ID: 976112301

View in Genome Browser
Species Human (GRCh38)
Location 4:81688946-81688968
Sequence AAGAACGGGAGCAGTGGTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976112296_976112301 -6 Left 976112296 4:81688929-81688951 CCATAGCTGAACACCACAAGAAC No data
Right 976112301 4:81688946-81688968 AAGAACGGGAGCAGTGGTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976112301 Original CRISPR AAGAACGGGAGCAGTGGTAG AGG Intronic