ID: 976112302 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:81688952-81688974 |
| Sequence | GGGAGCAGTGGTAGAGGTGA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 679 | |||
| Summary | {0: 1, 1: 1, 2: 3, 3: 49, 4: 625} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 976112296_976112302 | 0 | Left | 976112296 | 4:81688929-81688951 | CCATAGCTGAACACCACAAGAAC | No data | ||
| Right | 976112302 | 4:81688952-81688974 | GGGAGCAGTGGTAGAGGTGATGG | 0: 1 1: 1 2: 3 3: 49 4: 625 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 976112302 | Original CRISPR | GGGAGCAGTGGTAGAGGTGA TGG | Intronic | ||