ID: 976113510

View in Genome Browser
Species Human (GRCh38)
Location 4:81701874-81701896
Sequence AGAGAAAGTGTATGAATAAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 722
Summary {0: 1, 1: 0, 2: 4, 3: 66, 4: 651}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976113510_976113513 7 Left 976113510 4:81701874-81701896 CCGTTTATTCATACACTTTCTCT 0: 1
1: 0
2: 4
3: 66
4: 651
Right 976113513 4:81701904-81701926 GGATAATAATTGCACCTATCAGG 0: 1
1: 0
2: 1
3: 23
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976113510 Original CRISPR AGAGAAAGTGTATGAATAAA CGG (reversed) Intronic
903101024 1:21029704-21029726 AGAGAAAGTGAAGGCAGAAAGGG + Intronic
903276801 1:22227131-22227153 AGAGTAAGTGAATGAATGAATGG + Intergenic
903798903 1:25951872-25951894 ATACAAGGTGTATGAATGAATGG + Intergenic
904556448 1:31367995-31368017 AGAAAAGGTGTAGGAATACAGGG - Intronic
904924282 1:34034047-34034069 AGAGAGAGTATATGAATATGGGG - Intronic
906030106 1:42712422-42712444 TGAGAAACTTTATGAATACATGG - Intergenic
906412013 1:45586057-45586079 AGAGAAAGTTTATGTATATGTGG + Intronic
906439002 1:45824102-45824124 ATAGGAAGGGTATGAATAAAAGG + Intronic
906650933 1:47512150-47512172 AGAGTAAATGGATGAATGAATGG - Intergenic
906660250 1:47576878-47576900 TGAGAATGTGTATAAACAAATGG + Intergenic
907515097 1:54988689-54988711 AGAGTAAGTAGATGAATAAACGG - Intronic
907661610 1:56398205-56398227 TGAGTCAGTGAATGAATAAATGG + Intergenic
908506055 1:64801541-64801563 AGAGCAAGTTTATTAAGAAAGGG + Intronic
908623671 1:66015158-66015180 AGAGAAAATGAATGCATAAATGG - Intronic
908812310 1:67995423-67995445 AGTGTTAGTGTATGAAGAAAAGG + Intergenic
908863902 1:68523925-68523947 AGAGAAAGAGCAAGAATGAAAGG + Intergenic
908966628 1:69772875-69772897 ACAGAAAGTGTTTGAAAAAGAGG + Intronic
909194845 1:72606188-72606210 AGACAAAATGTAGGAAAAAATGG + Intergenic
909255193 1:73411320-73411342 TGAGAAAGTTCATGATTAAAAGG - Intergenic
909594382 1:77389341-77389363 AAAGAAAGTGGATGAATCAATGG + Intronic
909768064 1:79382980-79383002 AGAGAAAGAGAATGGAGAAAAGG - Intergenic
909791530 1:79685061-79685083 AGATGATGTCTATGAATAAAGGG + Intergenic
910030557 1:82716486-82716508 GGACAAAGTGTATGAACTAATGG - Intergenic
910056071 1:83034268-83034290 AGAAAAAGTTTACGAATAAATGG + Intergenic
910122126 1:83801821-83801843 AAAGAAAGAATATGAATCAAAGG + Intergenic
911013011 1:93301606-93301628 AGAGTATGTGTGTGTATAAAAGG + Intergenic
911262671 1:95705057-95705079 TTAGCAAGTGTATGAAGAAAAGG - Intergenic
911306075 1:96233855-96233877 AGAGGAAATGTATGAAGAAAAGG + Intergenic
911335839 1:96578944-96578966 AGAGAAAGAGAGGGAATAAAAGG - Intergenic
911470727 1:98314938-98314960 AGAACAAGTGGATGAATAAAAGG + Intergenic
911679603 1:100699827-100699849 AAAAAAAGTGTATGAAACAATGG - Intergenic
911825126 1:102473698-102473720 AGAAAGAGTATATTAATAAAGGG - Intergenic
911853852 1:102853453-102853475 AGAGAAAGTGCATGAAGAAAGGG - Intergenic
912188892 1:107314575-107314597 GGAGAAAGTGTAGGGATAAAAGG - Intronic
913358025 1:117945418-117945440 AGAAAAAGCTTATGGATAAATGG - Intronic
913409830 1:118539019-118539041 AGAGAAACATTATGACTAAAAGG - Intergenic
914214205 1:145609732-145609754 AGTGAAAGTCTATGATTATAAGG - Intronic
914256495 1:145964256-145964278 AGAGGCAGTGTATGATTGAAAGG + Exonic
914371481 1:147028981-147029003 AGTGAAAGTGTATGAATGCTTGG + Intergenic
914448884 1:147773404-147773426 AGAGAAAGAGTAGGAAGAAGTGG - Intergenic
914466145 1:147930134-147930156 AGTGAAAGTCTATGATTATAAGG - Intronic
914715092 1:150248031-150248053 AAAAAGAGTGTATGAACAAAGGG - Intergenic
915739253 1:158106008-158106030 AGAGAAAGGGTTTGAAGAATCGG - Intergenic
916036283 1:160925405-160925427 AGGGAAAGAGAATCAATAAATGG + Intergenic
916220201 1:162436148-162436170 AGAAAATTTGAATGAATAAAAGG - Intergenic
917474566 1:175357646-175357668 AGATAAAGTGAAAGAAGAAAAGG - Intronic
917493427 1:175518071-175518093 AGAAGAAGTGAATGAATGAAGGG - Intronic
917715233 1:177728907-177728929 AGAGAAAGTTTAGAAATAATAGG + Intergenic
917777872 1:178357556-178357578 AAAGTAAGTACATGAATAAAAGG - Intronic
918076387 1:181174422-181174444 AAAAAAAGTGAAGGAATAAAAGG - Intergenic
918598111 1:186317337-186317359 AGAGAAATTTTATTATTAAAAGG - Intronic
918797068 1:188914096-188914118 ATAGAAAATGCATAAATAAATGG + Intergenic
918901124 1:190419623-190419645 AGAGAAAATGTATGAGAAACTGG - Intronic
919314777 1:195957693-195957715 AAAAAAAGTCTATGTATAAATGG + Intergenic
919422954 1:197393867-197393889 AGTGAATGTATAGGAATAAAAGG + Intronic
919456382 1:197825087-197825109 AAAGAAAATGTATGAATTCAGGG - Intergenic
919605757 1:199681406-199681428 AGAGAAAGTCTAACACTAAATGG + Intergenic
919876050 1:201869470-201869492 AGAGAAAGCTTATTAATGAAAGG - Intronic
920443502 1:205998040-205998062 AGAGCTAGTGTTTGAATCAAAGG + Intronic
920507028 1:206522553-206522575 GGAGAAAGTGTAAAAGTAAATGG - Intronic
921707297 1:218338159-218338181 AGGAAAAGGGTATGAATTAAGGG - Intergenic
922076614 1:222251398-222251420 AAAGAAACTGTGAGAATAAATGG + Intergenic
923403100 1:233634478-233634500 CCAGAAAATGTATCAATAAATGG + Intronic
923811516 1:237322989-237323011 TGAATAAATGTATGAATAAATGG - Intronic
924076035 1:240338164-240338186 AGAGAGAGTGTGTGAGTACAGGG - Intronic
924105023 1:240640941-240640963 AGAGAGAGAGTATGAATTATGGG - Intergenic
924817856 1:247458286-247458308 AGAGAAAATGGATCAATAATGGG + Intergenic
1063014900 10:2066159-2066181 AAAGAAAATGTGTGAATTAATGG + Intergenic
1063114225 10:3062643-3062665 TGAGTGAGTGTATGAGTAAAGGG - Intergenic
1063131453 10:3181274-3181296 AGAAAAAATGTAGGAAAAAAGGG - Intergenic
1063428499 10:5967647-5967669 AGAGAGAGTGGATGAACCAATGG + Intronic
1064541752 10:16412758-16412780 AGAGAAAGAGAAAGAAAAAAAGG + Intergenic
1064880827 10:20051527-20051549 AGAGAAAGAGTATTAAAAATAGG - Intronic
1064927119 10:20581748-20581770 AGAGAAATTCTATGCAGAAAAGG + Intergenic
1064945857 10:20788895-20788917 AGAGACAGTGAATGAATCAATGG - Intronic
1065900988 10:30207778-30207800 AAAGACAGTGTAAGAATGAATGG - Intergenic
1065947752 10:30622694-30622716 ATAGAAAGTATATAAATGAATGG - Intronic
1066629017 10:37440302-37440324 AGAGAAACAGAATGAACAAATGG + Intergenic
1067457596 10:46431752-46431774 AAAGATAGTCTTTGAATAAATGG - Intergenic
1067629603 10:47952882-47952904 AAAGATAGTCTTTGAATAAATGG + Intergenic
1068304174 10:55182331-55182353 AGAGAAAGTCTGTGTATTAATGG - Intronic
1068359504 10:55957802-55957824 AGAGAAAATTGATAAATAAATGG - Intergenic
1068556964 10:58468911-58468933 GGAGAAAGTGTAGAAATAAATGG + Intergenic
