ID: 976120938

View in Genome Browser
Species Human (GRCh38)
Location 4:81780585-81780607
Sequence TATTATTTTAAGAAGGTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 596
Summary {0: 1, 1: 0, 2: 4, 3: 58, 4: 533}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976120938_976120941 25 Left 976120938 4:81780585-81780607 CCCTTCACCTTCTTAAAATAATA 0: 1
1: 0
2: 4
3: 58
4: 533
Right 976120941 4:81780633-81780655 CTATGTTTGTGATTAAGCTCTGG 0: 1
1: 0
2: 0
3: 6
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976120938 Original CRISPR TATTATTTTAAGAAGGTGAA GGG (reversed) Intronic
901299434 1:8188681-8188703 TACTTTTTCAAGAATGTGAAGGG + Intergenic
904050091 1:27633785-27633807 CATGTTTTTGAGAAGGTGAAGGG + Intronic
904766290 1:32850636-32850658 TATTTTTTAAAAAAGGTCAAGGG - Intronic
904997292 1:34640932-34640954 TATTAATCCAAGAAGGAGAACGG + Intergenic
905066280 1:35186902-35186924 TGTTTTTTTAAGTAGGTGACTGG - Intronic
905095124 1:35463620-35463642 CACATTTTTAAGAAGGTGAAAGG + Intronic
905585116 1:39111025-39111047 TATAATTATCAGAAGCTGAAAGG - Intronic
905757310 1:40521878-40521900 TCTTATTTTAAGAAATTGCAAGG + Intergenic
906429932 1:45748363-45748385 AATTTTTTAAAGAGGGTGAAAGG + Intronic
906854520 1:49290537-49290559 AATTGTATTAAGAAGGGGAAAGG + Intronic
907724445 1:57005904-57005926 TATTATTATTAGTAAGTGAAAGG + Intronic
908110295 1:60890186-60890208 TTTTGTTTTAAGCAGGGGAATGG + Intronic
908416604 1:63918919-63918941 TATCTTTTTAAAAAGATGAATGG - Intronic
908608949 1:65834503-65834525 TAGAATTTTAAGAATGAGAAAGG + Intronic
910094133 1:83500603-83500625 AATTATTTTAAGAAGATAAATGG + Intergenic
910203840 1:84727381-84727403 TATTATTTTGAGAAGGAAAATGG - Intergenic
910685306 1:89909955-89909977 TATGATTTTAAGAACATGAAAGG - Intronic
910709007 1:90159348-90159370 TAATATTTTCAGAACTTGAATGG + Intergenic
910941049 1:92534396-92534418 AATTATTTGAAGAAAGTCAATGG - Intronic
911311716 1:96300880-96300902 TAATTTTTTAATAAGGTGTAAGG - Intergenic
911362568 1:96897233-96897255 TAATTTTTTTATAAGGTGAAGGG + Intergenic
911997414 1:104784551-104784573 TACTATTTTAGGAAAATGAAAGG - Intergenic
912096703 1:106153439-106153461 TATATTTATATGAAGGTGAAAGG + Intergenic
912108387 1:106309713-106309735 TGTTATTTTGAAAAGGTAAAAGG + Intergenic
912159154 1:106959895-106959917 TATTTTTTTAATAAGTGGAAAGG + Intergenic
912402876 1:109410255-109410277 TAATCTTTGAAGAAGGGGAAAGG + Intronic
913201343 1:116497307-116497329 GAATAATTTAAGAAGATGAAGGG + Intergenic
913448195 1:118972336-118972358 GATCATTTTAAGAAGGAAAAGGG - Intronic
914342480 1:146771720-146771742 TGGTCCTTTAAGAAGGTGAATGG - Intergenic
914384829 1:147158450-147158472 TATTAATCTAAGAATGTGGAAGG + Exonic
914691626 1:150034026-150034048 TATTATTTTAAGAATTATAATGG + Intergenic
915380945 1:155439906-155439928 TATTATTTGAAGAAAGTTATTGG - Intronic
915388243 1:155516885-155516907 AATAAATTTAAGGAGGTGAAAGG + Intronic
918026310 1:180751843-180751865 TATAATTTTAAGTATGTAAAGGG + Intronic
918334953 1:183499975-183499997 TATTATTTCAAGAAGGTACAGGG + Intronic
918688921 1:187456080-187456102 TTTTATTTTAATGAGGAGAAAGG - Intergenic
