ID: 976111285

View in Genome Browser
Species Human (GRCh38)
Location 4:81676669-81676691
Sequence GCCTTTCCTTTCTTACAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 223}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976111285_976111286 -8 Left 976111285 4:81676669-81676691 CCAGGCTGTAAGAAAGGAAAGGC 0: 1
1: 0
2: 0
3: 22
4: 223
Right 976111286 4:81676684-81676706 GGAAAGGCTGAAGCCTAATGCGG 0: 1
1: 0
2: 1
3: 11
4: 169
976111285_976111288 7 Left 976111285 4:81676669-81676691 CCAGGCTGTAAGAAAGGAAAGGC 0: 1
1: 0
2: 0
3: 22
4: 223
Right 976111288 4:81676699-81676721 TAATGCGGAACTGCTGCAGTAGG 0: 1
1: 0
2: 1
3: 3
4: 48
976111285_976111289 8 Left 976111285 4:81676669-81676691 CCAGGCTGTAAGAAAGGAAAGGC 0: 1
1: 0
2: 0
3: 22
4: 223
Right 976111289 4:81676700-81676722 AATGCGGAACTGCTGCAGTAGGG 0: 1
1: 0
2: 0
3: 6
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976111285 Original CRISPR GCCTTTCCTTTCTTACAGCC TGG (reversed) Intronic
900760562 1:4467451-4467473 GCCTTTCCCTTCCTCCAGCCAGG - Intergenic
901026121 1:6279593-6279615 CACTTTCCTTCCTTTCAGCCTGG + Intronic
902112639 1:14095539-14095561 GCCTTTCATGTCTTCCAACCTGG - Intergenic
902662844 1:17917414-17917436 GCCTTTCCACTCCTTCAGCCTGG + Intergenic
903872796 1:26449007-26449029 GCCTCTCCTTCCTAACAGCTGGG + Intronic
906648542 1:47493497-47493519 GCCTCTGCTTTCTCACAGTCAGG - Intergenic
906688605 1:47778325-47778347 GCCTTTCCATTCTTGCTTCCTGG + Intronic
908089305 1:60669678-60669700 GCCCTTCCTGTCTGACAGTCCGG - Intergenic
909864457 1:80649846-80649868 GCCTTTTCTTTCTTATTTCCAGG + Intergenic
910746846 1:90583457-90583479 CCCTTTCCTGTCTGACAGCCTGG - Intergenic
912484821 1:110017928-110017950 TCCTTTCTTTTCTTCCAGCATGG + Exonic
915259680 1:154667888-154667910 GTCTTTACTTTCTTTCAGTCTGG + Intergenic
917980962 1:180268776-180268798 GCCCTGCCTTGCTCACAGCCAGG - Intronic
920118190 1:203636105-203636127 GAATTTCTTCTCTTACAGCCTGG - Intronic
920564605 1:206963593-206963615 CCCTTTCCTTTCTCCCAGCTGGG + Intronic
920630998 1:207651470-207651492 GCATTTCTTTTCTTACTCCCTGG - Intronic
921786673 1:219239092-219239114 CCCTCTCCTTTCTGATAGCCAGG + Intergenic
922660818 1:227429076-227429098 GCCTTTGTTTTGTTCCAGCCAGG - Intergenic
923771801 1:236943869-236943891 TCCTTTCCTTTGATACAGCCAGG - Intergenic
924624806 1:245688998-245689020 GCCTCTCCTTTCCCACGGCCCGG + Intronic
1064857153 10:19782237-19782259 GCCTTCCCTTTCTTGAAGCTAGG - Intronic
1067533471 10:47091514-47091536 GCATTTCATTCCTTGCAGCCAGG - Intergenic
1067714548 10:48679588-48679610 CCCTTTCCTTTTTTACAGGCTGG + Intergenic
1068968330 10:62936085-62936107 CCCTTCCCTTTCTTCCTGCCTGG - Intergenic