1068788957 10:61006937-61006959 AAAGAAACTGTATCAATTAATGG - Intergenic
1069983968 10:72271414-72271436 GGAGACAGTGAATGAAAAAAAGG + Intergenic
1071128008 10:82358233-82358255 GGAGAAAGTGAAAGAATAATTGG + Intronic
1071331663 10:84566543-84566565 TGAGAAAGTAAAGGAATAAATGG - Intergenic
1071376286 10:85008088-85008110 AGAGAAACTGTGTGTATTAAGGG - Intergenic
1071419936 10:85483266-85483288 AGAGAAAATAAATCAATAAATGG - Intergenic
1071662604 10:87519491-87519513 AGGGAAAAAGGATGAATAAACGG - Intronic
1071921367 10:90354586-90354608 TGAATAAGTGAATGAATAAATGG + Intergenic
1072006322 10:91252935-91252957 GGAAAAAGTGAATGGATAAAAGG - Intronic
1072057946 10:91779232-91779254 AGAGAAAGTGAAGGAATGATTGG - Intergenic
1072165943 10:92813226-92813248 AGAGTAAATGAATGAATGAATGG - Intergenic
1072219131 10:93312937-93312959 GGAGTAAGTCTATGGATAAAGGG + Intronic
1073226312 10:101923176-101923198 AGAGACAGTTTAAGAAGAAAAGG + Intronic
1073235382 10:102010564-102010586 AGAGCAAGTGAATAAGTAAATGG + Intronic
1073910660 10:108339786-108339808 AGAGAAAGTTTATAAAAATATGG + Intergenic
1074052175 10:109889949-109889971 GGAGAAACTGTATTAATAAGTGG - Intronic
1074053240 10:109899010-109899032 ATTGAAACTGAATGAATAAATGG + Intronic
1074521730 10:114231585-114231607 AGAGAAAGTGGACAAAGAAAAGG - Exonic
1074675152 10:115840036-115840058 AGAAATATTTTATGAATAAATGG - Intronic
1075019455 10:118940373-118940395 TGAGCAAATGGATGAATAAATGG + Intergenic
1075156707 10:119983582-119983604 TGAGATAGTGTATCAAAAAATGG + Intergenic
1075221005 10:120584476-120584498 AGTGCATGTGTATGAATGAATGG + Intronic
1075897242 10:126007350-126007372 AGAGAAAGTGTGTGTAAAGAGGG + Intronic
1076051215 10:127335061-127335083 AGAGTAAGTGAATGAATGAATGG - Intronic
1076119173 10:127922217-127922239 TGAGACAGTGAATGAATGAATGG - Intronic
1076199972 10:128550449-128550471 AGAGAAAGAGTCTGGATAAGGGG + Intergenic
1078203717 11:9209424-9209446 AGAGAAAGGCTATGAATCACTGG + Intronic
1078641077 11:13097118-13097140 AGAAAAAGTATATTAATAATAGG - Intergenic
1080098582 11:28433232-28433254 GAAGAAAGTAAATGAATAAAAGG - Intergenic
1080236771 11:30078988-30079010 AGAGAAAGGGTGGGAAAAAAAGG + Intergenic
1080254295 11:30271672-30271694 AGAGAAAGTAGCTAAATAAATGG + Intergenic
1081153003 11:39654826-39654848 AGAGTAAATGAATGAATTAATGG - Intergenic
1082902326 11:58268267-58268289 TGAATAAGTGAATGAATAAATGG - Intergenic
1083101831 11:60315531-60315553 AGAAAAAGTATATGCATATATGG - Intergenic
1083695958 11:64442608-64442630 AGAGAAAATATAATAATAAATGG - Intergenic
1083908506 11:65690485-65690507 AGGGAAAATGAATCAATAAATGG + Intergenic
1084548999 11:69829685-69829707 AGAAACAGTTTCTGAATAAATGG - Intergenic
1084687573 11:70705883-70705905 ATAGAATGTGTATCAGTAAAGGG - Intronic
1085923199 11:80983492-80983514 TGAGTGAGTGAATGAATAAATGG - Intergenic
1085962135 11:81473824-81473846 AGAGAATCTGTATGATTCAAGGG + Intergenic
1086952932 11:92909412-92909434 AGAGGAAGTGAATGAATGAATGG + Intergenic
1087028497 11:93678033-93678055 ATATAAAGGATATGAATAAAGGG - Intronic
1087207167 11:95409116-95409138 AGAGAAGGAGAAAGAATAAAAGG - Intergenic
1087498879 11:98925579-98925601 ATTGAAAGTTTATGAATAAGTGG - Intergenic
1087861273 11:103160112-103160134 AGAGAAATTGGTTGAATAAAAGG - Intronic
1088132600 11:106512276-106512298 AGACAAAATGTATGAAACAATGG + Intergenic
1088385978 11:109256944-109256966 AGAGGAAAAGAATGAATAAAAGG - Intergenic
1088652121 11:111966977-111966999 AAAGAAAGTGTTTGAAGAGAAGG - Intronic
1089004809 11:115082478-115082500 ACAGAGACTGTATTAATAAAAGG + Intergenic
1089396892 11:118141986-118142008 GGATAAAGCGTTTGAATAAAAGG - Intronic
1090866155 11:130702502-130702524 ATAGAAAATGGATGAATGAATGG - Intronic
1091495845 12:972338-972360 ACAGAAAGTGCATGAGAAAATGG + Intronic
1092519803 12:9258068-9258090 GGAGAAAGTCTATGAAAAAAAGG + Intergenic
1092656835 12:10694418-10694440 ACAGAAAATAAATGAATAAATGG + Intergenic
1092736304 12:11586115-11586137 AGAGAAAGAGAATGAATACAGGG - Intergenic
1092929914 12:13306060-13306082 GGGAAATGTGTATGAATAAAAGG - Intergenic
1093318493 12:17681664-17681686 AGAGAGAATGTAAGAAGAAATGG + Intergenic
1093337076 12:17919162-17919184 ACAGAATGGGTATGCATAAATGG + Intergenic
1093474515 12:19539802-19539824 GGAGAAAGTGTGTGGATACAAGG + Intronic
1093981165 12:25477334-25477356 AGAGAAAGTGAAGAAATAAGAGG + Intronic
1094330186 12:29282951-29282973 GGGGAAAGTATATGAATTAATGG + Intronic
1095756994 12:45779606-45779628 AGTGAAAGTCTATTAATCAATGG - Intronic
1096712944 12:53471115-53471137 ATCAAAAGTGTATGAGTAAAGGG + Intronic
1097324303 12:58258543-58258565 AGATAAAGTGTAAGAAAATAAGG + Intergenic
1097570879 12:61329764-61329786 CTAGAACGTGAATGAATAAAAGG - Intergenic
1097619717 12:61924665-61924687 GAAGAAAGTGTATGAACGAATGG + Intronic
1097666375 12:62481896-62481918 AGAAAAAGTGTATAAACAAAGGG + Intronic
1098373354 12:69783654-69783676 AGAGCAAATCTAAGAATAAACGG - Intronic
1098517471 12:71394096-71394118 AGTGAAGGTTTATGAAGAAAAGG - Intronic
1099540830 12:83905160-83905182 AGAGAAATTGTAGGCAGAAAAGG - Intergenic
1099664502 12:85610525-85610547 AGAAAAAGAATATGAATAAAAGG + Intergenic
1099803372 12:87484814-87484836 ACAGAAATTATATGAATCAATGG - Intergenic
1100450128 12:94697799-94697821 TGAATAAGTGAATGAATAAAAGG + Intergenic
1100652176 12:96603022-96603044 GAAGAAAGTGTATCAATTAACGG - Intronic
1100906210 12:99302654-99302676 TGAGAAAGTCAGTGAATAAAGGG - Intronic
1101298706 12:103454933-103454955 ATAGAAAGTGAATAACTAAAAGG - Intronic
1104493114 12:129211761-129211783 AGAAAAAGTGTATGGATAATGGG - Intronic
1106001220 13:25725197-25725219 AGAGAAACTGGAAGAATGAAGGG - Intronic
1107588156 13:41874576-41874598 AAAGAAAGTGTATTAGAAAATGG - Intronic
1107827253 13:44339576-44339598 AGAAGAAGTGCATGAATGAAGGG - Intergenic
1108106475 13:47016054-47016076 ATAGACAGTGAATGAATCAAAGG - Intergenic
1108263449 13:48680910-48680932 AGAGAAAGTGTCGAACTAAATGG + Intronic
1109399935 13:61813210-61813232 AGATAACATTTATGAATAAACGG + Intergenic
1109406316 13:61904511-61904533 ATAGAATGTGTTTGAAAAAAGGG - Intergenic
1109431251 13:62238489-62238511 AGAAAAATTAGATGAATAAATGG - Intergenic
1109453255 13:62546563-62546585 CGAGACATTGTAGGAATAAACGG - Intergenic
1109995629 13:70121163-70121185 AGACAAAGAGAATAAATAAATGG + Intergenic
1110154082 13:72292619-72292641 AGAGAAAATATATGAATAAAGGG + Intergenic
1110268288 13:73564684-73564706 TAAGAAAGAGTATGAACAAATGG + Intergenic
1110454354 13:75673445-75673467 AGAGAAAGGGTAAGATTAAAGGG - Intronic