919031552 1:192249763-192249785 AATGACTTTGAGAAGGTGAAAGG - Intergenic
919118401 1:193309957-193309979 TTTTATTTTAAAAAGTTTAAAGG - Intergenic
919712429 1:200740350-200740372 TATTATTGCAAGAAGGTGGATGG + Intronic
919816424 1:201443670-201443692 TTTTTTTTTCAGAAGGGGAAAGG - Intergenic
919973347 1:202594874-202594896 TTTTATTTTAAAAAGGGGGAAGG - Exonic
920902843 1:210128485-210128507 TCTTATTAAAAGAAGATGAAAGG - Intronic
921254965 1:213330770-213330792 TCTTTTCTTGAGAAGGTGAACGG + Intergenic
921394075 1:214650265-214650287 TATTTTTTTTAGAAATTGAAAGG + Intronic
922193193 1:223337997-223338019 TATTTCTTTAAAAAGGTGAATGG + Intronic
922262325 1:223953634-223953656 TATTATTTTAAAAAATTGACAGG - Intergenic
922617657 1:226972450-226972472 TATTATTTTTAAAAGGTAAAAGG + Intronic
922627302 1:227061667-227061689 GATAATTTTAAGGAGGGGAATGG - Intronic
924209175 1:241747059-241747081 TGTTATTTTAAGAATGTTATTGG - Intronic
924879120 1:248138611-248138633 TTTTATTTTAAGCTGGTGATGGG + Intergenic
924884305 1:248195930-248195952 TTTTATTTTAAGCTGGTGATGGG + Intergenic
924892923 1:248304708-248304730 TTTTATTTTAAGCTGGTGATGGG - Intergenic
1063059008 10:2531241-2531263 TAAAATTTAAATAAGGTGAAAGG + Intergenic
1063647661 10:7901704-7901726 TATTAATTTAAGAAGTTTACTGG - Intronic
1063714924 10:8517190-8517212 AATTATTTTAAATTGGTGAATGG - Intergenic
1063876949 10:10489860-10489882 TCTTAATTTAAAAATGTGAATGG - Intergenic
1063926189 10:10979936-10979958 GTTTATTTTAAGAAAGTCAAGGG + Intergenic
1064246224 10:13669539-13669561 TAGTATTTTAAGAAAGTGATTGG - Intronic
1064864405 10:19863049-19863071 TATTATTTTTAGAGGGTAAGAGG + Intronic
1065159092 10:22900671-22900693 TATTCATGAAAGAAGGTGAAGGG + Intergenic
1066481668 10:35801751-35801773 AATTAAAATAAGAAGGTGAAGGG - Intergenic
1066707459 10:38197077-38197099 TATTATTTTCAGTAGTTTAAGGG + Intergenic
1067453875 10:46399618-46399640 TATTCTGTTAAGATGATGAAAGG - Intergenic
1067583321 10:47459658-47459680 TATTCTGTTAAGATGATGAAAGG + Intergenic
1067633326 10:47985011-47985033 TATTCTGTTAAGATGATGAAAGG + Intergenic
1068272660 10:54749007-54749029 CATTATTTTATAAAGGTGAGTGG + Intronic
1068373709 10:56151985-56152007 TATTCTTTTCAGAAGCAGAAAGG - Intergenic
1069186911 10:65435186-65435208 GATTATTTTAAGAATGAGTATGG - Intergenic
1069333348 10:67319497-67319519 AATTAATTTAAGAAAGTTAATGG + Intronic
1070039832 10:72765435-72765457 TATTATTTTAATAATCTGTAGGG + Intronic
1070370007 10:75773310-75773332 TAGTATGTTAACTAGGTGAAGGG + Intronic
1071190501 10:83093792-83093814 AATTATTTGAAGAAAGTCAATGG - Intergenic
1071211365 10:83345342-83345364 TATTATTTTAACAAGAGGCAAGG - Intergenic
1073519722 10:104116534-104116556 TATTATTTTAATCAAGAGAAGGG - Intergenic
1073645972 10:105304318-105304340 TGTTATGGCAAGAAGGTGAAAGG - Intergenic
1073857521 10:107694649-107694671 AATTTTTTTAAGAAAATGAAAGG - Intergenic
1073895616 10:108152961-108152983 TATTTTTTAAGGAAGGTAAATGG + Intergenic
1074328638 10:112479676-112479698 GATTATTTTCAGAAGTTGAATGG - Intronic
1075225269 10:120623421-120623443 TATTATTTTAAGAAATTGACAGG + Intergenic
1075443784 10:122499759-122499781 TATTTTTTAAAGAAAATGAAAGG + Intronic
