ID: 976118046

View in Genome Browser
Species Human (GRCh38)
Location 4:81749516-81749538
Sequence GATGCTAATTTTAAGATGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 5, 3: 14, 4: 213}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976118042_976118046 21 Left 976118042 4:81749472-81749494 CCTATATACTCAATAAAGAGTTC 0: 1
1: 0
2: 0
3: 12
4: 155
Right 976118046 4:81749516-81749538 GATGCTAATTTTAAGATGATGGG 0: 1
1: 0
2: 5
3: 14
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976118046 Original CRISPR GATGCTAATTTTAAGATGAT GGG Intronic
904550867 1:31316404-31316426 GATGCTACTTTTAAGTTTGTTGG + Intronic
906947071 1:50303788-50303810 GGTGATAATTTCAGGATGATGGG + Intergenic
907478947 1:54730318-54730340 TATGCTAAGTTTGAGATGAAGGG - Intronic
907723195 1:56993298-56993320 GAGTCTAATTTTAAAATAATTGG - Intergenic
908007393 1:59741123-59741145 GATTTTATTTTTAAGATGAAAGG - Intronic
908081069 1:60578913-60578935 GATCCTAATTGTATGATGGTAGG + Intergenic
908751275 1:67426134-67426156 GAGGCGAATTTTCAGTTGATAGG - Exonic
909354065 1:74686710-74686732 GATTTTAATTTTAATATGTTTGG + Intergenic
909381823 1:75007070-75007092 GATGTAAATTTTAAAATGAAGGG - Intergenic
910467133 1:87512021-87512043 GCTACTAATTTTAAGACAATAGG - Intergenic
915226238 1:154413691-154413713 AATGCTAATTTTATTTTGATTGG + Intronic
915669307 1:157474914-157474936 GATTCTAATTTAAAAATAATAGG + Intergenic
916397229 1:164404400-164404422 TATGCTAATTTAAAAATGAGGGG + Intergenic
917029744 1:170676637-170676659 AAAGCCAATTTTAAGAAGATAGG + Intronic
917287734 1:173439388-173439410 GAGTCTAATTTTGAGATGTTGGG - Intergenic
919363243 1:196622191-196622213 GATGCTAATTTTCAAATAATTGG + Intergenic
919430876 1:197489655-197489677 AATGCTAATATTAAGATGTGAGG - Intergenic
921435738 1:215118876-215118898 GATTCTACTTTTAGGATGATAGG + Intronic
921878153 1:220222848-220222870 GATGATCATTTTTAGATGTTAGG + Intronic
922083958 1:222327217-222327239 GATGGTAATTTTAAAAAGAGGGG - Intergenic
923248706 1:232159779-232159801 GATACTAAATCTGAGATGATGGG + Intergenic
1063724072 10:8617417-8617439 AATGCTAATGTTAAGGTGCTTGG + Intergenic
1064958416 10:20937331-20937353 GATGCTTATTTTAAGTTGGGAGG - Intronic
1064970384 10:21060081-21060103 GCTGCTATTTTTTAGATGACCGG - Intronic
1065559627 10:26949452-26949474 GATGATAATTATAAGAAAATAGG - Intergenic
1068044214 10:51864399-51864421 GATGATAATTTTAAAAAGTTTGG + Intronic
1069087744 10:64160999-64161021 TTTCCTAATTTTAAGATGCTGGG + Intergenic
1069214854 10:65806723-65806745 GGTGCTCATTGTGAGATGATTGG - Intergenic
1070397245 10:76022067-76022089 GATACTAATCTTAAGATATTTGG + Intronic
1070497592 10:77038513-77038535 GATGTTGAGTTTAAGATGAACGG - Intronic
1071710743 10:88046611-88046633 GAGGCTAATATTTATATGATAGG + Intergenic
1072592168 10:96836432-96836454 GATGCTGTTTTTAGGATGAAGGG + Intronic