1110913686 13:80995462-80995484 AGAGGAAGTGTCTGACTTAAAGG + Intergenic
1111025608 13:82517544-82517566 AGAGAAAATCTATGTATATATGG - Intergenic
1111061595 13:83026144-83026166 AGAGCAAATGTATGAGTAATAGG + Intergenic
1111155520 13:84318160-84318182 AGAGAAATCAGATGAATAAATGG + Intergenic
1111183974 13:84704989-84705011 AGACACAGTGTGTGAATAAAAGG + Intergenic
1111343712 13:86922105-86922127 AGAAAAAATGTTTGAATAATTGG - Intergenic
1111539696 13:89654681-89654703 ATATAAATTGTATGAATAAATGG + Intergenic
1111774253 13:92639643-92639665 AAAGATAATGTTTGAATAAATGG - Intronic
1112856372 13:103774664-103774686 AGAAAAAGTTGATGAAGAAAAGG + Intergenic
1114182813 14:20380056-20380078 AGAGAAAGAGTAGGAAGAAAGGG + Intronic
1114518326 14:23316187-23316209 CGGGAAAATGTATTAATAAAAGG - Intronic
1114580452 14:23753724-23753746 AAAGAAAGAGTGTGAAGAAAGGG + Intergenic
1115492925 14:33976107-33976129 AGTCAAATTGTAAGAATAAATGG + Intronic
1115539611 14:34407888-34407910 AGACAAAATGTTTGAAGAAATGG + Intronic
1115735008 14:36317376-36317398 ATATAAAGTGTAGGGATAAATGG + Intronic
1116334342 14:43638639-43638661 AGAGCAAGTGGATTAATATAGGG - Intergenic
1116498441 14:45591078-45591100 AGGGAAAGTGGATGAGTAATTGG + Intergenic
1116574242 14:46552486-46552508 ACAGCAATGGTATGAATAAAAGG + Intergenic
1116657761 14:47673881-47673903 TGAGCAAGTGCATGAATGAACGG - Intronic
1116946341 14:50838730-50838752 GGAGAAAGAGTAGTAATAAAGGG - Intergenic
1117834611 14:59790440-59790462 GGAGAAAAATTATGAATAAAAGG - Intronic
1118206804 14:63730076-63730098 AGAGAAAGTGAAGGAAGATAGGG + Intergenic
1119112911 14:71991902-71991924 ACAGAAAGTGTGTAAATGAATGG + Intronic
1119908195 14:78324602-78324624 AAAGAGAGTGCATTAATAAAAGG + Intronic
1120056572 14:79931002-79931024 AAACAAAGTGTAGAAATAAAAGG - Intergenic
1120499402 14:85275880-85275902 GGAGAATGTGTATGAATACGTGG - Intergenic
1120585824 14:86311282-86311304 AGAGAAAGAGTCTGTATAAGAGG + Intergenic
1120719144 14:87871605-87871627 AGTTAAAGTGTAAGAATGAATGG - Intronic
1121346352 14:93138683-93138705 AAATAAAGTAGATGAATAAAAGG - Intergenic
1121371379 14:93361334-93361356 AGAGATAGGGTCTCAATAAATGG - Intronic
1122002213 14:98667890-98667912 AGTGAGAGTGGATAAATAAATGG - Intergenic
1202872839 14_GL000225v1_random:179645-179667 AGAGAAATTGTTTGGATATAGGG + Intergenic
1123540697 15:21287044-21287066 AGTTTAACTGTATGAATAAATGG - Intergenic
1125786378 15:42322169-42322191 AGAGAAAGTGAATGGTAAAAAGG + Intronic
1125787215 15:42330627-42330649 AAAGAACGTGTAAGAACAAAGGG - Exonic
1126007367 15:44270793-44270815 AGAGAAAGTGTAACAAAAAGTGG + Intergenic
1126062191 15:44793403-44793425 AGTGAAATTATATGATTAAAAGG - Intergenic
1126936791 15:53719050-53719072 ATAGAAAGTGTATGGAAGAATGG - Intronic
1127021023 15:54748946-54748968 ACAGAAAGATTATGAATAAAAGG + Intergenic
1127482754 15:59392284-59392306 AGGCAAAGAGTATGAGTAAAAGG + Intronic
1127573186 15:60264123-60264145 AGAGAAACTTTCTGAAAAAAAGG + Intergenic
1127797970 15:62454572-62454594 AGAGCAAGTGTATCAAGAAGTGG + Intronic
1129129471 15:73480525-73480547 CAAGAAAGATTATGAATAAATGG - Intronic
1130169844 15:81499731-81499753 AGAGAGAGAGTATTAATAGAAGG + Intergenic
1130385893 15:83411861-83411883 AAAGAAAGTCTTTCAATAAATGG - Intergenic
1132000298 15:98172632-98172654 AGAGAAAATATATGAAATAATGG - Intergenic
1132067830 15:98747153-98747175 AGTGTAAGTGTATAAATGAATGG - Intronic
1132191209 15:99862788-99862810 AAAGATAATGTTTGAATAAATGG + Intergenic
1202949009 15_KI270727v1_random:14187-14209 AGTTTAACTGTATGAATAAATGG - Intergenic
1133610432 16:7428203-7428225 GGAGAAACTAAATGAATAAAAGG - Intronic
1135015897 16:18925564-18925586 CGAGAAAGTGAATGAGTAACAGG + Intronic
1135321517 16:21501387-21501409 CGAGAAAGTGAATGAGTAACAGG + Intergenic
1135437435 16:22437832-22437854 CGAGAAAGTGAATGAGTAACAGG - Intergenic
1135901118 16:26460612-26460634 AGAGAAAGAGATTGAAGAAATGG - Intergenic
1136332997 16:29594501-29594523 CGAGAAAGTGAATGAGTAACAGG + Intergenic
1136447691 16:30334588-30334610 CGAGAAAGTGAATGAGTAACAGG + Intergenic
1136704603 16:32176054-32176076 TGAGAAAGTGTATGATATAAAGG - Intergenic
1136763310 16:32753352-32753374 TGAGAAAGTGTATGATATAAAGG + Intergenic
1136804790 16:33117034-33117056 TGAGAAAGTGTATGATATAAAGG - Intergenic
1137752304 16:50875549-50875571 TCAGAAAGTCTATGCATAAAAGG - Intergenic
1137866716 16:51905190-51905212 AGATATAGTGAATGACTAAAGGG - Intergenic
1138004081 16:53314133-53314155 AGAGAAAATGTGTGAATATCGGG + Intronic
1138896298 16:61209060-61209082 GGAGAAAGAGTATGAATTAGTGG - Intergenic
1138919285 16:61507447-61507469 AGAGATATGGTATAAATAAATGG - Intergenic
1139996037 16:70980789-70980811 AGAGACAGTCTATGGCTAAAAGG + Intronic
1140270708 16:73464173-73464195 AGAGAAAGGGAATGAGTAAGTGG + Intergenic
1140454428 16:75096638-75096660 ACAGAAAGTGTGTGTGTAAATGG - Intronic
1140911154 16:79454277-79454299 AGAGAAGATGTAGAAATAAATGG + Intergenic
1203065460 16_KI270728v1_random:1013673-1013695 TGAGAAAGTGTATGATATAAAGG + Intergenic
1144131131 17:12248923-12248945 AGAGAAAATATATGAAACAAGGG + Intergenic
1146592207 17:34137234-34137256 AGACAAAATGAATGAATAAGTGG + Intronic
1147061458 17:37882588-37882610 AGAGTAATGGTGTGAATAAATGG - Intergenic
1147270184 17:39263810-39263832 AGAGAAAGTGTTTGGTTAAATGG - Intronic
1147540671 17:41355839-41355861 ATAAAAAGTGATTGAATAAAGGG - Intergenic
1150770096 17:68033670-68033692 AGATCAAGTGTATTAATATATGG + Intergenic
1151257212 17:72887195-72887217 TGAGTGAGTGAATGAATAAATGG + Intronic
1153064727 18:1033380-1033402 AAAGAAACTGTATCAATTAACGG - Intergenic
1153138787 18:1948053-1948075 AGAAAGAGTGAATGAATCAAGGG + Intergenic
1153496390 18:5704189-5704211 AGAGAGAGAGTATGAAGGAAGGG - Intergenic
1155079264 18:22391668-22391690 AGAGAAAGTGAATTACTAATTGG - Intergenic
1155610302 18:27659602-27659624 CAATAAAGTGTATGAAGAAATGG + Intergenic
1155620778 18:27776740-27776762 AGAAAAATTGTGTGAAGAAAAGG + Intergenic
1156441268 18:37190698-37190720 AGAGATAAAGAATGAATAAATGG - Intronic
1156584118 18:38413085-38413107 AGTGAATGTGTATGTGTAAATGG + Intergenic
1157014412 18:43693680-43693702 TCAGAAAATGTATGAATACATGG + Intergenic
1157318570 18:46616053-46616075 ACAGAAAGTCTGAGAATAAATGG - Intronic
1157486957 18:48094627-48094649 GGAAAAAGTGTATGAGAAAAGGG - Intronic
1157849932 18:51039107-51039129 AGAAAAAGAATATGAATAAAGGG + Intronic
1159236321 18:65678817-65678839 AGGAAAAGTGTAACAATAAAGGG + Intergenic
1159506225 18:69340176-69340198 AGAGAAAGTGGAAGAAAAAAAGG - Intergenic
