ID: 976112303

View in Genome Browser
Species Human (GRCh38)
Location 4:81688955-81688977
Sequence AGCAGTGGTAGAGGTGATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 942
Summary {0: 1, 1: 0, 2: 7, 3: 109, 4: 825}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976112296_976112303 3 Left 976112296 4:81688929-81688951 CCATAGCTGAACACCACAAGAAC No data
Right 976112303 4:81688955-81688977 AGCAGTGGTAGAGGTGATGGTGG 0: 1
1: 0
2: 7
3: 109
4: 825
976112300_976112303 -10 Left 976112300 4:81688942-81688964 CCACAAGAACGGGAGCAGTGGTA No data
Right 976112303 4:81688955-81688977 AGCAGTGGTAGAGGTGATGGTGG 0: 1
1: 0
2: 7
3: 109
4: 825

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976112303 Original CRISPR AGCAGTGGTAGAGGTGATGG TGG Intronic