ID: 976112302

View in Genome Browser
Species Human (GRCh38)
Location 4:81688952-81688974
Sequence GGGAGCAGTGGTAGAGGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 679
Summary {0: 1, 1: 1, 2: 3, 3: 49, 4: 625}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976112296_976112302 0 Left 976112296 4:81688929-81688951 CCATAGCTGAACACCACAAGAAC No data
Right 976112302 4:81688952-81688974 GGGAGCAGTGGTAGAGGTGATGG 0: 1
1: 1
2: 3
3: 49
4: 625

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976112302 Original CRISPR GGGAGCAGTGGTAGAGGTGA TGG Intronic