1075478745 10:122760483-122760505 GATGCAAGCTTTAAGATGAAGGG - Intergenic
1079311076 11:19366450-19366472 GATGCTAGTTTGCAGATGAAGGG + Intronic
1080476248 11:32594239-32594261 GACCCTAATTTTAAGGTTATAGG + Intronic
1080607418 11:33875271-33875293 GATTCTAACTTTAAAATGTTTGG + Intronic
1080840026 11:35975610-35975632 GACTCTAATTAAAAGATGATGGG + Intronic
1080974888 11:37327022-37327044 GATGGGAATTTTAAACTGATTGG - Intergenic
1082901446 11:58257510-58257532 GATGCTTATATGATGATGATGGG - Intergenic
1085586972 11:77717780-77717802 GATGAGAATTTTAATATGACTGG - Intronic
1085991162 11:81846413-81846435 AATGATAAGTTTGAGATGATGGG + Intergenic
1086816226 11:91374946-91374968 GATGCTACTTTGAAGTAGATGGG - Intergenic
1089237829 11:117047972-117047994 AATACTAATATTAAGATGAATGG - Intronic
1097216225 12:57415496-57415518 GATGATACTTTTAAGATTTTGGG - Intronic
1097589685 12:61559161-61559183 GATGCTAATTTTATTTTGAAGGG + Intergenic
1099064612 12:77958432-77958454 GATGCTAATATTAAGTATATAGG + Intronic
1099977098 12:89557557-89557579 GATGCTTATTTTGAGCTTATCGG + Intergenic
1102187650 12:110962107-110962129 GATGGTTATATTATGATGATTGG + Intergenic
1105059444 12:133135091-133135113 GAAGCTCTTTTTAAGATGTTAGG - Intronic
1106274021 13:28186345-28186367 TATGTTAATTTTGAGATAATAGG + Intronic
1106676895 13:31969647-31969669 GATAATAATTTTAAGATGCTTGG - Intergenic
1107327598 13:39261738-39261760 GATGCTGATTTCCTGATGATGGG + Intergenic
1107419271 13:40231596-40231618 GATACTGATTTCAAGATGAGAGG + Intergenic
1108018957 13:46105705-46105727 GATGCTACTTTCAAGATGATAGG - Intergenic
1108080475 13:46729608-46729630 GGTGCTAACTTTAAGACTATAGG + Intronic
1108852559 13:54751241-54751263 GATGTTAATATTAAGAGGAAAGG + Intergenic
1109532291 13:63665397-63665419 GATGCTAATTTTTAATTTATTGG + Intergenic
1109796567 13:67321542-67321564 CATGTTAATTATAGGATGATTGG + Intergenic
1111112832 13:83736631-83736653 GATGGTATTTTTAACATTATTGG - Intergenic
1111706031 13:91750501-91750523 GATTCTAAATTTAAGTTGCTGGG - Intronic
1112049697 13:95633129-95633151 GATGCTTCTTTTAAGAGGACTGG + Intronic
1112476212 13:99733000-99733022 GAAGCTAATTTGAAGGTAATTGG + Intronic
1113032650 13:106011537-106011559 GATGATAATTCAGAGATGATTGG + Intergenic
1113194667 13:107788177-107788199 TAAGCTAATTTTGGGATGATAGG - Intronic
1114263274 14:21054897-21054919 GATGCTAATTAAATGATGCTTGG + Intronic
1115020084 14:28668704-28668726 CATGCTAATGTTAAGATCAGAGG - Intergenic
1115493160 14:33978410-33978432 GAAGCCAATTTTGAGTTGATGGG - Intronic
1116116094 14:40652884-40652906 AATACTAATTTTAAGAGGAGGGG + Intergenic
1116260709 14:42621488-42621510 GATGCTTATTTTAGGATGGTTGG + Intergenic
1116608982 14:47042034-47042056 CATGCTTATTTTAAGATTCTTGG - Intronic
1117537611 14:56717014-56717036 GATGGCATTCTTAAGATGATTGG + Intronic
1117904298 14:60568337-60568359 GATGCCAAAATTAAGAGGATAGG + Intergenic