1069035440 10:63641884-63641906 GCCGTCCCTTTATTCCAGCCAGG - Intergenic
1069223657 10:65914225-65914247 GGCTTTCCTTTCCTACAGTTGGG + Exonic
1069560533 10:69426315-69426337 GCCTTTCTTCTCTTGCTGCCAGG + Intergenic
1069590711 10:69640053-69640075 GCCTGTCCTTACTCAGAGCCTGG + Intergenic
1070861351 10:79666356-79666378 TCCTTTCCTTTTCTACACCCTGG + Intergenic
1072657168 10:97337804-97337826 GCTTTTCTCTACTTACAGCCAGG - Intergenic
1073133914 10:101208931-101208953 GCCTTTCTTTTCTCAAAACCTGG + Intergenic
1073650456 10:105352942-105352964 GCCTTTCCTTCCTCCCAGCTCGG + Intergenic
1074068253 10:110038354-110038376 GTCTCTCCTTCCTTACAGGCTGG - Intronic
1075231118 10:120679302-120679324 GAATTTTCTTTCTTTCAGCCTGG + Intergenic
1076923211 10:133466219-133466241 ACCTCTCCTTTCTCAGAGCCTGG + Intergenic
1078174679 11:8961198-8961220 GCCTTTTCTTTTTTAAAGTCAGG + Intronic
1081313224 11:41599194-41599216 CCCTTTCCCTTCCTCCAGCCTGG - Intergenic
1081766956 11:45618055-45618077 GCTTTTCCCTGCTCACAGCCAGG + Intergenic
1082784186 11:57307881-57307903 GCCTGTCCTGTCTTGAAGCCTGG - Intronic
1083154221 11:60812705-60812727 CCCTCTCCTTTTTTTCAGCCAGG - Intergenic
1083365587 11:62139870-62139892 GCCTTGCCTATCATAGAGCCAGG + Intronic
1083642985 11:64155496-64155518 GCCTTCCCTTGCTAACACCCAGG + Intronic
1084537287 11:69764601-69764623 GCCTGTCCTTTCTTCCGTCCAGG - Intergenic
1084553840 11:69864411-69864433 GCCTTTCCTCCCCCACAGCCTGG - Intergenic
1084603320 11:70159216-70159238 CCCTTCCCCTTCTTCCAGCCTGG - Intronic
1085188671 11:74598713-74598735 GCCTGGGCTTTCTCACAGCCTGG + Intronic
1088992410 11:114965123-114965145 GGCTCTCCTTTCTTCTAGCCTGG - Intergenic
1089134103 11:116235497-116235519 GCCTTTCCTCTCTTAGCGCATGG - Intergenic
1091397347 12:162097-162119 TCCTTTCCTTTCTTTCTTCCTGG + Intronic
1091480007 12:818173-818195 GCATTTCCCTTCCTCCAGCCAGG + Intronic
1092192921 12:6533576-6533598 GCCTTTCATTCCATCCAGCCTGG - Intergenic
1093029854 12:14278267-14278289 GCCTTTTCTTCCTAACAGCTTGG - Intergenic
1093271949 12:17074272-17074294 CATTTTCCTTTCTTACAGGCTGG + Intergenic
1093442570 12:19216102-19216124 GCCTCTTCTTTCTGACAGCATGG - Intronic
1094867757 12:34558610-34558632 ACCTTTCCTTTCATTCAGCAAGG - Intergenic
1097257727 12:57693329-57693351 CCTTTCCCTTTCTTACGGCCTGG + Intergenic
1097527216 12:60752022-60752044 GCCTTTGCCTTCTTACATCAAGG - Intergenic
1099305942 12:80956081-80956103 GCCTTTCCTGTCATACTTCCTGG + Intronic
1101198308 12:102408368-102408390 GCCTTTCCTCTCTGGCAGCCAGG + Intronic
1102515832 12:113446027-113446049 ACCCATCCTTTCTTACAGCTGGG - Intergenic
