ID: 976112296

View in Genome Browser
Species Human (GRCh38)
Location 4:81688929-81688951
Sequence GTTCTTGTGGTGTTCAGCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976112296_976112304 4 Left 976112296 4:81688929-81688951 CCATAGCTGAACACCACAAGAAC No data
Right 976112304 4:81688956-81688978 GCAGTGGTAGAGGTGATGGTGGG 0: 1
1: 1
2: 3
3: 57
4: 363
976112296_976112305 5 Left 976112296 4:81688929-81688951 CCATAGCTGAACACCACAAGAAC No data
Right 976112305 4:81688957-81688979 CAGTGGTAGAGGTGATGGTGGGG 0: 1
1: 0
2: 1
3: 62
4: 423
976112296_976112308 18 Left 976112296 4:81688929-81688951 CCATAGCTGAACACCACAAGAAC No data
Right 976112308 4:81688970-81688992 GATGGTGGGGATAAGGCTGCGGG No data
976112296_976112306 11 Left 976112296 4:81688929-81688951 CCATAGCTGAACACCACAAGAAC No data
Right 976112306 4:81688963-81688985 TAGAGGTGATGGTGGGGATAAGG No data
976112296_976112302 0 Left 976112296 4:81688929-81688951 CCATAGCTGAACACCACAAGAAC No data
Right 976112302 4:81688952-81688974 GGGAGCAGTGGTAGAGGTGATGG 0: 1
1: 1
2: 3
3: 49
4: 625
976112296_976112301 -6 Left 976112296 4:81688929-81688951 CCATAGCTGAACACCACAAGAAC No data
Right 976112301 4:81688946-81688968 AAGAACGGGAGCAGTGGTAGAGG No data
976112296_976112307 17 Left 976112296 4:81688929-81688951 CCATAGCTGAACACCACAAGAAC No data
Right 976112307 4:81688969-81688991 TGATGGTGGGGATAAGGCTGCGG 0: 1
1: 1
2: 2
3: 40
4: 525
976112296_976112303 3 Left 976112296 4:81688929-81688951 CCATAGCTGAACACCACAAGAAC No data
Right 976112303 4:81688955-81688977 AGCAGTGGTAGAGGTGATGGTGG 0: 1
1: 0
2: 7
3: 109
4: 825

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976112296 Original CRISPR GTTCTTGTGGTGTTCAGCTA TGG (reversed) Intronic