ID: 976117234

View in Genome Browser
Species Human (GRCh38)
Location 4:81740935-81740957
Sequence CCATCAGAGGTTTTTGCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 154}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976117234_976117242 29 Left 976117234 4:81740935-81740957 CCCCAAGCAAAAACCTCTGATGG 0: 1
1: 0
2: 0
3: 15
4: 154
Right 976117242 4:81740987-81741009 CATAGAAGAGCCTCCCCATCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976117234 Original CRISPR CCATCAGAGGTTTTTGCTTG GGG (reversed) Intronic