTAAAGACAAAAGG - Intronic
911407120 1:97455916-97455938 CTGAAGTTCCTGATGACAAAAGG - Intronic
912801060 1:112719985-112720007 GAGAGGTTCTTAGGGAGAAATGG + Intergenic
914709921 1:150203769-150203791 GTGACTTGCTTGAGGACACAGGG - Intergenic
914877124 1:151520399-151520421 CTGAGCTTCTAGAGGATAAAAGG - Exonic
916691814 1:167197241-167197263 CTGAGGTTTTTGAAAACAAAGGG - Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
918917966 1:190669912-190669934 CTGAGGTGCTTGAAGGCAAAGGG - Intergenic
920540710 1:206775922-206775944 GTGAGCTTCTTGAGGCCAAAAGG + Intergenic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
922909323 1:229202392-229202414 GTGAGGCTCTTGACCACTAAGGG + Intergenic
923124432 1:231022909-231022931 GTAAGGTTCCTGAGAACAACTGG - Intronic
1063489239 10:6447937-6447959 GTTTGGTTTTTGAGGGCAAAAGG + Intronic
1065384076 10:25116497-25116519 GTGAGGATCTTGAGGTTATATGG + Intergenic
1065748378 10:28862667-28862689 GTCAGGTTCTTGGTCACAAAAGG - Intronic
1067140716 10:43654067-43654089 TTGAGGCTCTTTAGGACAGATGG + Intergenic
1077238071 11:1492805-1492827 GAGAGGTTCTGGAGGCCACACGG + Intronic
1077341686 11:2029078-2029100 GTGGGGCTCTTGGGGACAGAAGG - Intergenic
1077798799 11:5517989-5518011 GTGAGGTCCCTGGGGAGAAAAGG - Intronic
1078275810 11:9844979-9845001 GTGATGTACTTAAGGATAAAGGG + Intronic
1079017402 11:16881002-16881024 GTGAGGTTGGGGAGGACAACTGG - Intronic
1081537356 11:44005395-44005417 GGGAGGGTTCTGAGGACAAAGGG + Intergenic
1081667646 11:44925873-44925895 GTGAGGTGCTTGGGGTCAGAGGG + Intronic
1081725320 11:45323617-45323639 GTGACGTTCCTGAGCACCAAGGG - Intergenic
1082146376 11:48675241-48675263 GGGAGCTTATTGAGGTCAAAGGG + Intergenic
1082307346 11:50596513-50596535 GTGAGCTCATTGAGGCCAAAGGG + Intergenic
1082312333 11:50667065-50667087 GGGAGGTCCTTGAGGCCAAAGGG - Intergenic
1083010318 11:59391073-59391095 ATTATGTTTTTGAGGACAAACGG - Intergenic
1083206223 11:61150846-61150868 GTGAGGCTCTGGAGGGCAACTGG - Intronic
1085376468 11:76066963-76066985 GTTAGGTTCATGTGGATAAATGG - Intronic
1085684937 11:78612802-78612824 TTGAGGTGCTTGAAGGCAAAGGG + Intergenic
1086288731 11:85279845-85279867 GTGAGGCTCCAGAAGACAAAGGG - Intronic
1087051140 11:93887460-93887482 GTGAGATTTTTGAGGACAGGTGG - Intergenic
1202824672 11_KI270721v1_random:84267-84289 GTGGGGCTCTTGGGGACAGAAGG - Intergenic
1091526918 12:1312000-1312022 ATCATGTTCTTGAGGAAAAATGG - Intronic
1091778006 12:3197313-3197335 GTGAGGCTGCAGAGGACAAAAGG + Intronic
1092742737 12:11645977-11645999 GTGAAGTTCTTGAGGCCAAAGGG + Intergenic
1093084653 12:14853099-14853121 GTCAGGGTAGTGAGGACAAAAGG - Intronic
1093855054 12:24092118-24092140 CTGATGTTCTTGAGGTCAAATGG - Intergenic
