ID: 976112305

View in Genome Browser
Species Human (GRCh38)
Location 4:81688957-81688979
Sequence CAGTGGTAGAGGTGATGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 487
Summary {0: 1, 1: 0, 2: 1, 3: 62, 4: 423}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976112296_976112305 5 Left 976112296 4:81688929-81688951 CCATAGCTGAACACCACAAGAAC No data
Right 976112305 4:81688957-81688979 CAGTGGTAGAGGTGATGGTGGGG 0: 1
1: 0
2: 1
3: 62
4: 423
976112300_976112305 -8 Left 976112300 4:81688942-81688964 CCACAAGAACGGGAGCAGTGGTA No data
Right 976112305 4:81688957-81688979 CAGTGGTAGAGGTGATGGTGGGG 0: 1
1: 0
2: 1
3: 62
4: 423

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976112305 Original CRISPR CAGTGGTAGAGGTGATGGTG GGG Intronic