1076259194 10:129052136-129052158 GATTAATTTAGCAAGGTGAACGG + Intergenic
1076524979 10:131106761-131106783 GAATATTTTAAGAATGTGAATGG - Intronic
1076532985 10:131157797-131157819 TGGTATTTTAAGGAGGTTAAAGG - Intronic
1078606025 11:12776251-12776273 TATTATGGTAAGATGGTGATGGG + Intronic
1078681809 11:13484197-13484219 TAATTTTTTTACAAGGTGAAAGG - Intergenic
1079291715 11:19194084-19194106 AACTATTATAAGAAGGTGACTGG - Intronic
1079774928 11:24513113-24513135 TATTATTTTAAGAAAATAGATGG + Intronic
1079859842 11:25655111-25655133 TCTTACTTTAAGAGGATGAAAGG - Intergenic
1079932221 11:26578448-26578470 AATTAGAGTAAGAAGGTGAAGGG + Intronic
1080594802 11:33762046-33762068 TATTATATGAAAAAGGTGAAGGG - Intronic
1080997752 11:37624853-37624875 TTTTATTTTAAATAGATGAAAGG + Intergenic
1081157292 11:39709883-39709905 TACTAGTTTAAGAAGCTGAAAGG + Intergenic
1082930151 11:58594440-58594462 CATAAGTTTGAGAAGGTGAAAGG - Intronic
1085500019 11:77011742-77011764 TATTTTTTAAATATGGTGAATGG - Intronic
1085584747 11:77691628-77691650 TATTTTTTAAAAAAGGTGACTGG + Intronic
1086319069 11:85626426-85626448 TATTATTTTACTAAAGTAAAAGG - Intronic
1087301876 11:96445363-96445385 TATTATTTTAAAAATTTAAATGG + Intronic
1087339193 11:96881048-96881070 TGGTATTTTATGAAGGTAAATGG + Intergenic
1087346034 11:96972315-96972337 TAGTAGTTTAAGAAGCTGAAAGG + Intergenic
1087806376 11:102559569-102559591 CATTATTTTAAACAGGTGAGGGG + Intergenic
1088350896 11:108886112-108886134 TTTTATTTTGAGAAGGGGAGGGG + Intronic
1088741362 11:112769999-112770021 AATTATTTTAACAAGGTAATGGG + Intergenic
1089056609 11:115590742-115590764 TTTTCTCTTAGGAAGGTGAATGG + Intergenic
1089429918 11:118414470-118414492 CAGTATTTAAGGAAGGTGAAAGG - Intronic
1090109353 11:123888212-123888234 AACTATTTTAAGAAGTTCAAGGG - Intergenic
1090545601 11:127763899-127763921 TTTTATTTTAGAAATGTGAAAGG - Intergenic
1090610941 11:128469746-128469768 AATTATTTTAAGAAGATTAAGGG + Intronic
1090899544 11:131015539-131015561 TATTAATGGAAGAAGGTAAAAGG + Intergenic
1091043604 11:132305468-132305490 TATTAATTTCAGATGGTGTAGGG + Intronic
1091096336 11:132825766-132825788 TGTTAGTTTAACAAAGTGAAGGG + Intronic
1091525335 12:1294250-1294272 TAAAATTTAAAGAAGGAGAAAGG - Intronic
1092095706 12:5840194-5840216 TATGATTTTAAGCACATGAAAGG - Intronic
1092990751 12:13896603-13896625 TATTATTTTAAAAAATGGAATGG - Intronic
1093156737 12:15695397-15695419 TATTATTCTAGGAAGTTGTATGG - Intronic
1094333390 12:29321195-29321217 TTGTATTTTAAGAAGTTGATAGG - Intronic
1094359258 12:29612395-29612417 TTTTTTTTTAAAAAGATGAATGG - Intronic
1095383323 12:41620271-41620293 TATTGTATTAAGCAAGTGAATGG - Intergenic
1095526806 12:43135847-43135869 TATTTTTTTAAAGAGGTAAATGG + Intergenic
1095894779 12:47269123-47269145 TGTTATTTTAAGTAGGTGCATGG - Intergenic
1095913500 12:47452794-47452816 TTACATTTTAAGAAGATGAAAGG - Intergenic
1095916239 12:47482104-47482126 TTTAATTTTTACAAGGTGAATGG - Intergenic
1097494048 12:60307749-60307771 TAATATTTTCAGCAGGAGAAGGG - Intergenic
1097524100 12:60708558-60708580 TATTATTTTAATAGTGTAAAAGG - Intergenic
