ID: 976116377

View in Genome Browser
Species Human (GRCh38)
Location 4:81732647-81732669
Sequence ACCAAAGAGAACTCCAGATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 233}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976116377 Original CRISPR ACCAAAGAGAACTCCAGATA TGG (reversed) Intronic
901119895 1:6882783-6882805 ACAATAGAGAAGTCCAGACATGG + Intronic
903248030 1:22030895-22030917 GCCAAAGAGAGATCCAGACATGG - Intergenic
903423930 1:23238987-23239009 AACAAAGACAACTCCATATGAGG - Intergenic
904825774 1:33272816-33272838 ACCAAAGAGAGCTGCAGACCAGG - Intronic
904915082 1:33964375-33964397 TTCAAAGAGAATTACAGATATGG - Intronic
905501065 1:38437311-38437333 ACAAAAGAAAACTCCAGACCTGG - Intergenic
905727727 1:40268646-40268668 AAAAAAGGGAACTACAGATATGG + Intronic
907826417 1:58021485-58021507 TCCAAATAAAACTCCAGAAAGGG + Intronic
909104757 1:71393891-71393913 ACCACAGAGAACTCCCATTAGGG + Intergenic
910350333 1:86289021-86289043 AGCAAAGAGAACTACAGTCAGGG - Intergenic
911780047 1:101865095-101865117 ACCAAAGTGAATTCTACATAAGG - Intronic
912441604 1:109703322-109703344 GCAAAATAGAACTCCTGATAAGG - Intronic
913029908 1:114891674-114891696 AGCAAAGATAGATCCAGATATGG - Intronic
915026972 1:152840284-152840306 ACCAAAGAGAAACCCAGTCATGG + Intergenic
916012729 1:160720582-160720604 ACCAGAGAGGAATGCAGATAAGG - Intergenic
916640331 1:166721510-166721532 CCCAGAGAGAAGTTCAGATAAGG - Intergenic
918175972 1:182045541-182045563 ACAAAACAGAACTACTGATAAGG + Intergenic
918335844 1:183511969-183511991 TACAAAGAGAACTAGAGATAGGG + Intronic
918378989 1:183936106-183936128 TCCCAAGAGAAATCCAGACAGGG + Exonic
918589586 1:186225366-186225388 ACCAGACAGAAATGCAGATAAGG - Intergenic
919730109 1:200908423-200908445 ACAAAAGATAACTGCAGACATGG + Intronic
920081319 1:203375316-203375338 ACTAAAGAGAACTAAAAATAGGG - Intergenic
922284403 1:224156295-224156317 ACCACAGAGAATTCCTGACATGG - Intronic
923432913 1:233940790-233940812 ACCAAAGAGAAATCTACACAAGG - Intronic
1064154626 10:12893898-12893920 AAAAAAGAGAACTCTAGATCTGG - Intergenic
1064590210 10:16882633-16882655 ACCAAAGAGGACTAGAGATGAGG + Intronic
1065316691 10:24470782-24470804 ACCAATGAGAAGTGCAAATAAGG - Intronic
1066157773 10:32696713-32696735 ACCAAAGAGATCTCTAGGTTTGG - Intronic
1066452860 10:35547444-35547466 GCCAAAGAGACCTTCAAATAAGG - Intronic
1067464039 10:46480820-46480842 ACCAGACAGAAGTACAGATAAGG - Intergenic
1067623156 10:47903831-47903853 ACCAGACAGAAGTACAGATAAGG + Intergenic
1069399991 10:68034011-68034033 TCCAAAGATAGCTCCAGAAAGGG + Exonic
1069649244 10:70032245-70032267 ACCACAGAGCAATGCAGATAGGG - Intergenic
1070591681 10:77806266-77806288 ACCACACAGAAGTCCAGACAGGG + Intronic
1071393897 10:85202628-85202650 ACCACAGAAAACTCCAGAATGGG - Intergenic
1071563166 10:86658499-86658521 GCCAAAGAGAGCTCCACAGAAGG - Exonic
1074311501 10:112326897-112326919 AACAAAGAGAACTAAAGAGAGGG + Intergenic
1075190118 10:120299559-120299581 ACCACAGAGAACACTAGATTCGG + Intergenic
1075965957 10:126611794-126611816 CCCAGAGAGAACCCCAGAAATGG - Intronic