1118574467 14:67227794-67227816 GATGTTAAGATTAAGATTATGGG - Intronic
1120345455 14:83283820-83283842 AATACTAACTTTAAGTTGATTGG + Intergenic
1120568745 14:86091864-86091886 GCTGCTAATTTTAACAAGAAAGG + Intergenic
1121409383 14:93738698-93738720 GATGGTACTTTTAAGATGGGGGG - Intronic
1121966833 14:98315296-98315318 TTTGCTAATTTTAAGAAGACAGG + Intergenic
1123206900 14:106722354-106722376 CATTTTAATTTTAAGATCATTGG + Intergenic
1123211918 14:106769358-106769380 CATTTTAATTTTAAGATCATTGG + Intergenic
1123402166 15:19998133-19998155 AATTTTAATTTTAAGATCATTGG + Intergenic
1123511507 15:21004800-21004822 AATTTTAATTTTAAGATCATTGG + Intergenic
1125276763 15:38001537-38001559 GATACAAATTTTAAAATGACAGG - Intergenic
1126289340 15:47055825-47055847 AATGCTATTTTTCAGCTGATGGG - Intergenic
1127744839 15:61956767-61956789 AATGCTAAATTTAAAAAGATTGG + Intronic
1135503767 16:23019016-23019038 GATGCTAAATTTTAGAGGAAAGG - Intergenic
1135742327 16:24986458-24986480 AATGGTTATTTTAAAATGATTGG + Intronic
1138545218 16:57714945-57714967 AATGCTAATTTGAAGATGTAGGG + Intronic
1138884872 16:61064451-61064473 GATTTTAATTTTAAGATGCCAGG - Intergenic
1146350824 17:32091941-32091963 CATGGTCATTTCAAGATGATGGG + Intergenic
1146579067 17:34020889-34020911 GTTGCTAAGTTTATGGTGATTGG + Intronic
1147513207 17:41090824-41090846 TAAGCTACTTTTAAAATGATTGG + Intronic
1150179359 17:63099694-63099716 CATTCTAATTTTAGGATAATAGG + Intronic
1151629456 17:75300684-75300706 GAAGCTAATTTTCAGATTTTTGG + Intergenic
1152050033 17:77966554-77966576 GAAGCTAATATTAAGATATTTGG + Intergenic
1156805190 18:41169972-41169994 GATGCAAAAATTAAAATGATTGG + Intergenic
1157216225 18:45785874-45785896 GATATTTATTTTAAAATGATAGG - Intergenic
1157800120 18:50612639-50612661 GATGCAAATTCTAAGAAGACAGG + Intronic
1158614940 18:58978565-58978587 GGGGCTAATTTTAGGAGGATGGG - Intronic
1159138350 18:64363092-64363114 GTTGAGAATTTTAAGATGAAGGG - Intergenic
1159739898 18:72154523-72154545 GCTGCTAATTTTAGGGTAATTGG - Intergenic
1159766281 18:72492764-72492786 GGAGCTATTTTTAAGCTGATAGG + Intergenic
1160398412 18:78589309-78589331 GACTCTAATTTTAAAATGAATGG - Intergenic
1163070422 19:14835909-14835931 GATGGAAATTTTCAGATGTTGGG - Intergenic
1165666307 19:37631607-37631629 GAAGGTAATTTTAAGGTGTTGGG + Exonic
1166462717 19:43003450-43003472 TATCCTAATTTTAAGATGTAAGG + Intronic
925677476 2:6379559-6379581 GATTAAAATTTTAAAATGATGGG + Intergenic
927226630 2:20772501-20772523 AATCCTAATTTTAGAATGATGGG + Intronic
927911640 2:26904002-26904024 AATGCTAATTTTGAGTTGGTGGG - Intronic
929172113 2:38942579-38942601 GATGCTATTTTTAAAAAGAGAGG - Intronic
929703064 2:44181545-44181567 GATGCTAAAATTAGGATGGTAGG + Intronic
930430824 2:51273866-51273888 AATACTCATTTTAAAATGATTGG - Intergenic
931647226 2:64435458-64435480 GTTGATTTTTTTAAGATGATAGG + Intergenic
