ID: 976112304

View in Genome Browser
Species Human (GRCh38)
Location 4:81688956-81688978
Sequence GCAGTGGTAGAGGTGATGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 425
Summary {0: 1, 1: 1, 2: 3, 3: 57, 4: 363}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976112296_976112304 4 Left 976112296 4:81688929-81688951 CCATAGCTGAACACCACAAGAAC No data
Right 976112304 4:81688956-81688978 GCAGTGGTAGAGGTGATGGTGGG 0: 1
1: 1
2: 3
3: 57
4: 363
976112300_976112304 -9 Left 976112300 4:81688942-81688964 CCACAAGAACGGGAGCAGTGGTA No data
Right 976112304 4:81688956-81688978 GCAGTGGTAGAGGTGATGGTGGG 0: 1
1: 1
2: 3
3: 57
4: 363

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976112304 Original CRISPR GCAGTGGTAGAGGTGATGGT GGG Intronic