1094224428 12:28029406-28029428 GTGAGCTTCTAGAGTACAAGAGG - Intergenic
1094374169 12:29772974-29772996 GAGAGATTCTTGAAGTCAAAGGG - Intronic
1094495669 12:30987864-30987886 GGGAGGTTCCAGAGGACAGAAGG + Intronic
1096579093 12:52573028-52573050 ATGAGTTTCTTGAGGACAGCTGG - Intronic
1097624431 12:61982661-61982683 GAGAGGTACTTGAGAACTAAAGG - Intronic
1099975969 12:89545773-89545795 GTGAGGTTCTTGTGCCCAAGGGG - Intergenic
1100388103 12:94122190-94122212 GTTAGGTACTTCTGGACAAATGG + Intergenic
1100687147 12:96998960-96998982 GTGTGGCTTTTGAGGACTAAAGG + Intergenic
1101052551 12:100878403-100878425 ATCAGGTACTTGAGGACAAATGG - Intronic
1101326931 12:103723841-103723863 GGGAGGTTCCTGTGGACCAAAGG + Intronic
1102227732 12:111240781-111240803 GTGAGGTTCCTGAAGACATTTGG + Intronic
1103593304 12:122007447-122007469 TTGAGGCTCTTGGGGCCAAAGGG + Intergenic
1106508160 13:30389834-30389856 GAAAGGTTCTAAAGGACAAAGGG - Intergenic
1109294688 13:60515002-60515024 GTGAGCTTCTTTGGGACAAGAGG - Intronic
1109644322 13:65233653-65233675 GTGAGGATGTGGAGAACAAAAGG - Intergenic
1111400631 13:87729698-87729720 CCAAGGTTCCTGAGGACAAAGGG + Intergenic
1112748576 13:102555407-102555429 GTGAGGTCTTTGAGAATAAAGGG + Intergenic
1112916618 13:104558867-104558889 GTGAGTTTGTTGAGGATAATAGG + Intergenic
1113139882 13:107135442-107135464 GTGATGTTATTAAGGACAGAAGG - Intergenic
1113231251 13:108215692-108215714 GTTAGGGTCTTGAGTACACACGG + Intronic
1116226294 14:42156943-42156965 TTTAAGTTCTGGAGGACAAAGGG - Intergenic
1118405518 14:65419770-65419792 CTGAAATTCTTGAGGCCAAAAGG + Intronic
1118839779 14:69501603-69501625 TTGAGATTCTGGAGGAGAAAGGG + Intronic
1119166576 14:72499731-72499753 GTGAGGATCTGGGGGACAAGTGG - Intronic
1121100842 14:91249083-91249105 CTGAGGTTCTAAATGACAAACGG + Intronic
1122037741 14:98960844-98960866 GTGAGCTTCCTGAGGACCCAGGG + Intergenic
1123711491 15:22990985-22991007 TTGAAGTTCTGGAGGACAGAAGG - Intronic
1123799663 15:23806731-23806753 GGGAGGATCTTGAGGAGGAAAGG - Intergenic
1126049505 15:44673464-44673486 GTGAAGTTCTTGAGGGGAAAAGG - Intronic
1127262514 15:57336708-57336730 GTGACTTTCTTGAGACCAAATGG + Intergenic
1128491106 15:68145833-68145855 GTGATCTTCTTGTGGACAACTGG - Exonic
1128831524 15:70773529-70773551 GTTAAGTCTTTGAGGACAAAGGG + Intergenic
1129541754 15:76355749-76355771 GTGAGGTTCAGGAGCCCAAATGG - Intronic
1130685761 15:86035953-86035975 GTGAGAGTCTTCAGGAAAAAAGG + Intergenic
1131648023 15:94367020-94367042 GTGGGTTTCTTTTGGACAAATGG - Intronic
1131697036 15:94889156-94889178 GGGAGGGGCTTGAGAACAAATGG - Intergenic
1138618642 16:58194102-58194124 GTGGCTTTCTTGAGGACAAGTGG - Intronic
1139662346 16:68429731-68429753 ATGAAGGACTTGAGGACAAAGGG + Intronic
1141964890 16:87435292-87435314 GCGTGGTTCTTCAGGACAACTGG - Intronic