1102936393 12:116900823-116900845 TCATCTCCTTTCATACAGCCTGG - Intergenic
1104093523 12:125535867-125535889 GCCTTTGGTTTCTTGCTGCCTGG - Intronic
1106069714 13:26398012-26398034 ACCTTTCCTTTATTGCAACCAGG + Intronic
1107246001 13:38294737-38294759 TCCTTTCCTTTCTTACAAATTGG - Intergenic
1107246487 13:38302605-38302627 GCCTATCCCTTTTTACAGCTGGG + Intergenic
1112934997 13:104786083-104786105 GCCTTTCCTTTCTTACATTATGG + Intergenic
1114069564 14:19096771-19096793 GCCTTGCCTTTTTCTCAGCCTGG - Intergenic
1114092698 14:19303232-19303254 GCCTTGCCTTTATCTCAGCCTGG + Intergenic
1114322564 14:21559366-21559388 GCCTTTCTTTTTTTAAAGACAGG + Intergenic
1114645223 14:24252374-24252396 CCCTTTCCTTACTTCCAGGCAGG + Intronic
1115283382 14:31690143-31690165 GCCCTTCCTGTCTTAAATCCTGG - Intronic
1115309636 14:31966233-31966255 GCCTTGTCCTTCTTACACCCGGG + Intergenic
1116069696 14:40027849-40027871 GCATTTATTTTCTTACAGTCTGG + Intergenic
1117158100 14:52960745-52960767 ATCCTTCCTTTCTTACATCCTGG - Intergenic
1119218079 14:72884582-72884604 GCCTGTCCTTCCAAACAGCCAGG - Intronic
1119260952 14:73237788-73237810 GCATTTCCTTTCCTCCAGGCCGG - Intronic
1120634183 14:86930873-86930895 GCTTTCCCTTCCTTACAGCTAGG - Intergenic
1121250003 14:92492473-92492495 GCATTTCCTTTCTTGCTGCCTGG + Intronic
1122310475 14:100791289-100791311 GCCTTTCCCTCTTTAGAGCCTGG - Intergenic
1122809383 14:104280590-104280612 GCCTTCTCTATCTTACAGGCAGG - Intergenic
1124711231 15:32014066-32014088 GCTTTTCCTGTTTTACAGCCTGG - Intergenic
1124716913 15:32072396-32072418 GCTTTTTCTTTCACACAGCCAGG - Intronic
1124851491 15:33343098-33343120 GCTTTTCCTTTTTTACAGTGGGG - Intronic
1126885788 15:53148205-53148227 GACTTTTTTTTCTTACACCCAGG - Intergenic
1127653494 15:61033017-61033039 GCCTTTCCTGTTTTACAGAGCGG + Intronic
1127995464 15:64151316-64151338 GCCTTTCCCTCCTTTCAGCCTGG - Intergenic
1129513399 15:76141133-76141155 GCCTTCCCTTTCTAACATCGTGG + Intronic
1130892458 15:88144829-88144851 GCCCTTCCATTCTTACAGCAAGG + Intronic
1132948494 16:2546659-2546681 GCTTTTCCTTCCTGACAGCGGGG + Intronic
1133978375 16:10616645-10616667 GCCCTTCCTTTCTTGAAGACTGG - Intergenic
1134033793 16:11014194-11014216 TCTTTTCCTTTCTTACATACAGG + Intronic
1137054210 16:35735654-35735676 GCCCTGCTTTTCTTACAGACTGG - Intergenic
1137580934 16:49633029-49633051 GCCTTTCCCTTCCTGCAGCCAGG + Intronic
1137970161 16:52976721-52976743 GGCTTTGCCCTCTTACAGCCAGG - Intergenic
1138339030 16:56276505-56276527 GCCTTTCCTCTTTTACACCAAGG + Intronic
1138482272 16:57311383-57311405 GCCTTTCCTGACCTCCAGCCTGG + Intergenic
1141536012 16:84680227-84680249 GCCTTTCCCTAATAACAGCCTGG - Intergenic