1077639824 11:3871373-3871395 ACCAAAGAGACGACCAGATAAGG - Intronic
1078459194 11:11500475-11500497 ACCAAAAACATCTCCAGACATGG - Intronic
1079089972 11:17473990-17474012 ACCAAAGAGAAAAGCAGGTAGGG - Intronic
1082853380 11:57785077-57785099 ACAAAATAAAACTCCAGATTAGG - Intronic
1085451597 11:76637394-76637416 ACCAATGAGATGGCCAGATATGG + Intergenic
1086951711 11:92897555-92897577 ACCAGGAAGAACTCCAGAAAGGG + Intergenic
1087022855 11:93620876-93620898 ACATAAGAGACCTTCAGATAGGG + Intergenic
1088371491 11:109093133-109093155 ACCATAGAGAAAGCTAGATAGGG - Intergenic
1089282360 11:117383128-117383150 ACCAAAGCTAACCCCAGGTAAGG - Intronic
1089423552 11:118350585-118350607 AGCAAAGAGAAAGCCAGATATGG - Exonic
1089473976 11:118743502-118743524 ACCAAAAATATCTACAGATAAGG + Intergenic
1089798482 11:121003331-121003353 AACAAAGAGAACTCCAGAGCAGG - Intergenic
1091427773 12:406361-406383 AGCAAAGAGAACTGTAGGTACGG + Intronic
1095246999 12:39934780-39934802 ACCTTAGAGAACTACATATAAGG - Intronic
1096042170 12:48527314-48527336 ACCTAAGAGAACTTCAGAGAGGG + Intronic
1096127556 12:49131018-49131040 ACAAAAGAGAGCTCCGGATACGG + Intronic
1096384996 12:51189490-51189512 ACCCAGGAGAACTCCAGAACAGG + Exonic
1096543932 12:52324053-52324075 AACAAAGAGAACTGCAGACCAGG + Intergenic
1097356578 12:58608877-58608899 GCCAAAGAGTAGTCCAGAAAAGG - Intronic
1098446986 12:70576142-70576164 ACCAAAAAGTACTCCATAAACGG + Intronic
1101729948 12:107418706-107418728 ACCCAAGAGAACTGCAAAGAAGG - Intronic
1102105290 12:110316152-110316174 ACCAAAGAGAACTACCAAGATGG - Intronic
1102690928 12:114760452-114760474 AACAAAGAAAGCTCCAGATCCGG + Intergenic
1103389682 12:120562914-120562936 GCCAGAGAGAACACCAGAGAAGG - Intronic
1104576193 12:129968028-129968050 ACCAAAGTGAGCTCCAGTCAGGG + Intergenic
1105879663 13:24593008-24593030 ACCAAAGATAGCTCAAGTTATGG - Intergenic
1108156718 13:47592531-47592553 ACCACAGAGAGCTCCAATTAGGG - Intergenic
1109602510 13:64650455-64650477 ACTGAAAAGAACTCCAGATAGGG + Intergenic
1109609218 13:64741193-64741215 ACCAGACAGAAGTGCAGATAAGG - Intergenic
1110252066 13:73391476-73391498 ACCAAAGAGAAATATAGATAAGG + Intergenic
1112614596 13:100990380-100990402 ACCAAACATATCTCCAGATGTGG - Intergenic
1113002238 13:105654656-105654678 ACCAAAGATAACCAGAGATAAGG + Intergenic
1113396182 13:109949834-109949856 ATCATAGAGAACTCCCCATAAGG - Intergenic
1114565119 14:23625190-23625212 ACCAGACAGAACTGCAGATAAGG - Intergenic
1114809096 14:25874812-25874834 AAAAAGGAAAACTCCAGATAGGG - Intergenic
1115767609 14:36639684-36639706 ACCAATGAGAATTCCACATGGGG + Intergenic
1115863138 14:37711958-37711980 TTCAAAGAGAACTCTAGAAAGGG + Intronic
1117301663 14:54435694-54435716 ACCAAAGATAAAACTAGATATGG + Intronic
1119126430 14:72131415-72131437 ACAAAATAAAATTCCAGATAAGG - Intronic
1119656118 14:76418345-76418367 ACAAAAGTGAAAACCAGATAAGG - Intronic
1119830400 14:77697039-77697061 GCCAAAGAGACCTCCAGAAGAGG + Intronic
1119939012 14:78620501-78620523 ACCACATAGAACAGCAGATATGG + Intronic