1097545349 12:60993415-60993437 AATTAGATTAAGAAGTTGAAAGG - Intergenic
1097670089 12:62525739-62525761 TTTTATTTTAAAAAGGGAAATGG + Intronic
1097706643 12:62875625-62875647 TTTTCTTTAAAGAAGCTGAATGG - Intronic
1098070925 12:66673908-66673930 TATTATTTTAAAAAGTTGATAGG + Intronic
1098308118 12:69121543-69121565 TATTCTTTTAAGAATGTGATTGG - Intergenic
1098448876 12:70596506-70596528 TTTTTTTTTAAGAAAGTGAAAGG - Intronic
1098647775 12:72926135-72926157 TATTGTTTTAAAAAAGTGGAGGG - Intergenic
1098681686 12:73364215-73364237 TTTTATCTTGAGAAAGTGAATGG - Intergenic
1098732449 12:74054821-74054843 TCTCATTTTAAAAAGGTAAATGG + Intergenic
1099316133 12:81084202-81084224 CATTTTGTTAAGAAGGTGATAGG + Intronic
1099831592 12:87850355-87850377 TATTATTTTAAAATGCTAAAAGG + Intergenic
1099939860 12:89173582-89173604 TAATATTATAAAAATGTGAATGG + Intergenic
1100459254 12:94782644-94782666 TTTTATTTTGAAAATGTGAAAGG + Intergenic
1100802237 12:98244407-98244429 TATAAATTTAACAAGATGAAAGG - Intergenic
1101005587 12:100398127-100398149 TATTATTTCAAGGAGGTAAAAGG - Intronic
1101047002 12:100818250-100818272 TATAGTTTTAAAAAAGTGAAGGG + Intronic
1102003706 12:109574952-109574974 TAATTTTGTAAGAAGGTAAAAGG + Intronic
1105584173 13:21728777-21728799 TTTAATTTTAGGAAGGTAAATGG - Intergenic
1106105979 13:26733955-26733977 AATTATTTAAAAAAGGTGAGGGG - Intergenic
1106362417 13:29044690-29044712 TGTTATTTTAAGAAAAAGAAAGG - Intronic
1106392612 13:29350126-29350148 TGTTATTTTAAGAAAAAGAAAGG - Intronic
1107220701 13:37976077-37976099 TATTTCTTAAAGATGGTGAATGG - Intergenic
1107241308 13:38237751-38237773 TATTATTTTAAGAATAAAAATGG - Intergenic
1108200282 13:48036836-48036858 TATAATTTTAAGAAGTAAAATGG - Intergenic
1108826590 13:54419694-54419716 TGTTAATATAAGAAGGTCAAAGG + Intergenic
1108830251 13:54468853-54468875 TATTATATGATGAAGATGAAGGG + Intergenic
1109381791 13:61571107-61571129 TATCTTTTGAAGAAGGTGGAAGG - Intergenic
1109637020 13:65133820-65133842 TATTATTTTAAAAGGATAAATGG - Intergenic
1109785968 13:67175318-67175340 TATTATTTTTAGATTGTGATGGG - Intronic
1109918205 13:69019787-69019809 GATAATTTTAAGAAGTAGAATGG - Intergenic
1110185071 13:72664441-72664463 AATGTTTTTAAGCAGGTGAATGG - Intergenic
1110552205 13:76822626-76822648 TTTTATTTTAATACGGAGAATGG + Intergenic
1110825140 13:79963076-79963098 AATTATGTTAAGAAAGTCAATGG - Intergenic
1110873876 13:80485700-80485722 TATCATTTTATGAAGGAGCATGG - Intergenic
1110879122 13:80548699-80548721 TATTATTTTAGGGAGGTGTCAGG + Intergenic
1111028307 13:82564164-82564186 AACTATTTTAAGAAGTGGAATGG - Intergenic
1111246348 13:85547030-85547052 TATAATCTTAACATGGTGAAAGG - Intergenic
1111373665 13:87351278-87351300 TATTTTTTTAGGAGCGTGAAGGG + Intergenic
1111516652 13:89341882-89341904 TAATATTTTAACAATGTAAATGG + Intergenic
1112227707 13:97556524-97556546 TTATATTTTAAAAAGGTGATGGG - Intergenic
1112930100 13:104724224-104724246 TTTTATTTTAAGAAGCTATATGG - Intergenic
1113130899 13:107035646-107035668 TTTGATTTTAAGAAGCAGAAAGG - Intergenic
1113344089 13:109456990-109457012 TAATTTTTTAAGAAGGTAAAGGG - Intergenic
1114747169 14:25161672-25161694 TATCATTTTCAGCAGTTGAATGG + Intergenic