1146071336 17:29684666-29684688 TACTTTCCAGTCTTACAGCCTGG + Exonic
1148634320 17:49135757-49135779 GATTTTCCTTTTTTAGAGCCAGG - Intronic
1150318598 17:64190723-64190745 GCCTTTCCTGACCTGCAGCCTGG + Intronic
1150445549 17:65224984-65225006 TCCTTTCCTTCTCTACAGCCGGG + Exonic
1150847569 17:68675364-68675386 GACTTGCTTTTCTTACAGCCTGG + Intergenic
1152370106 17:79881891-79881913 GACTTTCATTTCTTACATTCAGG + Intergenic
1154248630 18:12723148-12723170 GCCTTTCCTTCCTTAGAACTCGG + Intronic
1155732952 18:29184533-29184555 TTCTTGCCTTTTTTACAGCCTGG - Intergenic
1161474573 19:4477134-4477156 GCCTCTCCTTTGTTTCGGCCTGG + Intronic
1163834699 19:19566103-19566125 GCCTCTGCTTTCTTACAGCAGGG - Intronic
1165067118 19:33235851-33235873 GCCTGGCCTTTCTCACAGCTCGG + Intergenic
1165400675 19:35597724-35597746 GCCTTTGCACTCCTACAGCCTGG + Intergenic
1165522260 19:36323889-36323911 GCCTTGACTTCCTTACAGCCTGG - Intergenic
1165621835 19:37254626-37254648 GCCTTGACTTCCTTACAGCCTGG + Intergenic
1165633420 19:37320765-37320787 GCCTTGACTTCCTTACAGCCTGG + Intronic
1166058953 19:40312614-40312636 GCCTGTGCTTCCTTACAGCATGG - Intergenic
1167620525 19:50557548-50557570 GCTTTTCCTGGCTTCCAGCCAGG - Intronic
1167668867 19:50838606-50838628 GCCTCTCCTTTCTCAGACCCAGG - Intergenic
1168467611 19:56616799-56616821 ACCTTTCCTTTGTCAGAGCCTGG + Intronic
925269736 2:2595272-2595294 TCCTTTTTTTTCTTACAGTCTGG - Intergenic
926723389 2:15979348-15979370 TTCTTTCCCTTTTTACAGCCTGG + Intergenic
928332465 2:30368268-30368290 GACTTTCCTTCCTTTCAGCATGG + Intergenic
930703097 2:54479048-54479070 ACCTTTACTTTCCTTCAGCCTGG - Intronic
931195771 2:60051216-60051238 GGCTTTCCTTTTTTCCTGCCTGG + Intergenic
936389181 2:112055889-112055911 GCCTTTTGTCTGTTACAGCCGGG + Intronic
938077919 2:128350412-128350434 GCCTTTCCTTTCCTACTGCTTGG - Intergenic
938142263 2:128805092-128805114 GCTTTTCCATTTTTTCAGCCTGG + Intergenic
938701786 2:133886022-133886044 TCCTTTCCTTCCTCCCAGCCAGG + Intergenic
939706096 2:145455897-145455919 TCCCTTCCTTTCTTGCATCCTGG + Intergenic
940625121 2:156165501-156165523 GCCTTTCCATGCTTCCAGACTGG + Intergenic
941193556 2:162417927-162417949 GCCTTTCCTATTTTACACCAAGG - Intronic
942591509 2:177552181-177552203 GCCTGACCTTTCCTACAACCTGG - Exonic
942598635 2:177618119-177618141 GCCTGACCTTTCCTACAACCTGG - Exonic
944079918 2:195776113-195776135 GCTTTCACTTTCTTTCAGCCTGG + Intronic
947747221 2:232514634-232514656 TCCTTTCCTTTTTTTCAGTCTGG - Intergenic
948188216 2:236038125-236038147 GCCTTTCATTCCATACACCCTGG + Intronic
948267457 2:236645495-236645517 GCTTTTCCTTTCTCACAGAAAGG + Intergenic