1121003903 14:90474349-90474371 ACCAGACAGAAGTGCAGATAAGG - Intergenic
1121610985 14:95279438-95279460 ACCAGACAGAAGTGCAGATAAGG - Intronic
1122226349 14:100282600-100282622 ACCAAGGACAATTCCAGAAATGG - Exonic
1124063323 15:26316548-26316570 TCCAAAGAGAACTTCTGTTAGGG - Intergenic
1125116015 15:36092567-36092589 ACCAAAGAGAATTTAAAATAAGG - Intergenic
1125922664 15:43534810-43534832 TCCACAGAGAACTCCTGGTATGG + Exonic
1129139563 15:73584970-73584992 ACCACAGATAACTCAAGATTTGG + Intronic
1132029576 15:98428936-98428958 ACCAAAAATATCTCCAGACATGG + Intergenic
1133397877 16:5462766-5462788 ACCAAAAAGGACTCCAGAAGAGG - Intergenic
1135015884 16:18925457-18925479 ACAAAACAAAACTCCAGCTAAGG - Intronic
1137572163 16:49573857-49573879 AGCAAAGAGAAGCCCAGAGAGGG - Intronic
1140752050 16:78033716-78033738 ACCAAAGAGAAGTCTAGGTTAGG - Intronic
1140908797 16:79432575-79432597 ACAAAACAAAACTGCAGATAAGG + Intergenic
1142731446 17:1861179-1861201 TACACAGAGAACTCCAGAAATGG - Intronic
1143994648 17:10996228-10996250 AACAAAAAGAACTCCAGTAAGGG - Intergenic
1145147869 17:20495742-20495764 ACCAAAGAAAAAGCCAGAGAGGG + Intergenic
1146127369 17:30239602-30239624 GCTAAAGGGAACTCCAGACAAGG + Intergenic
1146436966 17:32859252-32859274 ATAAAAGAGAGCTCCAAATATGG - Intronic
1149034237 17:52116213-52116235 ACAAAAGTTAACTCCTGATAGGG - Intronic
1149483986 17:57027452-57027474 CCCAGAGAGAAGTACAGATAAGG + Intergenic
1151180148 17:72321371-72321393 TCCAAGGAGAAGTCAAGATAAGG + Intergenic
1153010167 18:531447-531469 ACCAAAAAGAAGTGCTGATAAGG + Intergenic
1155850801 18:30771226-30771248 CCCAGAGAGAAATGCAGATAAGG - Intergenic
1157145286 18:45156323-45156345 ACAAAAGAGGAATCAAGATAAGG + Intergenic
1157407611 18:47436275-47436297 CCCAAAGCGAGCTCCAGAGAGGG + Intergenic
1157630665 18:49092296-49092318 ATGAAAGAGAAATCCAGATGGGG - Intronic
1159213802 18:65364107-65364129 TCCACAGAGAATTCCAGGTATGG + Intergenic
1159358080 18:67362839-67362861 CCAAAAGAAAATTCCAGATATGG + Intergenic
1159524451 18:69569211-69569233 ACCAAAGAGAATGCTAGAGAAGG + Intronic
1159941955 18:74415100-74415122 ACCAAAGACAACAGCAGAGAGGG - Intergenic
1160461012 18:79038018-79038040 ACAAAATAAAACTCCAGACATGG - Intergenic
1161714553 19:5867925-5867947 ACATAAGAGTTCTCCAGATAAGG + Intronic
1162209841 19:9082516-9082538 AACAAACAGACCTCCAGATGTGG - Intergenic
1162421337 19:10567703-10567725 ACCAAAGACGCCCCCAGATATGG + Intronic
1166023845 19:40060348-40060370 AATAAAGAGAATTGCAGATAAGG + Intergenic
1166402238 19:42491497-42491519 ACCAGACAGAAATGCAGATAAGG + Intergenic
1167569558 19:50278346-50278368 ACCAAATAGAAGCCCAGAGAGGG - Intronic
1167858031 19:52258408-52258430 ACAACAGGAAACTCCAGATATGG + Intergenic
1168629057 19:57943053-57943075 ACTGAAGAGCACTGCAGATAAGG + Intronic
924976766 2:184454-184476 GGCCAAGAGAACTCCAGAGAAGG + Intergenic
926124607 2:10264525-10264547 ACCCAAGAGACCTCCAGACAGGG - Intergenic
928102548 2:28447730-28447752 ACCAAAGAGAAAGCCTGACATGG + Intergenic
928382399 2:30830046-30830068 ACCAGACAGAAGTACAGATAAGG - Intergenic