1116035642 14:39624008-39624030 TATTCTGTGAAGAAGGTCAATGG + Intergenic
1116926781 14:50646966-50646988 GATTTTTTTATAAAGGTGAAAGG + Intronic
1117059849 14:51950911-51950933 TATTATTTTATGCTGGAGAAGGG - Intronic
1117109215 14:52431407-52431429 TAATATTTTCAGAAAGTGATGGG - Exonic
1118155518 14:63237245-63237267 TATTTTTTTAAGAAGGAGCTTGG + Intronic
1118669360 14:68105600-68105622 TATTATTTTAAAAGGATGAAAGG + Intronic
1119587609 14:75851400-75851422 TTTCATTTTGAAAAGGTGAAAGG + Intronic
1120349562 14:83336775-83336797 TATTATTTTAGGATGGGGGATGG - Intergenic
1121132109 14:91457479-91457501 TACTGTTTTAATAAGGTGACAGG + Intergenic
1121344532 14:93125669-93125691 TGTTATTTTTAAAAGATGAATGG - Intergenic
1121785266 14:96654376-96654398 TAAAAATTCAAGAAGGTGAAGGG - Intergenic
1122316743 14:100829926-100829948 TGTAATTTAAAGAAGCTGAAAGG + Intergenic
1122498728 14:102179186-102179208 TCTTTTTTTAAAAAGCTGAAAGG - Intronic
1123495537 15:20821080-20821102 AAATATTTTAAAAAGGGGAAAGG + Intergenic
1123552025 15:21390195-21390217 AAATATTTTAAAAAGGGGAAAGG + Intergenic
1123967825 15:25476878-25476900 TCTTAGTTTCAGAAGCTGAAAGG - Intergenic
1124999586 15:34755705-34755727 TATTATTTTACTAATGGGAAGGG + Intergenic
1124999765 15:34757294-34757316 TATTATTTTAATAAACAGAATGG - Intergenic
1125982525 15:44015871-44015893 TATTATTTTAAGTAAATGAAAGG + Intronic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1131310420 15:91285623-91285645 TATTATTTTAACAATGAAAATGG - Intronic
1202960371 15_KI270727v1_random:117411-117433 AAATATTTTAAAAAGGGGAAAGG + Intergenic
1133516558 16:6514865-6514887 AATTATTTTAATAAGGAGGAAGG + Intronic
1133635335 16:7659616-7659638 TAATGTTTTAAGAAAGTTAATGG + Intronic
1134487076 16:14667162-14667184 TATTATTTTAAGTAGGGACAAGG - Intronic
1136285000 16:29235545-29235567 GATTATTTTAGGAAAGTAAATGG + Intergenic
1138166375 16:54805550-54805572 TGTTATTTAAAGGAGGAGAAGGG + Intergenic
1138732647 16:59212262-59212284 TATTCCTTGAAGAAGGTGATGGG + Intergenic
1139416069 16:66811728-66811750 GATGATTTTTAGAGGGTGAAAGG - Intronic
1140672992 16:77297583-77297605 TATTATTTTAGGGAGGGGAATGG - Intronic
1142053514 16:87976218-87976240 AATTTTTTTAAGACGGTGACAGG + Intronic
1142090063 16:88205169-88205191 GATTATTTTAGGAAAGTAAATGG + Intergenic
1143840793 17:9730216-9730238 TTTTCTCTTAAGAAGGAGAATGG + Intergenic
1143850082 17:9804373-9804395 TATTCTCTGGAGAAGGTGAACGG + Intronic
1144352691 17:14413222-14413244 TATTATTTTAAGATGCTCCAAGG + Intergenic
1146128780 17:30251790-30251812 AATAATTTTAAGAATGTAAAGGG - Intronic
1146599485 17:34202311-34202333 TATTCTTTTAAGAGGCTGATGGG + Intergenic
1147394973 17:40135326-40135348 AATTATTTTTACAAAGTGAATGG - Intronic
1147492112 17:40879311-40879333 TAAAATTTTAAGATGGAGAATGG - Intronic
1148829596 17:50422703-50422725 TTTCAGTTTAGGAAGGTGAAAGG - Intergenic
1148940534 17:51206277-51206299 TATTTTTTTAAAATGGAGAATGG + Intronic
1149060523 17:52416036-52416058 TATTACTTTAAGATGCTGCAGGG + Intergenic
1149522613 17:57329324-57329346 AATTTTTTTAAAAAGGTAAATGG + Intronic
1150458970 17:65331129-65331151 TTTTAGTTTAGGAAGATGAAGGG - Intergenic