1144708557 17:17385747-17385769 TTGAGGTCCTTGAGGTCAGAGGG - Intergenic
1147941744 17:44053504-44053526 GTGAGATTCTGGAGGGCAAGAGG + Intronic
1149442960 17:56690624-56690646 GTGGGATTCTTGAAGACAAAGGG + Intergenic
1150156538 17:62858427-62858449 GTGAGTTGCTTGATGACAGAAGG - Intergenic
1150633766 17:66898538-66898560 GACAGCTTCTTGAGGACAAAGGG - Intergenic
1151543386 17:74776703-74776725 GTGGGGTTCTTGAGAAAAGAGGG + Intronic
1155469099 18:26171934-26171956 CTGTGGGTCTTGAGGATAAAGGG - Intronic
1155886946 18:31219536-31219558 GTGAGTCTCTTGAAGACAGAAGG - Intergenic
1158674345 18:59504881-59504903 GTGACCTTCATGAGGCCAAATGG - Intronic
1159402062 18:67951561-67951583 GTGAGTTTTGTGAGGAAAAATGG + Intergenic
1160589766 18:79936979-79937001 GTGGGGTCCTTGAGGGCAGAAGG + Intronic
1162593182 19:11606552-11606574 CTGGGGTTCTTGAGGACGGATGG + Intronic
1163554162 19:17983152-17983174 CTGAGGCTCTGGGGGACAAAGGG + Intronic
1163749740 19:19069302-19069324 GTGAGGTTCTGGCAGGCAAATGG + Intronic
1165976771 19:39682914-39682936 GGGAGGTTCATTATGACAAAGGG - Intergenic
1167161038 19:47767169-47767191 TAGAGGGGCTTGAGGACAAAGGG - Intergenic
926554391 2:14340877-14340899 GTGTGGATCTGCAGGACAAAGGG - Intergenic
926731927 2:16041994-16042016 GAGAGGTTTTTGGGGAAAAAGGG + Intergenic
927374037 2:22392607-22392629 CTCAGGTTATAGAGGACAAAAGG - Intergenic
927705889 2:25296395-25296417 GTGAGGTTTCTGTGGCCAAAGGG + Intronic
928174672 2:29025676-29025698 GTGAGACTCTAGGGGACAAAAGG + Intronic
929862607 2:45692601-45692623 GGAAGCATCTTGAGGACAAATGG - Intronic
929897295 2:45973195-45973217 GGGAGGTTCTTGGGGACTGAGGG + Intronic
931650862 2:64467592-64467614 GTGAGGTTCATGAGGAAGCAGGG - Intergenic
932597171 2:73101242-73101264 GTGACAGTCTTGAGGACAAATGG + Intronic
933476019 2:82791405-82791427 GTGAGGTTCAGGAAGAAAAAAGG - Intergenic
934075391 2:88424042-88424064 GTGACATTTTTGAGGACAACAGG - Intergenic
934102450 2:88666109-88666131 GTGAGCTTTTTGAGGGCCAAAGG - Intergenic
935543746 2:104378822-104378844 GAGGGGTACTTGAGGGCAAATGG - Intergenic
935616008 2:105082621-105082643 GGGAGGTTTTTGAGGAAAAATGG + Intronic
936582542 2:113715902-113715924 GTGAGGTTTTGGAGAACAAGTGG - Intronic
939450294 2:142364901-142364923 GTGAAGATCTGGAGGAGAAATGG + Intergenic
941208930 2:162610940-162610962 GTTAGGTTAATGAGGACAGAAGG + Intronic
941369458 2:164646237-164646259 GTAACTTTCTTGAGGAAAAAGGG + Intergenic
942301858 2:174570727-174570749 ATGAGGTTCCTGAGGTCACAGGG + Intronic
943795558 2:191988590-191988612 CTGACTTTCTAGAGGACAAATGG + Intronic
944828635 2:203510367-203510389 TTGAGGTTCTTGAGGGTAATAGG + Intronic
945874173 2:215260505-215260527 GTGAGCTCCTTGGGAACAAAGGG + Intergenic