932053328 2:68420149-68420171 GATGCTATTTTGAATATAATGGG + Intergenic
936038492 2:109130387-109130409 GATGCTAAGTTTAAGAGGCAGGG - Intronic
936717069 2:115199723-115199745 GATGATGATTTTAAAAAGATAGG + Intronic
938877750 2:135551122-135551144 GATAATAGTTTTAAGATCATAGG + Intronic
940831446 2:158470821-158470843 GATGCTAATTTTAAAAAGATTGG + Intronic
940831799 2:158474802-158474824 GATGCTAATTTTAAAAAGATTGG - Intronic
941073232 2:160978349-160978371 GAATCTAATTTTAAGGTGTTTGG - Intergenic
944331394 2:198470689-198470711 GATTCAAATTGTATGATGATGGG + Intronic
1170528727 20:17267671-17267693 GATGTTCATTTTTAAATGATGGG + Intronic
1173517760 20:43677340-43677362 CCTGCTAATTGTAAGATGAGTGG + Intronic
1175752106 20:61505809-61505831 GCTGCTTATGTTAAGATGAATGG + Intronic
1184080890 22:42219408-42219430 GATGCTTTTTTTAAGATGATGGG - Intronic
1185174667 22:49317496-49317518 TTAGCTAATTTTAATATGATGGG + Intergenic
949315832 3:2753892-2753914 GACTCTAATTTTAATATAATTGG + Intronic
949413472 3:3792047-3792069 GATGTTAAATTTATGATAATAGG + Intronic
951783516 3:26390873-26390895 GATGCTAATGTTATGATGATGGG - Intergenic
952729081 3:36620301-36620323 AATGCTTCTTTTCAGATGATTGG - Intergenic
953938634 3:47069915-47069937 TCTGCTAATTTTAAGAAGCTTGG + Intronic
955653588 3:61221030-61221052 GATGCTAATTATTGGCTGATTGG - Intronic
958641231 3:96808591-96808613 TATGCTAATTGTCAAATGATTGG + Intergenic
959385118 3:105694628-105694650 GTTTCTTATTTTAAGTTGATAGG - Intronic
961059069 3:123813103-123813125 GATGATAACTTTAAGCAGATAGG - Intronic
965082398 3:164051304-164051326 GATGTCAATTTTATGATGATTGG - Intergenic
965344579 3:167532772-167532794 GATCCTAAATTATAGATGATTGG - Intronic
966824238 3:183950389-183950411 TATGCTTATTTTAAAATGTTTGG + Intronic
967165188 3:186773777-186773799 GATGCCAACTCTGAGATGATAGG - Intergenic
967652325 3:192001805-192001827 GAGACTAATTTTAGGATGACGGG + Intergenic
974225450 4:59037417-59037439 AATGTTAATTATATGATGATTGG - Intergenic
975644809 4:76535715-76535737 CCTGCTTATTTTATGATGATGGG - Intronic
976011384 4:80493416-80493438 TTGGCTAATTTAAAGATGATGGG + Intronic
976118046 4:81749516-81749538 GATGCTAATTTTAAGATGATGGG + Intronic
976231968 4:82853399-82853421 GAAGCAAAGTTTGAGATGATAGG - Intronic
976360318 4:84170607-84170629 TATGCTAAATTTGAGATGTTGGG - Intergenic
976835111 4:89363040-89363062 GATGCAAGTTTTATGATTATCGG + Intergenic
977490958 4:97710732-97710754 GAAGTTACTTTTAAGTTGATGGG - Intronic
979070710 4:116202486-116202508 GATGATAATTTTAAAAATATTGG - Intergenic
979105780 4:116685347-116685369 GATGCTAAATTTAAGTAGAAAGG + Intergenic
979683026 4:123482256-123482278 CATTTTAATTTTAAGATGATAGG - Intergenic
980518304 4:133894928-133894950 AATGCAAATTTTAAGTTCATGGG - Intergenic
980674864 4:136064967-136064989 GATTATAATATCAAGATGATTGG - Intergenic
980706867 4:136508755-136508777 CATGTTCATTTTAAAATGATAGG - Intergenic