1150472306 17:65447464-65447486 TGTCATTTTAAGAGAGTGAAAGG + Intergenic
1150992575 17:70276981-70277003 TATTATATAAACAAGATGAACGG - Intergenic
1151411455 17:73932999-73933021 TATTATTTTATGATGGAGAGAGG - Intergenic
1152311441 17:79553339-79553361 TATTATTTTAAGATGATGCTTGG + Intergenic
1153386850 18:4508163-4508185 TAATTTTTTGGGAAGGTGAAAGG + Intergenic
1153526191 18:5997176-5997198 GATGATTTTAAGTATGTGAAAGG + Intronic
1153701911 18:7702860-7702882 TAATTTTTTAATAAGGTGTAAGG + Intronic
1153846741 18:9056986-9057008 AATTATTTTCAGAAGCTGATAGG + Intergenic
1154079090 18:11236656-11236678 TTTTATTATAAGAAGTTGTATGG - Intergenic
1154452939 18:14493562-14493584 AAATATTTTAAAAAGGGGAAAGG + Intergenic
1154458699 18:14556750-14556772 TGTTTTTTTAAAAAGGTAAAGGG - Intergenic
1155700950 18:28742739-28742761 TATTATTTAAGGAAAATGAAAGG + Intergenic
1155797020 18:30052216-30052238 TATCATCTTAAAAATGTGAATGG - Intergenic
1156235072 18:35195163-35195185 TTTTATTTTAACAAAGTGTATGG - Intergenic
1156549654 18:38002377-38002399 TATTACATTAAAAGGGTGAAGGG - Intergenic
1157446773 18:47752268-47752290 TATTATTTTAAAAGTGTGCAAGG - Intergenic
1158612361 18:58953010-58953032 TAGTATTCCAAGAATGTGAAAGG + Intronic
1158726416 18:59977033-59977055 TATAATTTTAAAAGGGTGAGTGG - Intergenic
1158726640 18:59979494-59979516 TCTTTTTTAAAAAAGGTGAATGG + Intergenic
1158771770 18:60526617-60526639 CATTATTTTAAGAAGTTGATAGG - Intergenic
1158777746 18:60606231-60606253 AAATATTTTAATAATGTGAAAGG - Intergenic
1159094749 18:63890197-63890219 TTTTTTTTTAAGAAAGTGATTGG - Intronic
1159221999 18:65477221-65477243 CATTATTTCAAGAAGGTAAATGG - Intergenic
1159251420 18:65882381-65882403 AATTATTTTTAAAAGGAGAAAGG - Exonic
1159472444 18:68874848-68874870 TACTATTTTAAGTAGGGTAACGG + Intronic
1159694315 18:71535655-71535677 GATTATTTTATTAATGTGAACGG + Intergenic
1159992613 18:74927689-74927711 TATTCTTTTAAGAAAGTTACTGG + Intronic
1160050366 18:75427700-75427722 TATTATTTTATGAAGCTGGATGG + Exonic
1160050373 18:75427756-75427778 TATTATTTTATGAAGTCGGATGG + Intergenic
1160251586 18:77208001-77208023 TATTATTTTTAGAAAGAGACGGG + Intergenic
1164505454 19:28856989-28857011 TATTATCTTTATAAGGTGGACGG - Intergenic
924989393 2:299088-299110 TATTCTTTGAAGAAAGTCAATGG - Intergenic
925999666 2:9320084-9320106 TATTATTTTAAGAGAAAGAAAGG + Intronic
926071158 2:9892925-9892947 AATTAATTTAAAAAGATGAAAGG - Intronic
926376235 2:12230816-12230838 TAATGTTTTAAGAAAGTTAACGG + Intergenic
926827192 2:16917680-16917702 TATTTTTTTAAAAAGAAGAATGG - Intergenic
926875543 2:17473235-17473257 GATTCTTTAAAGAAGGAGAATGG - Intergenic
927438633 2:23092564-23092586 TCATCTCTTAAGAAGGTGAAAGG - Intergenic
927438973 2:23096492-23096514 TATTCTTCAAAGAAGGAGAAAGG + Intergenic
927851504 2:26503030-26503052 TCTCCATTTAAGAAGGTGAAGGG + Intronic
928523883 2:32119385-32119407 GATTATATCAAGAAGGTGAGTGG + Intronic
928954815 2:36853730-36853752 TATTTTTTTAAAAAAATGAAAGG - Intronic
929185884 2:39094343-39094365 TAATTTTTTAAGAGTGTGAAGGG + Intronic
930352488 2:50274770-50274792 TTTTTTTTTAAGTAGTTGAAAGG - Intronic