948609845 2:239159811-239159833 ACCTTTCATTTCCTGCAGCCTGG + Intronic
948779864 2:240312381-240312403 GGCTTTAGTTTCTTACAGCTAGG - Intergenic
948845199 2:240679792-240679814 GCCCCTCCTTTCTTATATCCTGG - Intronic
948848661 2:240695087-240695109 GCCCCTCCTTTCTTATATCCTGG + Intronic
1170017927 20:11802943-11802965 TCCTTTCCTTTGTTAGAGCCAGG - Intergenic
1171294514 20:24005732-24005754 GCCTGGGCTTTCTTACAGCACGG + Intergenic
1172291191 20:33778253-33778275 ACCTTCCCTTTCTTGCTGCCTGG + Intronic
1174744423 20:53047435-53047457 GCTTTTCCTTTCTTGCTGGCTGG - Intronic
1174776031 20:53343792-53343814 GTCTTCCCTTTCTAACAGGCTGG + Intronic
1178087843 21:29130652-29130674 TCCTTGCCTCTCTAACAGCCAGG - Intronic
1178121280 21:29472926-29472948 GGCTTTCTTTTCTTTCAACCGGG + Intronic
1178906688 21:36642595-36642617 GCCTTCCCCTGCTTCCAGCCAGG + Intergenic
1179151162 21:38809495-38809517 GTGTGTGCTTTCTTACAGCCTGG + Intronic
1180488031 22:15819334-15819356 GCCTTGCCTTTATCTCAGCCTGG - Intergenic
1181429271 22:22868068-22868090 GTCTTGCCTCACTTACAGCCCGG - Intronic
1181574753 22:23786773-23786795 GCTTTCCCAGTCTTACAGCCAGG - Intergenic
1181917850 22:26295024-26295046 GCTTTTCCTTTCTTACTGTATGG - Intronic
1182962386 22:34488063-34488085 GCTTTTCCTTTCTGACTCCCTGG - Intergenic
1183190893 22:36321556-36321578 GGCTTTCCTTATTTACAGGCAGG - Intronic
1184437744 22:44489815-44489837 TACTTTCCTTTCTTACAGAATGG - Intergenic
949478788 3:4473564-4473586 GGCTTTCCATTTTTACATCCAGG + Intergenic
949478794 3:4473618-4473640 GGCTTTCCATTTTTACATCCAGG + Intergenic
949561923 3:5210962-5210984 GGCTCTCCTTTTTTATAGCCTGG - Intronic
950775452 3:15346069-15346091 GCTTTTGGTTTCTTACAGCATGG + Intergenic
954862782 3:53704225-53704247 CCCTTACCTTTCTTCAAGCCTGG + Intronic
956296206 3:67716427-67716449 GCCTTTACTAGCCTACAGCCTGG + Intergenic
956792284 3:72689385-72689407 TTATTTCCTTTCTTACAGACTGG + Intergenic
957997368 3:87707553-87707575 AAATTTCTTTTCTTACAGCCTGG + Intergenic
961723184 3:128909275-128909297 CCCTGTCCTGTCTCACAGCCCGG - Intronic
967136950 3:186520654-186520676 TCATTTCCTTTCTTCAAGCCTGG - Intergenic
967477562 3:189939323-189939345 CCCTTTCCTTTCTTAGACCTTGG - Intergenic
967535649 3:190599500-190599522 TCCTTTCCTTTCTTACTCCTTGG + Intronic
969076175 4:4579477-4579499 TCCTTTCCTGTCTCACCGCCTGG + Intergenic
969842000 4:9889509-9889531 GCAGTTCCTTCCTGACAGCCAGG - Intronic
970417831 4:15876419-15876441 TCATTTCCTTTCTTCCAGGCTGG - Intergenic
972558697 4:40206193-40206215 TCTTTTCCTTTCTTTCAGGCAGG + Intronic
974163686 4:58172502-58172524 ACCTTTCTTTTTTTACAGCAAGG - Intergenic
976111285 4:81676669-81676691 GCCTTTCCTTTCTTACAGCCTGG - Intronic