947876764 2:233472800-233472822 GTAAGGTGTTTGGGGACAAATGG + Intergenic
948275326 2:236704040-236704062 GCGAGGTTCATGGGGACAAGGGG - Intergenic
948764707 2:240213460-240213482 CTGAGGTTTTACAGGACAAAAGG + Intergenic
1172500201 20:35420679-35420701 TTGAAGATTTTGAGGACAAAAGG + Intergenic
1176944121 21:14957791-14957813 ATGAGGTGCTTGAAGACATAGGG + Intergenic
1177828147 21:26106769-26106791 TTGAGGTCATTGAAGACAAAAGG - Intronic
1178829284 21:36041631-36041653 TTGATGTTGTGGAGGACAAAAGG - Intronic
1179086389 21:38221529-38221551 GAGATGTTCCTGAGGACACAGGG + Intronic
1179454130 21:41486895-41486917 GTGAGGTTGTAGAAGAGAAATGG + Intronic
1182404345 22:30111563-30111585 CTGAGGTACTTGAGTACACATGG + Intronic
1183498270 22:38162911-38162933 CTGAGGCTCTGGAGGACACACGG + Intronic
1184554612 22:45226376-45226398 ATGAGGTCCTAGGGGACAAAGGG + Intronic
1184712909 22:46263392-46263414 GTGAGGGTCTTGGGGACAGTGGG + Intergenic
1184829794 22:46977416-46977438 CTGAGCTTCTTGGGGACAGAGGG - Intronic
949395827 3:3613973-3613995 ATGAGGTTATAGAGGGCAAAGGG + Intergenic
950079819 3:10213375-10213397 CTGAGCTTCTTGAAGACGAATGG - Exonic
951805956 3:26643640-26643662 GTGATCTTCTGGAGGACACAAGG + Intronic
952058759 3:29481353-29481375 GTTAGGTTCTAGAAGGCAAATGG + Intronic
952268745 3:31811828-31811850 GAGAGGTCTTTGTGGACAAATGG + Intronic
953085690 3:39664520-39664542 ATGACTTTCTTGAGGACACATGG - Intergenic
953228333 3:41041562-41041584 GTGAGGTTATTAAGGACTTAGGG + Intergenic
953981410 3:47414985-47415007 CTGGGGTCCCTGAGGACAAAAGG + Exonic
960127604 3:114017466-114017488 GTGAGTTCTTTGAGGACAAGGGG + Intronic
963528488 3:146444654-146444676 GTGTGTTTCTTGAGGGCAACAGG + Intronic
963950017 3:151189260-151189282 GTGAGGTTCTTTGAGACAAAGGG + Intronic
964305035 3:155330515-155330537 GGGAGGATATTGAGGACAACAGG + Intergenic
966282106 3:178243620-178243642 TTGAGGTTCTGAAGGCCAAAAGG - Intergenic
967959946 3:194912503-194912525 GTGAGGGTCTTTAGGGCTAAGGG - Intergenic
968402600 4:311589-311611 TTTGTGTTCTTGAGGACAAAGGG + Intergenic
968772197 4:2514557-2514579 GTAAGGTTCCTGAGAACAACTGG - Exonic
969435624 4:7187663-7187685 GTGTGGTTCTTGAAGCCAAGAGG + Intergenic
969922844 4:10557237-10557259 GGGAGGTTCTGGAGGGCAAATGG - Intronic
970550918 4:17180321-17180343 GTAAGATTCTTGAGGAACAAGGG + Intergenic
971734006 4:30422377-30422399 GTGAGGTTTTTGTGTACAGATGG - Intergenic
972097194 4:35363357-35363379 TTGGTGTTCTTGAGGAAAAAGGG - Intergenic
972564933 4:40261087-40261109 GAGAGGTTTTTAAGGAAAAAAGG + Intergenic
973636239 4:52863597-52863619 GAGAGGTTCTTGACTACAAAGGG - Intronic
974154418 4:58052659-58052681 GTGAGGTTCTTGAGAATCTAGGG + Intergenic
975912446 4:79282993-79283015 GAGAGGCTTTTGAGGACAGAAGG + Intronic