928894811 2:36248428-36248450 ACCAAAGAGAACCGCAGGGAAGG - Intergenic
930295366 2:49547211-49547233 ATCATAGAGAACTCCTCATAAGG + Intergenic
931072676 2:58670740-58670762 CACAAAGAAAACTCCAGATCTGG - Intergenic
931570859 2:63667982-63668004 AACAAAGAGAACTGGAGAAAGGG - Intronic
931755230 2:65367958-65367980 ACAAAAAAAAAATCCAGATATGG + Intronic
932073000 2:68639316-68639338 AGGAAAGAGAACCCCAGAGAAGG + Intergenic
934104579 2:88683825-88683847 ACCAGACAGAAGTCCAGATAAGG - Intergenic
939076399 2:137607518-137607540 ACCCATGAGAACTACAAATATGG - Intronic
939426054 2:142037983-142038005 ACATAAGAGCACTCCAGATATGG - Intronic
939569731 2:143826538-143826560 ACCAAAGAGAACTCTAAAGGTGG + Intergenic
941035641 2:160566086-160566108 AATGAAGAGAACTCCAGAGATGG + Intergenic
943543736 2:189249042-189249064 GCCAAAGAGAACTGCAGAATTGG - Intergenic
945563588 2:211368547-211368569 ACCAGAGAGAATGCCAGAGAGGG + Intergenic
946979804 2:225197961-225197983 ACCAAAGAGAAGAGCACATAAGG + Intergenic
1170686131 20:18571113-18571135 ACCAATGAGAAATCAAGATGAGG - Intronic
1172190240 20:33057697-33057719 ACCAAAGAACACTGCAGTTAGGG + Intronic
1174152825 20:48498055-48498077 ACCACAGAGAGCTGCAGAAAGGG + Intergenic
1174960372 20:55149855-55149877 ACCAAGAAGAACTACAGATTTGG - Intergenic
1177097534 21:16855997-16856019 ACAAAATAAAACTCCAGAAATGG - Intergenic
1177844840 21:26277319-26277341 AGCAAAAAGTACTCCAGAAAAGG - Intergenic
1178501805 21:33131702-33131724 ACAAAAGAGAAGTCCTGAGAAGG - Intergenic
1179679453 21:43008320-43008342 ACCAAAGACAATACCAAATAAGG + Intronic
1182830342 22:33300044-33300066 ACCAAATAGAACCCCAAAAAAGG + Intronic
1185097912 22:48821800-48821822 ATGAAAGGGAACTGCAGATATGG + Intronic
949369180 3:3316543-3316565 AGCAAAGAGAAATAAAGATAAGG - Intergenic
952294936 3:32053078-32053100 ACCAGACAGAAGTGCAGATAAGG - Intronic
952915445 3:38235430-38235452 AGTAAAGAGAATTCCAGAAAAGG + Intronic
953416291 3:42720422-42720444 AGCAAACAGAAGTGCAGATAAGG - Intronic
953922008 3:46958649-46958671 CCCAACGAGAACCCAAGATAAGG + Intronic
954825971 3:53373721-53373743 ACCAAAGGGAAGTCCAGACTTGG - Intergenic
956866565 3:73374773-73374795 ACCAAAAAGAATTAAAGATAGGG - Intergenic
957737609 3:84223498-84223520 ACCAGACAGAAGTGCAGATAAGG + Intergenic
959472605 3:106771004-106771026 ACCAAAGACAACTTGAGATCAGG - Intergenic
959508343 3:107179239-107179261 AGGAAAGAGAAGTCCAGAGAAGG + Intergenic
960550223 3:118968010-118968032 ACCAAAAAGCACCTCAGATAAGG + Intronic
960827243 3:121802253-121802275 CACAAAGAGAACTCCAGGTCTGG - Intronic
963599367 3:147364586-147364608 TCCAAAGAGAACTCCAGAGAGGG + Intergenic
963858117 3:150277430-150277452 AACAAAGATAACTCCAGGAAAGG - Intergenic
963861180 3:150312190-150312212 ACCAAACAGAAACCCAGAAATGG + Intergenic
965089565 3:164145167-164145189 ACCAGACAGAAGTGCAGATAAGG - Intergenic
965588253 3:170338775-170338797 ACCACACAGAAGTGCAGATAAGG + Intergenic
967133630 3:186495021-186495043 GGCAAAGAAAACTCCAGAGATGG - Intergenic
969902960 4:10366820-10366842 ACTAAAGACTACTCCAGGTAAGG + Intergenic