976350476 4:84054607-84054629 GTCTTTCTTTCCTTACAGTCTGG + Intergenic
978077330 4:104548984-104549006 GCCTTTCCTTCCTTCCACCCTGG - Intergenic
978401786 4:108338809-108338831 TCCTTGTCTCTCTTACAGCCGGG - Intergenic
980095396 4:128484780-128484802 GCCTTTCCTCTCTGACTGCCAGG - Intergenic
980206941 4:129732230-129732252 GACTTTCCTTTCCTTCAGACTGG - Intergenic
980392045 4:132159444-132159466 TTTTTTCCTTTCTTACAGCAGGG + Intergenic
981112273 4:140949213-140949235 TCCTTTCCTCTCTTCCACCCTGG + Intronic
981561614 4:146054500-146054522 GGCTTTGCTTTCTTCCAGCATGG + Intergenic
983896122 4:173084055-173084077 TCGTTTTCTTTCTAACAGCCAGG + Intergenic
986475950 5:8132720-8132742 CCCTTTTCTTTCTTACTGCATGG - Intergenic
987122368 5:14779142-14779164 GCCTTTCCTTTGTGACAGGAGGG - Intronic
989001915 5:36770257-36770279 TCCTTTCCTTTCTTCTGGCCTGG - Intergenic
992868015 5:80977189-80977211 GCCTGTCCTTTGTTATAGCACGG + Intronic
993755562 5:91725080-91725102 CTCTTTACTTTCTTACAGGCTGG + Intergenic
994965655 5:106667697-106667719 ACCCTTCCTTTCTTACTGTCTGG - Intergenic
998662868 5:144260026-144260048 GCCTTTCATTTCATGCAGACTGG - Intronic
1000013936 5:157260750-157260772 TCCTTTCCTGTCTTAAATCCTGG + Intergenic
1001094182 5:168763267-168763289 GTCTTCCCAATCTTACAGCCAGG - Intronic
1002679759 5:180951921-180951943 GCCTTTCTTGTCTTTCACCCTGG - Intergenic
1004316680 6:14594165-14594187 GCCTTTTCTTTCTTAAATCAGGG - Intergenic
1004355098 6:14923705-14923727 GACCTTCCTTTCCCACAGCCAGG + Intergenic
1007248036 6:40476407-40476429 GCCCTGCCTTTCTTACAGTGAGG - Intronic
1007476857 6:42124758-42124780 TCCTTTGCTTTCTTTCAGCAGGG - Intronic
1010290183 6:74127101-74127123 GCCTTTCCTTGATTACAGTATGG - Intergenic
1011273573 6:85604855-85604877 ATCCTTCCTTTCTTACAGTCAGG - Intronic
1012207630 6:96480181-96480203 GCCTTTCCTGTCTTAGGCCCTGG + Intergenic
1018654366 6:166019602-166019624 GGCTTTCCTTTCTCTCTGCCTGG - Intergenic
1020113457 7:5461269-5461291 GCATTTTCTTCCTTCCAGCCAGG + Intronic
1020690282 7:11346491-11346513 GCCTTGCCTTTCTTACCAGCTGG - Intergenic
1022813759 7:33894404-33894426 GGCTTTCCTTTCTTCCCTCCAGG - Intergenic
1024578638 7:50784072-50784094 GGCTTTCTTTTCTCACAGTCCGG + Intronic
1024823977 7:53367559-53367581 GCCATGTCTTTCTTGCAGCCAGG + Intergenic
1026400699 7:70010014-70010036 GCTTTATCTTTCTTACTGCCTGG + Intronic
1026591951 7:71704104-71704126 GTCTTTGCTTTCACACAGCCAGG - Intronic
1027054405 7:75040093-75040115 GTCTTTTCTTTCTTCCAGCTGGG - Intronic
1027130433 7:75586594-75586616 GGCTTTCCTCTCTCACAGCTTGG + Intronic
1027622450 7:80506064-80506086 ACCTTTCCTTTCTAACAGTATGG + Intronic