1159547764 18:69861831-69861853 AGAGAAAGAAAATGAATGAATGG + Exonic
1159678520 18:71317416-71317438 AGACAATGTGTATTAGTAAATGG + Intergenic
1159951131 18:74484763-74484785 AGAGTAAGTGAATAAATGAATGG - Intergenic
1162239860 19:9342052-9342074 AGAGAATGTGTAAGAATTTATGG + Exonic
1162260256 19:9527520-9527542 AGAGAAATTGTATGAATGTAAGG - Intergenic
1162607521 19:11721775-11721797 AGAGAAGCTGTATGAATGTAAGG - Exonic
1162611348 19:11756607-11756629 AGAGAAGCTGTATGAATGTAAGG - Intergenic
1162619740 19:11832436-11832458 AGAGAAACCGTATGAATGTAAGG + Exonic
1162991109 19:14302747-14302769 AGAGAAAGAATAGTAATAAAAGG + Intergenic
1163057433 19:14731111-14731133 AGAGAAATTGAATGAATAAAGGG - Intronic
1164278326 19:23744610-23744632 AGAGAAACTCAATGAATATAAGG - Exonic
1164901687 19:31931750-31931772 AGAGAAAAAGTAAGAATAATGGG - Intergenic
1164902262 19:31938271-31938293 AGAGAGAGTTTATGCACAAAGGG + Intergenic
1165275011 19:34742083-34742105 AGAGAAACTGTATGAAGCAGTGG + Exonic
1165587654 19:36933781-36933803 AAACAAAGAGGATGAATAAAAGG - Intronic
1167197779 19:48042559-48042581 AGAGAGAGAGAATGAAAAAAAGG - Intronic
1167631286 19:50627752-50627774 AGAGAGAATGTATGAATCAATGG + Intronic
1167791947 19:51688714-51688736 AGAGAAAAGGGAAGAATAAATGG + Intergenic
1168457525 19:56525432-56525454 AGAGAAACCGTATGAATGCAAGG + Exonic
1168491721 19:56816551-56816573 AGAGAAAATGTACGAATGTAAGG - Exonic
1168633909 19:57979719-57979741 AGAAAAACTCTATGAATATAAGG - Exonic
925831268 2:7898068-7898090 AGAGAGAAAGAATGAATAAAGGG + Intergenic
925933058 2:8726170-8726192 AAAGAATGTATAAGAATAAAAGG - Intronic
926367585 2:12147018-12147040 AAAGGAAGTGTGTGAATAAAGGG - Intergenic
926960785 2:18356414-18356436 AGGGAAAGTGTATGCATGCATGG - Intronic
927318046 2:21708730-21708752 AGAGCTAGTATATGAATAATAGG + Intergenic
927608970 2:24517257-24517279 AGAGAAACTGAAGGAAAAAAAGG - Intronic
927817523 2:26232444-26232466 AGAGGAAAAGTATGAAAAAAAGG - Intronic
929096753 2:38269772-38269794 AGAAAAAGTTTATTAATAAAAGG - Intergenic
929204317 2:39273622-39273644 AGAGAAAAGGTAATAATAAAAGG + Intronic
929954888 2:46449504-46449526 AGACAAAGTGTATGAAACAATGG - Intronic
930100958 2:47602455-47602477 AAATAAAGTGTATGATTCAATGG + Intergenic
930287324 2:49447177-49447199 AGACAAAGTATATGAATATGTGG + Intergenic
930617123 2:53605044-53605066 TGAGAAGATGTATGAATTAAGGG - Intronic
931078898 2:58746801-58746823 AGAGAAAGAGTAATAATACATGG - Intergenic
931772764 2:65512905-65512927 AGAGAAAATGAATGAAAACATGG + Intergenic
932451053 2:71811097-71811119 AGGGATAGTGTTTGATTAAAGGG + Intergenic
933001076 2:76924359-76924381 AGAGAAATGGGATGAATATATGG - Intronic
933348331 2:81119941-81119963 ACTTAAAGTGAATGAATAAAAGG + Intergenic
933410739 2:81921799-81921821 AGAGAGAGTGTATGTAAAGAAGG + Intergenic
933437322 2:82263950-82263972 ATAGAATGTGTATGGATAAGGGG - Intergenic
934062083 2:88304227-88304249 AAGAAAAGTGTATGAATAAAGGG - Intergenic
935076727 2:99752909-99752931 AGAGAAAGTGTGTCAAAAAGTGG - Intronic
935304008 2:101719349-101719371 TGAGACAGTGAATGAATAAAAGG + Intronic
935329412 2:101965584-101965606 AGAGGAAATGTACGTATAAAAGG + Intergenic
935370359 2:102339848-102339870 AGATGTAGTGTATGAATAAATGG + Intronic
935749306 2:106216364-106216386 AGAGTTGCTGTATGAATAAAGGG - Intergenic
936581824 2:113706723-113706745 AGTGAAAATGTTTTAATAAAAGG + Intronic
937708017 2:124943774-124943796 ATTGAAAATGTGTGAATAAATGG - Intergenic
937943312 2:127307521-127307543 AGAGAAGGTGAATGAATAGATGG + Exonic
938326037 2:130403676-130403698 AGGGAAAGTATCTGAATTAATGG - Intergenic
938363905 2:130717789-130717811 AGGGAAAGTATCTGAATTAATGG + Intergenic
938440292 2:131324334-131324356 AGGGAAAGTGTCTGAATTAATGG + Intronic
939119121 2:138094867-138094889 ATAGAAAGTTTAACAATAAAAGG - Intergenic
939516164 2:143170890-143170912 AGAGAAAGTGTCTGACTTCACGG - Intronic
940394633 2:153173952-153173974 AGAGAAATTGAAAGAAAAAAGGG + Intergenic
940777240 2:157897848-157897870 AAAGAAAGTGAAAGATTAAAGGG + Intronic
940797163 2:158092086-158092108 AGACAAATTGAATGTATAAAAGG + Intronic
940890122 2:159027201-159027223 AGACAAAATGTATAATTAAAAGG - Intronic
941145785 2:161843385-161843407 AGAGAATGTGTATAATTAAATGG - Intronic
941196993 2:162465043-162465065 GGGGAAAGTCTAGGAATAAAAGG + Intronic
941434555 2:165453130-165453152 AAAGAAAATGTATGAACACACGG + Intergenic
942012012 2:171773476-171773498 AGAGAAAATGTGAAAATAAAAGG + Intergenic
942035709 2:172008883-172008905 AGAGAATGTGGATGACTAATGGG + Intronic
942886879 2:180936670-180936692 AGAGAAAATGTAGTGATAAATGG + Intergenic
942952782 2:181739906-181739928 AAAAAAAGTGTGAGAATAAATGG + Intergenic
943078382 2:183226652-183226674 AGAGTAACTGAATGAGTAAATGG + Intergenic
943521606 2:188958396-188958418 CGAGAAAGAGTAAGAATGAATGG - Intergenic
943688635 2:190845651-190845673 ATAGAAAGTGCAGGACTAAAGGG - Intergenic
944363169 2:198883008-198883030 AGAGAAACTGCAATAATAAATGG + Intergenic
944497760 2:200325736-200325758 AGAGAAAGAGTAAGTAGAAATGG - Intronic
944504532 2:200397005-200397027 AAAGGAACTGAATGAATAAATGG + Intronic
944757492 2:202778718-202778740 ATAGCAAGTGTATGAAAAAGTGG + Exonic
944822210 2:203442190-203442212 AAAGAAAATGTATCAAGAAATGG + Exonic
945178400 2:207066559-207066581 AGAGAAAATATATAAAGAAAAGG + Intergenic
945298379 2:208193262-208193284 AGTGAAAGTAAAGGAATAAAAGG - Intergenic
945353410 2:208809473-208809495 AGAGAAAATGGAAGAATCAAAGG + Intronic
945368125 2:208981365-208981387 AAACAAAGTATATGAATATATGG + Intergenic
945512125 2:210715456-210715478 AGAGAAAAAGTATGAAGAAGCGG + Intergenic
945591598 2:211739220-211739242 ACAAAGAGAGTATGAATAAATGG - Intronic
945781260 2:214175352-214175374 AGAGAAATTCTGTGAATAAAAGG + Intronic
946122457 2:217528340-217528362 AAAGAAAGTATAGGGATAAACGG + Intronic
947298383 2:228658991-228659013 AGAGAAAATATATAAACAAATGG - Intergenic
947349149 2:229224546-229224568 AAGGAAAATGTTTGAATAAATGG - Intronic
947413386 2:229867487-229867509 AGAGATAGTATATGAGAAAAAGG + Intronic
948504152 2:238416595-238416617 AGACAAAGTTTATCACTAAAAGG - Intergenic
1169033493 20:2431279-2431301 AATGAAAGTGAGTGAATAAATGG - Intronic
1169440069 20:5626597-5626619 AGAGAAATTGTAGGCAGAAAAGG + Intergenic
1169777074 20:9267011-9267033 AGAGCAAGTTTATGATAAAATGG + Intronic
1170230282 20:14038823-14038845 AGAAAATGTGAATGAATGAATGG - Intronic
1170233916 20:14080617-14080639 AGAGAAAATTTATGCTTAAATGG + Intronic
1170505019 20:17016370-17016392 AGGGAAAGAGTTTTAATAAATGG - Intergenic