980921035 4:139085760-139085782 GATGCTTACTTTAAATTGATTGG - Intronic
981640170 4:146933191-146933213 GATGCTAAAAATAAGATGTTCGG + Intronic
981891893 4:149748051-149748073 GCTGCTATTTTTAATATTATGGG - Intergenic
982787531 4:159553460-159553482 TATTCTGATTTTAAGATGTTAGG - Intergenic
982911845 4:161151770-161151792 CATGGTAATTTCAAGATGATGGG - Intergenic
983465976 4:168090670-168090692 GATGAAAATTTTAAAATGTTTGG - Intergenic
988458595 5:31411488-31411510 GATGCTAATTTTGATATTATAGG + Intronic
989176357 5:38530869-38530891 GAGGCCAATTTTCAAATGATGGG + Intronic
990104167 5:52236002-52236024 TTTACTAATCTTAAGATGATTGG + Intergenic
990365548 5:55066732-55066754 GAGGCTATTTTTAAGGTGAGAGG - Intergenic
990538014 5:56743003-56743025 GATGCTAATGTTCATATAATTGG + Intergenic
992014576 5:72562847-72562869 GATTCTAATTTGGAGATGATGGG + Intergenic
992829853 5:80583654-80583676 AATGCTAATTTTAAGATCAATGG + Intergenic
993656443 5:90583863-90583885 GATGGTATTTTTAATACGATAGG + Intronic
995556334 5:113332768-113332790 GATGTTAATTTGCAGAAGATCGG - Intronic
996560698 5:124825860-124825882 GGTGGAAATTTTAAGTTGATTGG - Intergenic
997243112 5:132322737-132322759 GATGCTAATCGTTATATGATAGG - Intronic
998071154 5:139198813-139198835 GATGCTATTTTTAAAATAACTGG - Intronic
998943333 5:147309955-147309977 GTAGCTAATTTTAAAATGTTTGG - Intronic
1011761493 6:90571191-90571213 TATGCTAATTTCATGATTATTGG + Intronic
1011969384 6:93203289-93203311 GAAGCTAATTTTATGTTAATTGG + Intergenic
1011973975 6:93268836-93268858 TATTCTATTTTTAAGATGAGTGG + Intronic
1012111309 6:95238450-95238472 GATGATAATGTTCAGATTATAGG + Intergenic
1012754265 6:103204899-103204921 GATGACAACTTTAAGAAGATAGG - Intergenic
1012933942 6:105345960-105345982 TATACTAATTTTAAAATGTTCGG - Intronic
1012956280 6:105573894-105573916 GATACTCATTTGAAGATTATTGG - Intergenic
1013315638 6:108940121-108940143 CATGCTAATTTTAATAAGCTTGG - Intronic
1014282246 6:119454778-119454800 GAGGCTATTTTAAAGATGAATGG - Intergenic
1016789125 6:148049609-148049631 TTTGCTAATTTTAAAATAATTGG - Intergenic
1018488179 6:164263647-164263669 GGAGATAATTTTAATATGATTGG - Intergenic
1021325783 7:19266026-19266048 GTATCTAATTTTAGGATGATGGG + Intergenic
1021616785 7:22509814-22509836 TATGCTAAATTTAAGAAGCTAGG - Intronic
1022261948 7:28714278-28714300 GATGCTAATTAAAAGAAAATGGG + Intronic
1022926581 7:35061024-35061046 TATGCTAAATTTAAGAAGCTAGG - Intergenic
1022960560 7:35422417-35422439 GAGGTTATTTTAAAGATGATGGG - Intergenic
1023885645 7:44352628-44352650 ATTTCTAATTTTGAGATGATAGG + Intergenic
1024934084 7:54695160-54695182 AATGATAATTTTAAAATGTTTGG + Intergenic
1026542532 7:71292871-71292893 GATGCTAATTTCCAGAGGATGGG - Intronic
1027748762 7:82113909-82113931 GATGCCAATATTAAGATGAATGG + Intronic
1028211024 7:88074813-88074835 AATGCACATTTTTAGATGATTGG + Intronic