970951981 4:21767032-21767054 AACAAAGAGAACACAAGAAAGGG + Intronic
971368077 4:25993565-25993587 ACCCAAGAGAACTGCAGAGAGGG - Intergenic
971520672 4:27546662-27546684 ACCAAAGATAACTCCCACTAGGG - Intergenic
971624544 4:28901876-28901898 AAGAAAGAGAACTCCAGAGCCGG + Intergenic
971786332 4:31108054-31108076 TCCAAAGAAAACTACAGAAAAGG + Intronic
973172260 4:47160416-47160438 TTCAAAGAAAAATCCAGATAAGG + Intronic
973939014 4:55884627-55884649 TCCAAAAGGAACTCCAGAGATGG - Intronic
974679463 4:65142313-65142335 ACCAAAACGTACTCCAGTTATGG - Intergenic
976116377 4:81732647-81732669 ACCAAAGAGAACTCCAGATATGG - Intronic
976285947 4:83371204-83371226 ACGAAAGAGAACACCAGGAAGGG + Intergenic
976441343 4:85078779-85078801 ACCAGAGAAAACTCAAAATATGG + Intergenic
977838555 4:101673365-101673387 ACCAGAGAGAAATGCAGATAAGG - Intronic
978249891 4:106617929-106617951 ACCAAAGAGAAGACGAGATATGG + Intergenic
978899027 4:113926513-113926535 ATCATAGAGAACTCCCCATAAGG + Intronic
992671666 5:79067466-79067488 ACAAAAGAGAACTTAAGATCAGG + Intronic
993093248 5:83452420-83452442 ACTAAAGTAACCTCCAGATAGGG + Intergenic
995096929 5:108247281-108247303 TCCAAAGATAATTCCAGAGATGG + Intronic
997145839 5:131432293-131432315 AGCAAAGAGACCACCAGATTTGG - Intronic
998260463 5:140627276-140627298 ACCAGACAGAAGTGCAGATAAGG + Intergenic
998422780 5:142002888-142002910 AGCAAACAGATCTCCAGAAATGG + Intronic
998983398 5:147728922-147728944 ACCAGACAGAAGTGCAGATAAGG - Intronic
999191312 5:149749486-149749508 TCCAAAAAGAATTCAAGATAAGG - Intronic
999777176 5:154820670-154820692 TCAAAGGAGGACTCCAGATACGG - Intronic
1000446348 5:161326790-161326812 ACCACAGAGATCTCCATTTAAGG - Intronic
1002280416 5:178126656-178126678 ACAAAAGAGAACATCAGAGAAGG - Intergenic
1003345002 6:5258980-5259002 TCCAAAGAGAATTTCAGAAATGG + Intronic
1003436224 6:6090960-6090982 ACCAACTAGAACTCCCCATAGGG - Intergenic
1003591779 6:7442508-7442530 AGAACAGAGAACTTCAGATATGG + Intergenic
1007931046 6:45690827-45690849 ACCACAGAGAACATGAGATAAGG - Intergenic
1010454271 6:76037213-76037235 AGCTAAGAGAAATCCAGACATGG - Intronic
1011051175 6:83151643-83151665 ACCAAAGAGACCTTCAGGTAAGG + Exonic
1011998715 6:93626039-93626061 ACCAAAGACAATTTCAGATTTGG - Intergenic
1013109525 6:107053919-107053941 TCCAAAGAGAAGTCCAGAGATGG - Intergenic
1013691058 6:112644128-112644150 ACCAAACAGAACTACATAAACGG - Intergenic
1015058408 6:128932408-128932430 ACCAAACAGAATGCCAGATATGG + Intronic
1015979136 6:138821295-138821317 ATCATTGAAAACTCCAGATATGG + Intronic
1017118903 6:151005533-151005555 AATAAAGAGAACTCTAGCTAGGG - Intronic
1020765567 7:12315831-12315853 ATCAAAGAGAACACCAAAAAAGG + Intergenic
1022746966 7:33182350-33182372 ACCAGACAGAAGTGCAGATAAGG + Intronic
1023587670 7:41748106-41748128 ACCAGACAGAAGTGCAGATAAGG + Intergenic
1023624638 7:42103748-42103770 ACCCAAGATAACCCAAGATAAGG + Intronic
1028192786 7:87871829-87871851 ACTAAAGAAAACTCCAGGTCTGG - Intronic
1029720270 7:102359170-102359192 TCCACAGAGAACTGCAGAGATGG - Intergenic
1033955467 7:146842339-146842361 AACAAAGTGAACACCAGAAAGGG - Intronic