1171473740 20:25391499-25391521 AGAGAAAAGGAAAGAATAAAGGG + Intergenic
1171965638 20:31528234-31528256 AAAGAAAGTATATCAATAGAGGG + Intronic
1172333573 20:34094570-34094592 AAAGAAAGTGTATGTCTAGAAGG + Intronic
1173356576 20:42298459-42298481 AGAGGAATTGTAGGATTAAAGGG - Intronic
1174156187 20:48516852-48516874 AGAGGAAGTAAATAAATAAATGG + Intergenic
1174492425 20:50910079-50910101 AGAGAAAGTGAATAAATAAGAGG + Intronic
1174738430 20:52987432-52987454 AGAGAAAGAGTATAAAAAAAGGG - Intronic
1177109834 21:17012417-17012439 AGAGAAAATGGATCAATAAAAGG - Intergenic
1177327623 21:19612683-19612705 AGAGAAAGAGTGAGAATGAAGGG - Intergenic
1178105211 21:29310855-29310877 AGAGACAGTGTGAGTATAAATGG + Intronic
1178157273 21:29869376-29869398 AGAAAGAGTAAATGAATAAAGGG - Intronic
1179227817 21:39471115-39471137 AGAGAAAGAGGAAGAAGAAAAGG - Intronic
1181901005 22:26155788-26155810 TGAAAAAGTGAATGAATGAATGG + Intergenic
1182564608 22:31188222-31188244 AGAGAAATCGTGTGAAGAAAAGG + Intronic
1183362719 22:37391031-37391053 AGAGAGAGGGAATGAATGAATGG - Intronic
949159535 3:863539-863561 AGAGAAAGGACATGAATTAAAGG - Intergenic
949762523 3:7487244-7487266 AGACAAAGTTTATAATTAAAAGG + Intronic
951047614 3:18058378-18058400 ACAGGAAGTGGCTGAATAAAGGG - Intronic
952058985 3:29483783-29483805 AGAGGAAGTGTTTGAAGAAGGGG - Intronic
952807535 3:37370858-37370880 AGAGAAAAAGTATTAATAAATGG - Intergenic
953259019 3:41319844-41319866 AGAGCCAGTGAATTAATAAATGG + Intronic
954768012 3:52938376-52938398 AGAGAAACTATATGTGTAAACGG - Intronic
955139828 3:56258323-56258345 AGAGACAATGTGTGAACAAATGG + Intronic
955814053 3:62823059-62823081 AGACAAAGTGGCAGAATAAATGG - Intronic
955839724 3:63098955-63098977 AGAGAGAGTTTAAAAATAAAAGG + Intergenic
955964676 3:64376631-64376653 TGAGTAAGTATATGAAAAAAGGG + Intronic
955978888 3:64504705-64504727 AGAGAAAGAATGAGAATAAAAGG - Intergenic
956026107 3:64984708-64984730 TGAGTGAGTGAATGAATAAATGG - Intergenic
956146650 3:66197648-66197670 AGAGAAAGAGTAGGAATTAGGGG + Intronic
956738027 3:72253651-72253673 AGGGAAATTGTAGCAATAAAAGG - Intergenic
957419838 3:79953314-79953336 AGAGAAAGAGAATGATGAAAAGG - Intergenic
957515831 3:81249908-81249930 AAAGAAAGTGTAAGAATAGAAGG - Intergenic
957543731 3:81609702-81609724 AGAGAAAATTTGTGAATAAGTGG - Intronic
957931031 3:86878579-86878601 GGAGAAAGGGAAGGAATAAAAGG + Intergenic
958117253 3:89236329-89236351 AAAGAGAGTAAATGAATAAAAGG + Intronic
958897860 3:99849485-99849507 AGAGAAAATTCATGAATACATGG - Exonic
958973836 3:100642863-100642885 AGAGGAAGAAGATGAATAAATGG + Intronic
959210403 3:103371550-103371572 AAAAAATGTGTAAGAATAAAAGG - Intergenic
959222142 3:103533858-103533880 ATAGAAAGTTTATCAAAAAATGG - Intergenic
959233389 3:103688328-103688350 AGAGAGAGAGTGGGAATAAAAGG + Intergenic
959427106 3:106204788-106204810 ATAAAAAGTGCATCAATAAATGG - Intergenic
959525726 3:107374049-107374071 TCAGAAAGTGAATGAATAACGGG - Intergenic
959760765 3:109961358-109961380 AAAGCAAGTGTCTGAATATAGGG + Intergenic
959830918 3:110861562-110861584 AGAGAAAGTCTGTGTATAAGTGG - Intergenic
960095931 3:113689854-113689876 AGAGAAAGAGGATGCATAATTGG - Intronic
960240997 3:115341899-115341921 GGAGTCAGTGAATGAATAAATGG + Intergenic
960382648 3:116983318-116983340 AGAGAAGGTGTAGGTTTAAAAGG - Intronic
960397068 3:117150923-117150945 GGGGAAATTGTATGATTAAATGG + Intergenic
960527258 3:118724029-118724051 AGAGGAGTTGTATGCATAAAAGG + Intergenic
960566001 3:119132127-119132149 AAAGAAACTGTATCAATTAATGG + Intronic
960778025 3:121283743-121283765 AGAGGATGGGTATGAAAAAATGG - Intronic
960828830 3:121822242-121822264 AGAGAAAGTGCTTGATTATAAGG - Intronic
961616290 3:128184031-128184053 AGAGAGATGGTAAGAATAAAGGG + Intronic
961959462 3:130839340-130839362 ACAGAAAGTGAAGGAATAAGAGG - Intergenic
962275234 3:134008369-134008391 AGAATAAATGAATGAATAAATGG + Intronic
962451312 3:135519678-135519700 AGAGAAAGTGTATGTATGGGGGG - Intergenic
962568273 3:136686263-136686285 AGAGAAAGAGTTTGAGGAAAAGG - Intronic
962752930 3:138447772-138447794 AGAAAATGTGAATAAATAAAGGG + Intronic
962909351 3:139833742-139833764 AGAGAAGGAGGATGAAGAAACGG - Intergenic
964148519 3:153495510-153495532 AGAGAAAGAGAAAGAATAAAGGG + Intronic
965229413 3:166030875-166030897 AGAAAAAGAGGATAAATAAAGGG - Intergenic
965883666 3:173418012-173418034 AAAGAGAATGGATGAATAAAAGG - Intronic
965889623 3:173496175-173496197 ATATAAAGTGTATGAAGACATGG - Intronic
965983018 3:174716091-174716113 ATAAAAAGTGAATGAGTAAATGG - Intronic
966060422 3:175748303-175748325 ATAGAAAATGTATGATAAAAAGG + Intronic
966495912 3:180580449-180580471 AGAGAAAGGGAATGGATACAGGG + Intergenic
966700428 3:182843125-182843147 AGGGTAAATGAATGAATAAATGG - Intronic
966983521 3:185159253-185159275 GGAGAAAGTGAATTAAGAAAAGG - Intergenic
967377987 3:188826981-188827003 TGAAAAAGTAAATGAATAAATGG + Intronic
967464850 3:189792694-189792716 AAAGAAAGTGGCTGAGTAAAGGG - Intronic
967591195 3:191275762-191275784 AGAGAAAATGGATGAAAGAAAGG + Intronic
969361920 4:6669936-6669958 AGAGAACATGGATGAATGAAGGG + Intergenic
969726952 4:8925252-8925274 TTAGAAATTGTATGAATAGATGG + Intergenic
970228926 4:13889049-13889071 AGAAAAAATGAAAGAATAAAGGG - Intergenic
970549509 4:17165231-17165253 ACAGGAAGGGAATGAATAAATGG + Intergenic
970656299 4:18234254-18234276 AGAGACTGAGAATGAATAAAAGG + Intergenic
970726268 4:19048737-19048759 TGAGAAAGAATATGAGTAAAAGG - Intergenic
970810723 4:20090675-20090697 AGAGAAAGACTATGACTAATAGG + Intergenic
970833115 4:20366662-20366684 TGAGGAAGTGAATGGATAAATGG + Intronic
971572148 4:28226845-28226867 AAATTAAGTGCATGAATAAAAGG + Intergenic
971664800 4:29468828-29468850 AGGGAAACTTAATGAATAAATGG + Intergenic
971829078 4:31666572-31666594 AAAGAAAGTGTATAATTCAATGG - Intergenic
971868636 4:32206839-32206861 AGAAAAAGTGGTTGAATGAATGG + Intergenic
971872659 4:32264107-32264129 AGATAAACTGTATGAATTTATGG + Intergenic
973066541 4:45801401-45801423 AGACAAAGTGAATTGATAAAAGG - Intergenic
973620846 4:52723683-52723705 AGAGAAAGGGAAGGAAGAAAGGG + Intronic
973945640 4:55952147-55952169 AGAGAAAGTATATTAATATTAGG + Exonic
974256603 4:59464400-59464422 AGAGACAATATATAAATAAATGG - Intergenic
974407308 4:61490776-61490798 GGAGAAACTCTATGAATAATGGG + Intronic
974495339 4:62618510-62618532 GGAGAAAGAGTACTAATAAAAGG + Intergenic
974560920 4:63516831-63516853 AGAGAAAGATTATAAATCAATGG + Intergenic
975672861 4:76799054-76799076 AGAGCATGTATATGAATAACTGG - Intergenic
975750910 4:77522775-77522797 GAAGAAATTGTATCAATAAACGG - Intronic