1028375684 7:90144512-90144534 TATGCTAAATTTAAGAAGCTAGG + Intergenic
1028813982 7:95122893-95122915 GATGAAAATTTTAAGATCATGGG + Intronic
1030618128 7:111760032-111760054 TAAGCTAAAATTAAGATGATGGG + Intronic
1030872399 7:114773314-114773336 GATGCTAGTTTCAAGGTGTTGGG + Intergenic
1031345379 7:120659262-120659284 GATTCTACTTCTAAGATGAATGG + Intronic
1031353118 7:120759952-120759974 GCTGCTTATTTAAAGATGAAAGG - Intergenic
1033840691 7:145370124-145370146 GGTGCTGATTTGAAGATGAAGGG - Intergenic
1035766262 8:2108145-2108167 GATTCTAATTTTAAGAAGGAAGG + Intronic
1037081441 8:14792111-14792133 GTTGCTATTTTTAAGACCATAGG - Intronic
1039159953 8:34606779-34606801 GAAGCTTATTTTAAGATATTGGG + Intergenic
1044237137 8:89843975-89843997 GATACTAATTCAAAGATTATTGG - Intergenic
1045232971 8:100323187-100323209 GAGTGTTATTTTAAGATGATGGG + Intronic
1048023011 8:130558111-130558133 TATACTAATATTAAAATGATAGG + Intergenic
1048753464 8:137705433-137705455 AATGCTAATTATAGGATTATAGG - Intergenic
1050536824 9:6637789-6637811 GATTCTAATTTTAATAAGAAAGG + Intronic
1051571615 9:18564708-18564730 TATGCTAATTTTAAGGAGGTGGG + Intronic
1051603089 9:18893527-18893549 GATGCAAATTCTAATATGGTAGG + Intronic
1052230463 9:26144749-26144771 GATGCAAAAATTAATATGATGGG - Intergenic
1054800091 9:69339411-69339433 GATGCTACTCTTAAAAAGATGGG - Intronic
1055116890 9:72614623-72614645 AACTCTAATTTTAAGAAGATTGG - Intronic
1055850952 9:80629357-80629379 GATGTCAATTTTGAGATGACTGG + Intergenic
1056065459 9:82929152-82929174 GATGGTAACTTGAAGGTGATAGG - Intergenic
1058031856 9:100208860-100208882 GATACTACTTTTATGATGAGAGG + Intronic
1058201748 9:102050953-102050975 GATGCTAAAATTAAAATGATTGG - Intergenic
1058410261 9:104724170-104724192 AAAGCTAATTTTAACATGAGGGG + Intergenic
1059010217 9:110449856-110449878 GTTGCCTATTTTAAAATGATAGG + Intronic
1061772582 9:132937477-132937499 GATTCTGATTTTAAGATTAGAGG - Intronic
1187980821 X:24755217-24755239 GAGGCTAATCTTAAGAGAATTGG + Intronic
1188050846 X:25483936-25483958 AATGCTAATTTAATGATGAGAGG + Intergenic
1189534211 X:41920579-41920601 CAAGCTAATTTTGAGGTGATAGG - Intronic
1192962320 X:76143973-76143995 GATGCTAGTTTTCAGAGTATAGG + Intergenic
1192963213 X:76151114-76151136 GATGCTAGTTTTCAGAGTATAGG - Intergenic
1193827687 X:86246179-86246201 GATGCCAATGTTCATATGATTGG - Intronic
1194726856 X:97409293-97409315 CATGCTAAATCTCAGATGATGGG + Intronic
1197111300 X:122778317-122778339 GATGGCAATTCTAAGATGAATGG + Intergenic
1199002815 X:142659932-142659954 GATGGCACTTTTAAGATCATTGG - Intergenic
1199234867 X:145479857-145479879 AATGCTAATTTGAAGATAAATGG - Intergenic
1199479250 X:148279843-148279865 TATGCTAATTTTAAGTTCAGGGG - Intergenic
1201935242 Y:19404824-19404846 GATCATAATTTTAAAATTATAGG + Intergenic
1202015038 Y:20395836-20395858 TTTGCTAATTTTATTATGATAGG - Intergenic