1028267292 7:88741999-88742021 GCTATTCCTATCTTACAGCCTGG + Intergenic
1032336212 7:131027370-131027392 CCCTGTCCTTTCTTACAATCTGG + Intergenic
1032970082 7:137151086-137151108 ACCTTTCCTTTCCTAAAGACAGG + Intergenic
1033718738 7:144033794-144033816 AGCTTTACTTTCTCACAGCCAGG + Intergenic
1037849934 8:22319122-22319144 GCCTTTCATTTCTTAGGGTCAGG + Intronic
1039329152 8:36517556-36517578 GCCTTGCCATTCTTATAGCAAGG - Intergenic
1039554984 8:38468783-38468805 GCCCTTCTCTTCCTACAGCCTGG + Intronic
1040905665 8:52467519-52467541 GCGGTTCTTTTCTAACAGCCTGG + Intergenic
1043449114 8:80349081-80349103 GCCTTTCTTGTCTTTCAGCATGG - Intergenic
1047533016 8:125694381-125694403 TCTTCTCCTTTCTTGCAGCCAGG - Intergenic
1048060292 8:130912455-130912477 GCCTTACATTCCTCACAGCCTGG + Intronic
1048297780 8:133227393-133227415 TCCTTTCCTTTCCTTCAGGCAGG + Exonic
1048865732 8:138760287-138760309 GCCTTTTCTTTCTTTCCTCCAGG - Exonic
1049171663 8:141165205-141165227 TCCATTCTTTTCTTAAAGCCCGG + Exonic
1050073606 9:1841306-1841328 GTCTTTTCTTTCTTCCAGCTGGG - Intergenic
1050146798 9:2576751-2576773 TCCTTTCCTCTCTTATATCCTGG - Intergenic
1054839137 9:69716869-69716891 ACCTTTCCTTTCTTACTTCAGGG - Intronic
1055435249 9:76286457-76286479 GTCCTTTCTTTCATACAGCCAGG + Intronic
1056016301 9:82391698-82391720 TCCTTTCCTTCCTTATTGCCTGG + Intergenic
1056607345 9:88097213-88097235 GCCTTTCCTTGCTCAGCGCCCGG + Intergenic
1057367863 9:94440644-94440666 TCTTTTCCTTACTTACAGCTAGG + Intronic
1057442587 9:95092589-95092611 GCCTGTAATTTCTTTCAGCCTGG + Intergenic
1057548270 9:96034093-96034115 GGATGTCCTTTCTTTCAGCCTGG - Intergenic
1058904620 9:109471922-109471944 GCCTGTCTATGCTTACAGCCAGG + Intronic
1058952597 9:109917433-109917455 GCCTTTCCTTCCTTCCTGCCAGG - Intronic
1060782387 9:126422330-126422352 ACCTCTCATTTCTCACAGCCAGG + Intronic
1061798219 9:133100743-133100765 GCCCCTCCTTTCTTACCTCCAGG - Intronic
1061945338 9:133905580-133905602 GCCCTTCCTTCCTGCCAGCCTGG + Intronic
1062261710 9:135666185-135666207 GGATTTACTTTCTCACAGCCTGG + Intronic
1187031675 X:15494119-15494141 GTCTTTCCTTTCTCAAAACCAGG - Intronic
1187357154 X:18587106-18587128 GGCTTTCCCTTCTTAAAGCTTGG + Intronic
1188237935 X:27752033-27752055 GACTTTCTTTTCTTCCAGGCAGG - Intergenic
1193792796 X:85836587-85836609 ACCTTACCTTTTTCACAGCCAGG + Intergenic
1193998431 X:88395527-88395549 GCTTTTCCCTTCTTTCTGCCTGG - Intergenic
1194073044 X:89350981-89351003 GCCTGTCTTTTCTCACTGCCTGG + Intergenic
1197897481 X:131330751-131330773 CACTTTCCTTCCTTAGAGCCTGG + Intronic
1201283148 Y:12358185-12358207 GCCTTTCCTTTCTGGCTTCCTGG + Intergenic