976113510 4:81701874-81701896 AGAGAAAGTGTATGAATAAACGG - Intronic
976121941 4:81792772-81792794 TGAGTAAGTGAATGAACAAATGG + Intronic
976242999 4:82978067-82978089 TGAGAAAGTGGAAGAATCAATGG + Intronic
976341162 4:83946605-83946627 AGAGAAAGAGGATGAAGGAAGGG + Intergenic
976627687 4:87204810-87204832 AGGGAAAGAGTATGACTAAAAGG + Intronic
976658035 4:87510285-87510307 AGAGAAACTGTAGGCATACAGGG + Intronic
977103655 4:92851813-92851835 AGAGAAAGTATGTGAAAAAGTGG + Intronic
977338759 4:95730425-95730447 AGAGAAATTCTAGGCATAAAAGG - Intergenic
977436321 4:97000242-97000264 AGAGAACCTGTATGAAGAAAAGG + Intergenic
977740642 4:100476871-100476893 ACAGAAAGACAATGAATAAAAGG + Intronic
978029189 4:103917386-103917408 AGAGAGAGAGAATGAATGAATGG - Intergenic
978084945 4:104639917-104639939 AAAGAAAGGGAAAGAATAAAGGG + Intergenic
978288334 4:107106089-107106111 TGAGTAAATGAATGAATAAATGG + Intronic
979459499 4:120965310-120965332 AGAGCAAATGTTTGCATAAAAGG + Intergenic
980097618 4:128508900-128508922 AATGAAAGAGTAAGAATAAAAGG - Intergenic
980764216 4:137278382-137278404 AGAGAAACTTGATGAATAATAGG + Intergenic
981544599 4:145881249-145881271 AGAGACAGTTTATGAACAAATGG - Intronic
981676086 4:147344719-147344741 AGAGAAAGTGTTTCTCTAAAGGG + Intergenic
981967076 4:150617111-150617133 AGAGAAAGATTAAGAAAAAATGG + Intronic
982128524 4:152205655-152205677 CGAGAATGTGAATGAATACATGG - Intergenic
982366892 4:154589055-154589077 AGAGATAGGGTAGGAAGAAATGG - Intronic
982522340 4:156434091-156434113 ATAAAAAATGAATGAATAAATGG + Intergenic
982901184 4:161004253-161004275 AGAGAAAGAGTGTGTATAGAAGG + Intergenic
982986384 4:162212736-162212758 AGACAAAGTGTATGATTAGTGGG - Intergenic
982990840 4:162271776-162271798 AGAGAAAGTTTATCAATATGGGG - Intergenic
983722596 4:170874835-170874857 AGAGAAAGTGTGTTTATAAATGG + Intergenic
983921303 4:173348172-173348194 AGAAAGACAGTATGAATAAAAGG + Intergenic
984713754 4:182907095-182907117 AAAGAAAATGTATGATTACATGG - Intronic
984804824 4:183742300-183742322 ATAGACAGTGTATTAAAAAAGGG - Intergenic
986784506 5:11101026-11101048 AGAGAATCTGAAGGAATAAAAGG + Intronic
986787416 5:11127227-11127249 AGAGAATGTGGTTGAGTAAAAGG - Intronic
986917202 5:12635662-12635684 AATGAAAGTATATGGATAAAAGG + Intergenic
986965533 5:13266821-13266843 AGAGAGTGTGTAGGAAGAAAAGG + Intergenic
986975273 5:13386933-13386955 GGAGAAAGTGAGAGAATAAAGGG - Intergenic
987061527 5:14248333-14248355 AGAGCAAGTGTCTGAACAGAAGG - Intronic
987375506 5:17230339-17230361 ACAGAAAGTTTATGAATCAGTGG + Intronic
987641945 5:20623461-20623483 AAAGAAAATATTTGAATAAATGG - Intergenic
988026537 5:25699583-25699605 AGTGAAGGTGTATCAAAAAATGG - Intergenic
988286610 5:29226432-29226454 AGAAAAATTGTAAAAATAAATGG - Intergenic
988559260 5:32265642-32265664 AGATAAACTGAATGAATTAAGGG + Intronic
989295843 5:39825643-39825665 AGAGTAAGTGGAAGGATAAAGGG + Intergenic
989315699 5:40075854-40075876 AGAGAATTTGTATGTATGAAAGG - Intergenic
989504104 5:42205988-42206010 ATAGAAAATGTACAAATAAAAGG + Intergenic
990173846 5:53085209-53085231 AGAGAAAGGGTAGCAACAAAAGG - Intronic
990909846 5:60842985-60843007 AAAGAAAGGGAATGAATAAGCGG + Intronic
990951918 5:61306760-61306782 AGAAAATGTGTATGAGTAAAAGG + Intergenic
991577075 5:68115805-68115827 AGAGAAAGTGTATAAGTTGATGG + Intergenic
991641728 5:68760989-68761011 AAAGAAAGTAAATAAATAAAGGG - Intergenic
991981887 5:72240800-72240822 AGAGAAAGTCTGTGAAGGAAGGG - Intronic
992127166 5:73653942-73653964 AGAAAAGGTGTATGAAAGAAAGG + Intronic
992308462 5:75467879-75467901 ATGGAAACTGGATGAATAAATGG + Intronic
992479471 5:77136172-77136194 AGAGAAAGTGCATTCATGAAAGG - Intergenic
992518267 5:77520360-77520382 AGAGAAAGTGTGAAAATTAATGG - Intronic
992781117 5:80128837-80128859 AGGGAAAGAGTAAGAATGAATGG - Intronic
993120965 5:83773850-83773872 TAAGAAAGTGAATAAATAAAAGG - Intergenic
993436095 5:87896649-87896671 AGAGAATGGGTATTAATTAATGG - Intergenic
993587651 5:89750887-89750909 AGAGAAAATATATGAAACAATGG - Intergenic
993754605 5:91712814-91712836 AGACAAAATGTATGAAGTAATGG - Intergenic
994571330 5:101517602-101517624 ATAGTCAATGTATGAATAAATGG + Intergenic
994600578 5:101898268-101898290 AGAGAAGGTGAATGTATAGAGGG - Intergenic
994854886 5:105105901-105105923 AGACAAATTGTATAAATATATGG - Intergenic
994921878 5:106056025-106056047 AGGGAAATTGGAAGAATAAATGG - Intergenic
995319216 5:110812760-110812782 AGAAAAAGAGAATGAAAAAAGGG + Intergenic
995399889 5:111729026-111729048 AGAAAAAGTGTAGAAATAAAAGG + Intronic
995730354 5:115233463-115233485 AGAGAAAGTGGCTGAAAAGAAGG + Intronic
995887575 5:116913433-116913455 AATGAAAGAATATGAATAAATGG - Intergenic
995910447 5:117180571-117180593 AAAGAAAATGTGTGGATAAAAGG + Intergenic
995948922 5:117686030-117686052 ATAGAAAGTGAATGAGGAAAAGG + Intergenic
996294184 5:121891798-121891820 AGAGACAGTGTTTAGATAAATGG + Intergenic
996294529 5:121895939-121895961 AGAGACAGTACATGAAGAAAAGG + Intergenic
996493967 5:124131886-124131908 ATACAAAGAGTAAGAATAAATGG + Intergenic
996498500 5:124189343-124189365 AGAGAAAGGGTTAGAAAAAAAGG + Intergenic
999340470 5:150765762-150765784 AGAGTAACTGTGAGAATAAAAGG - Intergenic
999490071 5:152041165-152041187 ACGGAATGTATATGAATAAATGG + Intergenic
999707703 5:154289130-154289152 AGGGAAAGTTTATGAAAACACGG - Intronic
1000207052 5:159071867-159071889 AAAGAAAGTGTACGGATCAAAGG - Intronic
1000382084 5:160638323-160638345 AAAGAAAGTTAATGATTAAAAGG - Intronic
1001874391 5:175186813-175186835 AGAGAAAATATATAAAGAAAAGG - Intergenic
1002008464 5:176255945-176255967 AGAGAAAGTGGAAGACCAAAAGG + Intronic
1002218257 5:177656317-177656339 AGAGAAAGTGGAAGACCAAAAGG - Intergenic
1002411356 5:179079908-179079930 AGAGAAACTGTATAAATGTATGG + Exonic
1003673110 6:8178267-8178289 AGGGTACATGTATGAATAAATGG + Intergenic
1003755023 6:9108461-9108483 AGAGAATGTGGATCAATTAAAGG + Intergenic
1003822165 6:9910868-9910890 AGAGAAAAAATAGGAATAAAAGG - Intronic
1004076604 6:12349551-12349573 AGAGAAAGTGTTTACATGAATGG + Intergenic
1004608220 6:17213799-17213821 ATAGAAAGTGGACGAGTAAAAGG - Intergenic
1005151008 6:22750698-22750720 AATGAGAGTGTAGGAATAAAAGG - Intergenic
1005773512 6:29102511-29102533 AGAATAAGTTAATGAATAAATGG - Intergenic
1005779552 6:29175204-29175226 AGAATAAGTTAATGAATAAATGG - Intergenic
1005913412 6:30330268-30330290 AAGGAAAATGTTTGAATAAAGGG + Intronic
1005921357 6:30404837-30404859 AGGGTAAATGAATGAATAAATGG + Intergenic
1006040904 6:31253984-31254006 AGGGTAAATGAATGAATAAATGG + Intergenic