1034857419 7:154564905-154564927 ACCAAATAGAACAACAGAAAAGG - Intronic
1035032084 7:155867864-155867886 ACTTAACAGAACTCCAGAGACGG + Intergenic
1035831564 8:2700164-2700186 TCCTAGGAGAACTGCAGATAAGG - Intergenic
1039266362 8:35828608-35828630 ACGAAAGAGAAAACCAGAAATGG + Intergenic
1041228663 8:55727387-55727409 ACCAGACAGAAGTACAGATAAGG + Intronic
1041864818 8:62559841-62559863 ACCAGAAAGAATTACAGATATGG - Intronic
1044525733 8:93249043-93249065 CACAAAGAGAACTTCAAATATGG + Intergenic
1045608664 8:103809188-103809210 ACAAAGGAGTATTCCAGATATGG - Intronic
1046547033 8:115666822-115666844 ACAAAAGAAAAATACAGATAGGG - Intronic
1047012291 8:120685273-120685295 ACCAAAGAGAACCCCCACTAGGG - Intronic
1049565056 8:143333895-143333917 CCCAAAGAGAGCCCCAGATGGGG - Intronic
1049874210 8:145004769-145004791 ACCAAAGAGAACTTCAATTCGGG + Intergenic
1050192115 9:3037541-3037563 ACCAAAGAGAAAATGAGATAAGG + Intergenic
1050260069 9:3831932-3831954 CCCAAAGACAACTATAGATATGG - Intronic
1050877920 9:10663642-10663664 CCCCAAGAAAAATCCAGATATGG - Intergenic
1051829411 9:21258598-21258620 ACCAGACAGAAATGCAGATAAGG - Intergenic
1052663565 9:31467158-31467180 ACCAGGGAGAAGTGCAGATAAGG + Intergenic
1056831972 9:89924564-89924586 ACCAGAGAAGACTCCAGTTAGGG + Intergenic
1056923275 9:90810583-90810605 ACCAGGGAGCTCTCCAGATATGG + Intronic
1056977687 9:91274707-91274729 ATGAAAGTGAACTTCAGATAAGG + Intronic
1057399384 9:94709591-94709613 TCGAAAGAGAACTCCAGGGAGGG - Intergenic
1059877137 9:118647355-118647377 ACCACAGAGAGCTCCAACTAGGG + Intergenic
1060306679 9:122419950-122419972 ATCAGAGAGAAGTGCAGATAAGG + Intergenic
1186159257 X:6759578-6759600 ACCAAAAATGATTCCAGATATGG + Intergenic
1186835154 X:13430277-13430299 ACCAAAGAGAATACCTGCTAAGG - Intergenic
1187003452 X:15206237-15206259 CCCAAGAAGAACTCCAGATCTGG - Intergenic
1187359161 X:18608856-18608878 GTCAAAGAGACCTCCAGAGAAGG + Exonic
1189073018 X:37885286-37885308 ACCAGACAGAAGTGCAGATAAGG + Intronic
1189096939 X:38150433-38150455 ACCAAAAATATCTCCAGACATGG - Intronic
1189531073 X:41883778-41883800 CCCAAAGAGCATTTCAGATAGGG + Intronic
1190282765 X:48941868-48941890 ACCAAGGAAACCTCCAGATAAGG + Intronic
1190452477 X:50595491-50595513 ACCAAAGAAATCTCCTGAAATGG - Exonic
1192712966 X:73610699-73610721 AACAAAGAAAACTCCAGGAATGG - Intronic
1193330965 X:80235508-80235530 ACCAGACAGAAGTGCAGATAAGG + Intergenic
1193420154 X:81272881-81272903 CTCAAAGAGAAATTCAGATACGG - Intronic
1195219815 X:102736007-102736029 ACCAGACAGAAGTGCAGATAAGG + Intronic
1195806254 X:108770471-108770493 AAAAAAGAGAACTACTGATAAGG + Intergenic
1196810866 X:119628088-119628110 AACAAAAAGAACTGCAGCTACGG - Intronic
1199271302 X:145885625-145885647 ACCAAAAACATCTCCAGATATGG + Intergenic
1199935081 X:152565356-152565378 AACAAAGAGAACACTGGATAAGG + Intergenic
1200021269 X:153211823-153211845 ACAAAACAGAACTACTGATAAGG + Intergenic
1201552963 Y:15238043-15238065 ACCAAAAATGATTCCAGATATGG + Intergenic
1201685923 Y:16702448-16702470 AAGAAAGAGAACACCATATAAGG - Intergenic