976106955 4:81629519-81629541 GTGAGGTTCTTGAGGACAAAGGG - Intronic
978127095 4:105147400-105147422 CTGAGGTTGTTCAGGATAAACGG - Intronic
985385000 4:189436292-189436314 GTCAGCTTTTTGAGGACAATAGG - Intergenic
985987709 5:3531287-3531309 GCGAGGTTATTCAGTACAAATGG - Intergenic
986245287 5:6001404-6001426 GTGAGCTCCTTGAGGACGAGGGG + Intergenic
989542293 5:42631444-42631466 GTGAGGCTCGTGATGATAAAAGG - Intronic
990895840 5:60699726-60699748 GTTAGATTCCAGAGGACAAAAGG + Intronic
991038343 5:62150568-62150590 TGGAGTTTCTTGAGGATAAATGG - Intergenic
991267063 5:64732136-64732158 GAGAAGTTTTTCAGGACAAATGG - Intronic
991609594 5:68436536-68436558 GAAAGGTTCTTCAGGACAGAGGG + Intergenic
991729765 5:69573974-69573996 GTGAGGATCTACAGGACCAAGGG - Intronic
991806197 5:70429114-70429136 GTGAGGATCTACAGGACCAAGGG - Intergenic
991865189 5:71053900-71053922 GTGAGGATCTACAGGACCAAGGG + Intronic
993683659 5:90911206-90911228 GTGAAGTTCTTCAGGAAAAGGGG + Intronic
994539789 5:101079819-101079841 GTGAGGTCCTTGAGGTCATAGGG - Intergenic
997696324 5:135863941-135863963 GAGAGATTCTTGAGGGCAAGTGG + Intronic
998391548 5:141790065-141790087 ATGAGGTTCCTGAGGACCTAGGG + Intergenic
1001971089 5:175955499-175955521 GGGATGTCCTTGAGGACCAAAGG - Intronic
1002246354 5:177888278-177888300 GGGATGTCCTTGAGGACCAAAGG + Intergenic
1002438897 5:179253770-179253792 GTGAGGAGCCTGAGGCCAAAGGG - Intronic
1004028567 6:11843377-11843399 GTGAAGATCTTGGGGACAGATGG - Intergenic
1005255760 6:24001403-24001425 AGGTGCTTCTTGAGGACAAATGG + Intergenic
1005525135 6:26639985-26640007 GTGATGTCCTTGTGAACAAAGGG - Intronic
1006812028 6:36826304-36826326 GTGAGGGTCTTGAGGTCACCAGG - Intronic
1007395228 6:41573958-41573980 ATGAGGTTCAAGAGGCCAAATGG + Intronic
1007976815 6:46110189-46110211 GTGAGAATGTGGAGGACAAAAGG - Intergenic
1009720723 6:67465896-67465918 GTGGGGTTATTGAGAAAAAAAGG + Intergenic
1009777542 6:68224098-68224120 ATGAGGTTCTTTAGGAGAGAGGG + Intergenic
1014906161 6:127030925-127030947 GTTAGGTTCTTCAAGATAAAAGG + Intergenic
1015925084 6:138300759-138300781 GTCAGGATCTTGAGGCAAAAGGG + Intronic
1017463365 6:154672178-154672200 GTGAGTTGCTAGAGGACCAAGGG - Intergenic
1018567637 6:165172319-165172341 GTGAAGATCTTCAGGAAAAATGG - Intergenic
1020077834 7:5270245-5270267 ATGAAGTTCATGAAGACAAACGG - Intergenic
1022205735 7:28161781-28161803 GTGAGATTCTTGGGGAATAAAGG - Intronic
1023070043 7:36420794-36420816 GTGAGCTCTGTGAGGACAAAGGG + Intronic
1024365544 7:48516347-48516369 GTGAGGATATGCAGGACAAAGGG - Intronic
1028318798 7:89435969-89435991 GAGAGATTCTGGAGGATAAAGGG - Intergenic
1029102937 7:98148947-98148969 GTGAGATTTTGGAGGAGAAAGGG - Intronic
1030985168 7:116232963-116232985 GTCATTTTCTTTAGGACAAAAGG + Intronic