1006051254 6:31346393-31346415 AGGGTAAATGAATGAATAAATGG + Intronic
1006301346 6:33194985-33195007 GGAGAAAGTGTATGCATCACTGG - Exonic
1006876412 6:37301163-37301185 ATAAAAATTGTATTAATAAAAGG - Intronic
1007629646 6:43265632-43265654 AGTGAGTGTGGATGAATAAACGG - Intronic
1007729142 6:43935234-43935256 AGAGTGAGTGAATAAATAAATGG - Intergenic
1007936201 6:45734327-45734349 AGAGAAAGTGTATGAGAAGGTGG + Intergenic
1008406896 6:51128171-51128193 AGAGAAATTTTGTGAACAAAAGG - Intergenic
1008502515 6:52197535-52197557 ATAGAAAGTTTAAAAATAAAGGG + Intergenic
1009447825 6:63763997-63764019 AGAGAAAGGGAAGGAAGAAAGGG - Intronic
1009754676 6:67921570-67921592 ACAGAATGTGTTTGAAGAAAAGG - Intergenic
1009842077 6:69090487-69090509 TGAAAAAGTGAATGAGTAAATGG - Intronic
1010736545 6:79450338-79450360 AGAGAAATTCTAGGAAGAAAAGG + Intergenic
1010812852 6:80319439-80319461 AGAGAGATTGTAGTAATAAATGG - Intronic
1011521428 6:88210696-88210718 AGAGAAAGTGCATGAAAAAAGGG + Intergenic
1011565472 6:88667863-88667885 AGGGAAAGTGTGTCAAGAAATGG + Intronic
1011679226 6:89767059-89767081 AGAGAAAGTCTAGCACTAAAGGG - Intronic
1012038762 6:94176474-94176496 TGTGAAAGTGTTTGCATAAATGG + Intergenic
1012492546 6:99798279-99798301 AGACAAAATGTATGAAACAATGG - Intergenic
1012583287 6:100893902-100893924 AGAGGAAGAGAATCAATAAATGG - Intergenic
1012633430 6:101503104-101503126 AGACAAAGTTTAAGAAGAAAGGG + Intronic
1012972407 6:105745605-105745627 AGAGAGAGTGTGTGACTACATGG + Intergenic
1012990272 6:105918768-105918790 AGAGAAAGAGGAAGAATAAAAGG + Intergenic
1013046524 6:106491100-106491122 AAATAAAGTGTTTGAAAAAAGGG - Intergenic
1013187253 6:107770553-107770575 AGAGAAACTCTATGAGGAAATGG + Intronic
1013246245 6:108290044-108290066 AAAGAAAGAGTATGAGGAAATGG + Intergenic
1013530315 6:111013472-111013494 AGAGAAAATGTTGTAATAAAAGG + Intronic
1013990679 6:116251505-116251527 AGAGAAAGGTTATGATTAAATGG - Exonic
1013995900 6:116307476-116307498 ATATAAAATGTATGAAGAAAAGG - Intronic
1014024101 6:116624791-116624813 TCACATAGTGTATGAATAAATGG - Intronic
1014252270 6:119127182-119127204 AGAGAAATTCTAGGCATAAAAGG - Intronic
1014759849 6:125344522-125344544 GGATAAAGTGTGTGAGTAAAGGG + Intergenic
1015330612 6:131974437-131974459 AGACAAAGTGGATGAAAAGATGG + Intergenic
1015679632 6:135791195-135791217 AGAAAAAGTGTCTTAAAAAAGGG - Intergenic
1015859395 6:137659818-137659840 AAGGAAATTGTATGCATAAAAGG + Intergenic
1017083241 6:150688631-150688653 AGAGAAAATGTTAGATTAAATGG - Intronic
1017142159 6:151200941-151200963 AGAGGAGGTGTCTGAATAAAGGG + Intergenic
1017478861 6:154829571-154829593 AGAAAAAGTTTAAGAATACAAGG - Intronic
1017513549 6:155135831-155135853 AAAGGATGTGAATGAATAAATGG + Intronic
1017541246 6:155405267-155405289 AGAGAAAGTGGATGGAAAGAAGG + Intronic
1017573088 6:155769023-155769045 AGAGAAAATGTATGAATTTCTGG - Intergenic
1018975920 6:168565668-168565690 AAACAAAGCGTATCAATAAAAGG + Intronic
1019003923 6:168780354-168780376 TAAGTAAGTGAATGAATAAATGG + Intergenic
1019461959 7:1164531-1164553 AAAGAAAGTTTATGAAGAACTGG + Intergenic
1019749276 7:2718661-2718683 TGAGAAAGTGTTGGAAGAAATGG - Intronic
1020417060 7:7958643-7958665 AGAGAGAGAGAATGAATAAGGGG + Intronic
1020483363 7:8690294-8690316 GCAGAAAGTCTATTAATAAATGG + Intronic
1020648808 7:10849832-10849854 ACAGAAAAAGTATGCATAAATGG + Intergenic
1020902541 7:14023977-14023999 ATAGACAGTGTGTGAATAAATGG + Intergenic
1020994921 7:15251430-15251452 AGAGTAAGTCAATGAAGAAAGGG + Intronic
1021102855 7:16603616-16603638 TGAGAAAGTGTATGAATGCAAGG - Intronic
1021155243 7:17202009-17202031 ACAGCAAGGGTATGAAGAAAGGG - Intergenic
1022212155 7:28221984-28222006 AGATATAGTCAATGAATAAATGG - Intergenic
1023538675 7:41241042-41241064 AGAGCAAGTCTATGAAGAAATGG - Intergenic
1024434236 7:49330633-49330655 ACAGCAAATGCATGAATAAAAGG - Intergenic
1024447039 7:49492815-49492837 AGAGCAAATGTATGGATAGAAGG - Intergenic
1025919398 7:65896607-65896629 AGAGAAAGAGGAAGAAGAAAAGG - Intronic
1026735109 7:72944398-72944420 GGATAAAGTGTATAAAAAAAGGG + Intronic
1026785452 7:73299327-73299349 GGATAAAGTGTATAAAAAAAGGG + Intergenic
1027710670 7:81597320-81597342 AGAGAAACAAAATGAATAAAAGG - Intergenic
1027854016 7:83485945-83485967 TGAGAAAGTGAAAAAATAAAAGG + Intronic
1028009576 7:85624151-85624173 AAAGAAAGTTTTTCAATAAATGG - Intergenic
1028138692 7:87248181-87248203 AGAGAAATGGCATGAACAAAGGG + Intergenic
1028172712 7:87617980-87618002 AGAGGAAGAGTATGTACAAATGG - Intronic
1028356242 7:89913556-89913578 AGAGAATGTGTATGAGTATGGGG + Intergenic
1028840317 7:95422830-95422852 AGAGTAAGATTATAAATAAATGG + Intronic
1029369744 7:100141458-100141480 AGATAAAGGGAATTAATAAAAGG + Intergenic
1030405594 7:109108220-109108242 AGAGAAAATGGATGGATCAAAGG + Intergenic
1030494567 7:110282582-110282604 AGTGAAAATGTATGTCTAAATGG - Intergenic
1030497873 7:110321845-110321867 AGAAAAAATGTATGAAGAGATGG + Intergenic
1030852145 7:114501574-114501596 AGATAAAGTGTATCATGAAAAGG + Intronic
1030889945 7:114987043-114987065 AGAGAATGTGAAGGAATAAAAGG + Intronic
1030934555 7:115569058-115569080 ATTGAATGTATATGAATAAATGG - Intergenic
1031204664 7:118741471-118741493 AGAGAAATTGTATGTATTTATGG - Intergenic
1031507346 7:122602003-122602025 ACAAAAAATGTATAAATAAAAGG + Intronic
1031812987 7:126395201-126395223 AGGGAAAGAGTATGAGGAAAAGG + Intergenic
1032569170 7:132981785-132981807 AGATAATGGGTAAGAATAAATGG + Intronic
1033082039 7:138307524-138307546 AGAGTAAATAAATGAATAAATGG - Intergenic
1033250618 7:139755388-139755410 ACACAAAGTGTATAAACAAAAGG - Intronic
1033432849 7:141304881-141304903 GGAGATTGTGAATGAATAAAAGG - Intronic
1033998658 7:147385499-147385521 AGAGAAATTGTCAAAATAAAGGG + Intronic
1034066807 7:148144854-148144876 AGAGAGAGTGAGCGAATAAAAGG - Intronic
1034296551 7:149977942-149977964 AGAAACAGTGTATGTATCAATGG + Intergenic
1034685963 7:152971721-152971743 AGAAATAATGTATGAACAAATGG - Intergenic
1034809480 7:154118883-154118905 AGAAACAGTGTATGTATCAATGG - Intronic
1035721304 8:1795446-1795468 AGAGAGAATGTATGAAAGAATGG - Intergenic
1036013264 8:4751876-4751898 TGAGAAAGTGGATGATTAATTGG - Intronic
1036762825 8:11522621-11522643 TTAGAAAATGAATGAATAAAAGG + Intronic
1036978771 8:13445100-13445122 AGAGAAAGTGTGTGACAAAGAGG + Intronic
1037034582 8:14149926-14149948 AAAGACAGTCTATCAATAAATGG + Intronic
1037044762 8:14284546-14284568 AGATTATCTGTATGAATAAAGGG - Intronic
1037195495 8:16184206-16184228 AAAGAAAGTATAATAATAAAAGG - Intronic