930491323 2:52076241-52076263 AATTATTTCATGGAGGTGAAGGG - Intergenic
930640295 2:53847553-53847575 CATTATTTCAAGAGGGAGAATGG + Intergenic
930822356 2:55659257-55659279 TATTATTTGAAGAATGTACATGG - Intronic
931316417 2:61136795-61136817 TTTTATTTTTAGTAGGTGCAGGG - Intronic
931801533 2:65763006-65763028 TATGATTTTAAGATAGTCAATGG + Intergenic
932104425 2:68929690-68929712 TATTTTTTTTATAAGGTGTAAGG - Intergenic
933476337 2:82796284-82796306 TATTATTGTATGAAGGAGAGTGG - Intergenic
933573347 2:84039450-84039472 TATTACTTCAGGAAGGTCAATGG - Intergenic
936707626 2:115093955-115093977 AATTATTTTATGAAATTGAATGG + Intronic
936787618 2:116112699-116112721 TTTTAGTCTAAGAAGATGAATGG - Intergenic
937476115 2:122216892-122216914 TATTATTATTTGGAGGTGAAGGG + Intergenic
937872357 2:126795242-126795264 CATTATTTTAAAAAGATGGAAGG + Intergenic
938410658 2:131061152-131061174 AATTTTTTTAATAAGGTGGAAGG + Intronic
939122770 2:138137800-138137822 GAAGATTTTAAGAAGGTTAAAGG - Intergenic
939635474 2:144576557-144576579 AAATGTTTTAAGAAGGTGAGAGG + Intergenic
940087559 2:149877862-149877884 TATTAATTTAAGAAAGTGGAAGG + Intergenic
940256153 2:151731734-151731756 AATTATTTTAAGAAAGACAAGGG + Intronic
940419430 2:153462027-153462049 TGGGATTTTAAGAAAGTGAAAGG - Intergenic
940594475 2:155772219-155772241 TAATATTTAAAGAAGATAAATGG - Intergenic
942662718 2:178283197-178283219 TGTTATTTAAAGAAGTGGAAGGG + Intronic
942683144 2:178500424-178500446 TATTATTTTATGAGGTAGAAAGG - Intronic
943328453 2:186529730-186529752 CATCATTTTAATAAGTTGAATGG + Intergenic
943413695 2:187571711-187571733 TTTTAATTTAAGAAGGTCAATGG - Intergenic
943756553 2:191563106-191563128 AATCTTTTTAAGAAGGTGATTGG + Intergenic
943846095 2:192650451-192650473 TATTATTTTAAAAACATTAAAGG + Intergenic
943963144 2:194294125-194294147 TATTATTTTAAAAATATTAATGG - Intergenic
944007336 2:194925862-194925884 TGTTATATAGAGAAGGTGAAAGG - Intergenic
944347846 2:198689730-198689752 TAATTTTTGAAGAAGGTGTAAGG - Intergenic
944483018 2:200176468-200176490 TATTATTTTTAAAAGGAGAAAGG + Intergenic
944556687 2:200894378-200894400 TGTTATTTTAAGAAGCTAGAAGG + Intronic
944684146 2:202103230-202103252 TATTTTTTAAAGAAGGAAAAAGG + Intronic
945742910 2:213685297-213685319 TGTTCTTGTAAGAAGGAGAAAGG + Intronic
945815289 2:214598547-214598569 TATTTATTTAAGAAGATGTAAGG + Intergenic
945961214 2:216136727-216136749 TATTATTTTAAGAAATTCAGAGG + Intronic
946082439 2:217133934-217133956 AATTATTTGAAGAATGTTAATGG + Intergenic
947204970 2:227652148-227652170 TATTATAAAAAGACGGTGAATGG + Intergenic
947832812 2:233153747-233153769 TATTCTTTGGAGAAGGTGAAGGG + Intronic
947920135 2:233863288-233863310 TATTATTTTAAGAAGGGATTGGG + Intergenic
1169262185 20:4147356-4147378 GTTTATCTTTAGAAGGTGAACGG - Intronic
1169664270 20:8017835-8017857 TATTTTTGGAAGAAGGTGAGGGG - Intronic
1169769726 20:9187683-9187705 TATAATTTTCAGAAGATAAAAGG - Intronic
1171354536 20:24534008-24534030 TATTCATGGAAGAAGGTGAAGGG + Intronic
1171720480 20:28557447-28557469 TATTATTTTAAAAATGTTGAAGG + Intergenic
1171784792 20:29452892-29452914 TATTATTTTAAAAATGTTGAAGG + Intergenic
