ID: 976112308

View in Genome Browser
Species Human (GRCh38)
Location 4:81688970-81688992
Sequence GATGGTGGGGATAAGGCTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976112300_976112308 5 Left 976112300 4:81688942-81688964 CCACAAGAACGGGAGCAGTGGTA No data
Right 976112308 4:81688970-81688992 GATGGTGGGGATAAGGCTGCGGG No data
976112296_976112308 18 Left 976112296 4:81688929-81688951 CCATAGCTGAACACCACAAGAAC No data
Right 976112308 4:81688970-81688992 GATGGTGGGGATAAGGCTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976112308 Original CRISPR GATGGTGGGGATAAGGCTGC GGG Intronic