ID: 976112307

View in Genome Browser
Species Human (GRCh38)
Location 4:81688969-81688991
Sequence TGATGGTGGGGATAAGGCTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 569
Summary {0: 1, 1: 1, 2: 2, 3: 40, 4: 525}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976112296_976112307 17 Left 976112296 4:81688929-81688951 CCATAGCTGAACACCACAAGAAC No data
Right 976112307 4:81688969-81688991 TGATGGTGGGGATAAGGCTGCGG 0: 1
1: 1
2: 2
3: 40
4: 525
976112300_976112307 4 Left 976112300 4:81688942-81688964 CCACAAGAACGGGAGCAGTGGTA No data
Right 976112307 4:81688969-81688991 TGATGGTGGGGATAAGGCTGCGG 0: 1
1: 1
2: 2
3: 40
4: 525

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976112307 Original CRISPR TGATGGTGGGGATAAGGCTG CGG Intronic