1037455375 8:19058290-19058312 GGAGAAAGTATAAGTATAAAGGG + Intronic
1038030086 8:23630526-23630548 AGATAAAGAGTATAAATAAAGGG + Intergenic
1038352239 8:26787526-26787548 GGTGAAAGTGTAGGAATAAAAGG + Intronic
1038904552 8:31884552-31884574 AGAGAAAGTGAAGGCAAAAAGGG - Intronic
1040089735 8:43385642-43385664 AGAGAAAGAGAATCAATAAATGG + Intergenic
1041252791 8:55950763-55950785 AGAGAAAGTGAAACATTAAAAGG + Exonic
1041350556 8:56943953-56943975 AGGGAAAATATATGACTAAATGG + Intergenic
1041507794 8:58620538-58620560 AGAGAAAGTGATACAATAAAAGG - Intronic
1041919924 8:63169316-63169338 AGAAAAAGTGTGTTAATCAAAGG - Intronic
1042226908 8:66521374-66521396 AGAGTAAGTGAATGAAGGAATGG + Intergenic
1043637907 8:82410105-82410127 AGAGAATATGTATAAATAACTGG + Intergenic
1043941747 8:86204235-86204257 CTAGAAAGTGAATGGATAAAAGG + Intergenic
1044067099 8:87712268-87712290 CGAGAATTTGTAAGAATAAAAGG + Intergenic
1044770875 8:95632446-95632468 ATGGAAAGTCTATGATTAAAAGG - Intergenic
1045058592 8:98392151-98392173 AGAGAAAGTCAAGTAATAAAAGG - Intergenic
1046233379 8:111387830-111387852 AGAGAAAGAGTAAGTAGAAATGG + Intergenic
1046346844 8:112940445-112940467 AAAGAAAGTCTATGAATATAAGG + Intronic
1046533981 8:115484975-115484997 AGAGAAAGTGTATGTACAGGAGG - Intronic
1046705253 8:117442149-117442171 AGAGACAGACAATGAATAAATGG - Intergenic
1047011528 8:120678104-120678126 AGTGAAAGTGTGCGCATAAAGGG + Intronic
1048130270 8:131688487-131688509 AGAGAAAGTCTATGGAGACAAGG + Intergenic
1048283018 8:133119233-133119255 GGAGAAAGCGGATGAATAATGGG - Intronic
1048884223 8:138896580-138896602 TGAGGAAGTAAATGAATAAAAGG + Intronic
1049524241 8:143113229-143113251 ATAGAAAGAGGAAGAATAAAGGG - Intergenic
1049630327 8:143651069-143651091 AGAGAGAGTGTATGAATGTAAGG + Exonic
1050045602 9:1541632-1541654 AGTGAAAGTGGAAGATTAAATGG - Intergenic
1050548463 9:6728896-6728918 AAAAAAATTGTATGAAAAAAAGG + Intronic
1050644468 9:7703861-7703883 AGAGAGAGAGAATGAATGAATGG + Intergenic
1051095632 9:13462401-13462423 ATAGGCAATGTATGAATAAATGG - Intergenic
1052221777 9:26032771-26032793 TGAAAAAGTGTAAGAAAAAATGG - Intergenic
1052430800 9:28364284-28364306 AGAGAAAGCATCTGAAAAAAAGG - Intronic
1052722828 9:32193110-32193132 AGAGAACAAGTATTAATAAAGGG - Intergenic
1052908845 9:33861828-33861850 AAAGAAAGTGGATCAACAAATGG - Intronic
1053538158 9:38946575-38946597 AGAGTAAATAAATGAATAAATGG - Intergenic
1054627976 9:67417346-67417368 AGAGTAAATAAATGAATAAATGG + Intergenic
1054721439 9:68608074-68608096 AGAGAAAATATATGAAACAATGG + Intergenic
1054755725 9:68955810-68955832 AAAGAATGTGCATGAATTAATGG - Intronic
1055181931 9:73399274-73399296 ATAGAAAGTCAATGAAAAAATGG - Intergenic
1055303831 9:74908535-74908557 AGACCAAGGGTATGAAAAAAAGG + Intergenic
1055378742 9:75682854-75682876 AGAGAGAATGTATGAGTGAAGGG + Intergenic
1056450504 9:86712243-86712265 TGAGTAAGTGAATGAATAAACGG + Intergenic
1056662538 9:88555187-88555209 TAAGAAAGTAAATGAATAAAAGG + Intronic
1057479234 9:95431204-95431226 AGAGATGGTATATGAATAAGAGG + Intergenic
1057536037 9:95907732-95907754 AGAGGCAGTGTCTGCATAAAAGG - Intronic
1058121390 9:101143046-101143068 GGAGAAAGTGGATGGATCAATGG + Intronic
1058914783 9:109555254-109555276 ATAAATAGTGAATGAATAAAAGG + Intergenic
1059645101 9:116258098-116258120 AGATAAACTGTGTGCATAAATGG + Intronic
1059928175 9:119233570-119233592 AAAGAAAGAACATGAATAAAGGG - Intronic
1059958910 9:119546136-119546158 AGAACAAATGAATGAATAAATGG - Intergenic
1060499390 9:124141559-124141581 AAAGAAAGTAAAGGAATAAAAGG - Intergenic
1060752508 9:126182701-126182723 TGAGGGAGTGAATGAATAAACGG + Intergenic
1061828970 9:133278467-133278489 AGAGGAAGGGAAGGAATAAAAGG + Intergenic
1203731621 Un_GL000216v2:96908-96930 AGAGAAATTGTTTGGATATAGGG - Intergenic
1185907415 X:3948887-3948909 AGATAGAGTGCATGAATAGAAGG + Intergenic
1186575588 X:10762177-10762199 AGAGAAAGTCTATTAATACTTGG + Intronic
1187168895 X:16831547-16831569 AAATACAGTGTAAGAATAAAGGG - Intronic
1187355541 X:18567021-18567043 TGAAAAAGTTTATGAATAATTGG - Intronic
1187498048 X:19813366-19813388 AGAAAAATTGTATTAATATAAGG + Intronic
1188397332 X:29701822-29701844 AGAGAAAGAGTGAGAATAAAGGG + Intronic
1188504887 X:30871871-30871893 TGATATAGTGTATGAATAAAAGG + Intronic
1188815626 X:34710281-34710303 AGAAAAACTGTATGATTCAATGG - Intergenic
1188980760 X:36724930-36724952 AGAGAAAGTGAATGGCTAGAGGG + Intergenic
1188983894 X:36752532-36752554 ACAGAAAGTGCATGAATGGAGGG + Intergenic
1189530005 X:41870058-41870080 AGAGAAAATCTATGAGGAAATGG + Intronic
1189710772 X:43809356-43809378 AGAGTAAATGTGTGAGTAAATGG + Intronic
1190451970 X:50591246-50591268 AGGGTAGGTGTATAAATAAATGG - Intergenic
1190993099 X:55572901-55572923 ACAGAAAGAATATCAATAAAGGG + Intergenic
1191886360 X:65892723-65892745 GGAGAAAATGCATCAATAAATGG - Intergenic
1192606383 X:72523456-72523478 AAAGAAAGTGTTTTAAGAAACGG - Intronic
1192716507 X:73647862-73647884 AGTCAAAGTGCATGATTAAATGG + Intronic
1193184222 X:78493204-78493226 AGAGAAAGTCTGAGAGTAAATGG + Intergenic
1194319493 X:92426072-92426094 AGAGAAATTGTATGAGTTCAAGG + Intronic
1195038668 X:100993530-100993552 AGAGAAAGTGGATGGGAAAAAGG + Intergenic
1195139959 X:101949418-101949440 AGAGGAAGAGGATGAATAAGGGG + Intergenic
1195418294 X:104643977-104643999 AGGGAAAGTGTAAGGATTAAAGG + Intronic
1195709465 X:107762466-107762488 AAAGAAAGTGTATGTGTGAAAGG - Intronic
1195863526 X:109406424-109406446 AGAGAAATTGGATGAAAGAAAGG + Intronic
1196241461 X:113346995-113347017 AAAGAAAGTGGATGAATCCAGGG - Intergenic
1196882834 X:120214225-120214247 AGAGAAATTTAATGAAGAAATGG + Intergenic
1197379341 X:125720689-125720711 AGAGAATGTGTAACTATAAAGGG + Intergenic
1197442513 X:126509607-126509629 AGGGTAAGTGAATAAATAAATGG - Intergenic
1198423359 X:136490756-136490778 AGAGTAAGTATTTCAATAAATGG + Intronic
1198670174 X:139071685-139071707 GGAGAAATTCTATGAATAACAGG - Intronic
1198916042 X:141672703-141672725 AGAGAAAGGGGTTGAATAGAAGG + Intronic
1199041728 X:143122198-143122220 AAAGAAAGTATAGGAATAAGAGG - Intergenic
1199207064 X:145161045-145161067 AGAGACAGTGAATGACTCAAGGG + Intergenic
1200627620 Y:5539148-5539170 AGAGAAATTGTATGAGTTCAAGG + Intronic
1201525615 Y:14930208-14930230 AAAGAAAATGTAGGCATAAAAGG + Intergenic
1201551774 Y:15225129-15225151 AGAGAAAGGGGATGAATGATGGG + Intergenic
1201592966 Y:15635982-15636004 AGTGAAAGAGTAAGAGTAAAAGG + Intergenic
1201694558 Y:16810704-16810726 TAAGAAAGTGAAGGAATAAAAGG + Intergenic