1032112747 7:129090866-129090888 GTGAGGTTGTTGAAGAGAAGTGG + Intergenic
1034237366 7:149582750-149582772 TTGACATTCCTGAGGACAAAAGG - Intergenic
1034517533 7:151592247-151592269 GTGTGGCTCTTGAGGACAGTGGG + Intronic
1034657558 7:152741566-152741588 GTGACCTCCTTGAGGACAACTGG - Intergenic
1036209282 8:6828911-6828933 ATGAGGTTCTTGAGACTAAAGGG - Intronic
1037833226 8:22201225-22201247 GTGAGGTTCCTGAGTAACAAGGG - Intronic
1038219077 8:25590431-25590453 GTAAGTTTCTTGAGGGCCAAGGG - Intergenic
1038272305 8:26085191-26085213 TTGATGTTCTTGAGGACTAGTGG - Intergenic
1038958388 8:32491811-32491833 TTGAGGTTTGTGAGGCCAAAGGG + Intronic
1042160772 8:65892181-65892203 GTGAGTCTCTTAAGGACAACAGG - Intergenic
1042786613 8:72554203-72554225 GTGGGTTTCTTGAGAGCAAAGGG + Intronic
1046411495 8:113849218-113849240 GTGAGGTTGTGGGGGAAAAAAGG - Intergenic
1048399415 8:134050292-134050314 GTAAGTTCCTTGAGGACAGAGGG - Intergenic
1048400622 8:134065519-134065541 GGGGGGGTCTTGAGGACACATGG - Intergenic
1049220138 8:141425313-141425335 GTGACTTTCTTGAGGTCACACGG - Intronic
1049702515 8:144021605-144021627 GTGAGGTTCTTCTGGACAGAGGG - Intronic
1049702722 8:144022452-144022474 GTGAGGTTCTTCTGGACAGAGGG - Intronic
1055095388 9:72408275-72408297 CTGAGTTTCTTGAAGACAATGGG + Intergenic
1055251059 9:74306095-74306117 GTTAGGTCCATGAGGACATAAGG - Intergenic
1056201597 9:84282248-84282270 GTGGGGTTGTTGACTACAAATGG + Intronic
1057565788 9:96164828-96164850 ATGACGTTCTTGAGAAGAAAAGG - Intergenic
1057715548 9:97492455-97492477 GTGTGGTTTTTGAAGTCAAAAGG + Intronic
1058409453 9:104715188-104715210 GTGAGATTGTTGAGGAGAAAGGG - Intergenic
1059983532 9:119799084-119799106 TTGAGGATCTTCAGCACAAAAGG + Intergenic
1186323463 X:8454046-8454068 GTGAGATGCTTGAGCAGAAAAGG - Intergenic
1190528391 X:51350763-51350785 CTGAGGTTCCTGAGGACACCTGG - Intergenic
1191714261 X:64183526-64183548 GTGAGTTTCTTGATGATAAAAGG + Intergenic
1192183821 X:68932491-68932513 GTGAGGTGCCTGAGGTCACATGG - Intergenic
1192766471 X:74145672-74145694 CTGAGGTTGTTTAGGATAAATGG + Intergenic
1194215137 X:91121975-91121997 GTGAGTTTCTTTACAACAAATGG + Intergenic
1195405524 X:104508980-104509002 GTGATGTGCTTAAGGACACAGGG + Intergenic
1195827479 X:109018022-109018044 GTGATGGTCTTAAGGAAAAAGGG - Intergenic
1196410461 X:115412898-115412920 GTGAAGTTCTTGCTGACAAATGG + Intergenic
1198137696 X:133770673-133770695 GTTAGGAGCTTGGGGACAAATGG - Intronic
1198623672 X:138543449-138543471 GTGAGCTTCTTGAGGGCCTATGG + Intergenic
1199074804 X:143514970-143514992 GGGAGATTCTGGAGGATAAAAGG - Intronic
1199093805 X:143718246-143718268 GGGAGATTCTGGAGGATAAATGG - Intronic
1199722127 X:150549532-150549554 GTGAAGTCCTTGAGTGCAAAGGG + Intergenic