1171863591 20:30424747-30424769 TATTATTTTAAAAATGTTGAAGG - Intergenic
1173022497 20:39278722-39278744 TCTTATTTAAAGGATGTGAAGGG - Intergenic
1174739899 20:53002366-53002388 TATTATTTTTAGATTGTGATTGG - Intronic
1174994783 20:55553816-55553838 TTTTTTTTTAAGTAGGGGAATGG + Intergenic
1175334781 20:58188152-58188174 TATTATCTTAAAAAGGAGAAGGG + Intergenic
1175359661 20:58398937-58398959 TATTATGTTAGGAAGATGAGAGG + Intronic
1175548496 20:59798399-59798421 AATTATTTCAAAAAAGTGAAAGG - Intronic
1176443098 21:6794721-6794743 AAATATTTTAAAAAGGGGAAAGG - Intergenic
1176728687 21:10467460-10467482 TATTTTTTTAAAAAGGTGCTGGG - Intergenic
1176821264 21:13659766-13659788 AAATATTTTAAAAAGGGGAAAGG - Intergenic
1176968232 21:15235873-15235895 CAATCTTTTAGGAAGGTGAAGGG - Intergenic
1177274554 21:18892132-18892154 CATTATTATAAGAAGGTCATTGG + Intergenic
1177320838 21:19518237-19518259 TTTTATTTTTAGAAGATAAATGG - Intergenic
1177881286 21:26698101-26698123 TATTATTTTAAAAAGTTTAAAGG + Intergenic
1178225387 21:30711172-30711194 TATTCTTTTAAGAAAGTAAATGG - Intergenic
1178444262 21:32624187-32624209 TAAAATTTTAAGAAGTTGATGGG - Intergenic
1178675376 21:34627013-34627035 TATAATTATAAGAAGGTGGCTGG - Intergenic
1178841378 21:36140198-36140220 TCTTAACCTAAGAAGGTGAATGG + Intronic
1179398603 21:41063399-41063421 TGTTATTTGAAGAAAGGGAAGGG + Intergenic
1179740344 21:43414905-43414927 AATCATTTTAAAAAGGGGAAGGG + Exonic
1180116052 21:45705747-45705769 TATTATTTTAAAAGGCTGAGAGG - Intronic
1181089478 22:20462662-20462684 TATTATTTTAAGTAGGGTCAGGG + Intronic
1181929524 22:26389088-26389110 TATTATCGTCAGAAGGGGAAGGG - Intergenic
1182856859 22:33525201-33525223 TATTACTGTCAGAAGGTCAAGGG - Intronic
1182881280 22:33735617-33735639 TATTATTTAAAGAAGATAAATGG - Intronic
1182991039 22:34768031-34768053 TATTATTTTCAGAAAATGGAAGG + Intergenic
949974659 3:9444965-9444987 TGATATTTTAAGAGGGTGAATGG + Intronic
950994654 3:17481586-17481608 TCTTGTTTTAAAAAGGTGAGAGG - Intronic
951252152 3:20406426-20406448 TATTATTTTTATATGTTGAATGG + Intergenic
951864445 3:27292164-27292186 TAAAATTTTAAGAAGGTAGATGG + Intronic
952599787 3:35066374-35066396 GATTGTTTTATGAAAGTGAAAGG + Intergenic
952864403 3:37843167-37843189 TAATTTTTTTAGAAGGTGTAAGG - Intergenic
953121525 3:40047432-40047454 TTTTATTTTAAGAAAGTGGAGGG + Intronic
954964273 3:54596726-54596748 TCTGGTTTTAAGAAGGTGCATGG - Intronic
955961916 3:64349334-64349356 TCTTTTTTTAAGAAGCTGCAGGG + Intronic
957241424 3:77665634-77665656 AATTATGTTAAGAATGTCAATGG + Intergenic
957401708 3:79724251-79724273 TTTTATTTTAAGATGGTTAATGG + Intronic
957462397 3:80538182-80538204 TACTATTTTAAGCAGGAGATTGG - Intergenic
957801763 3:85093777-85093799 TATTATTTTAAGATTTTGACAGG + Intronic
958077740 3:88705456-88705478 TATAATTTTAATAAGATGAAAGG - Intergenic
958118402 3:89252722-89252744 TAATATTTTAAAAATATGAATGG - Intronic
958134951 3:89476894-89476916 TATTATTTTAGGAAGGGGAAAGG + Intronic
958831047 3:99089651-99089673 TATTATTTTACAAAGATGACTGG + Intergenic
959158024 3:102690137-102690159 AATTATTTTGAGATGTTGAAAGG - Intergenic
959895107 3:111596486-111596508 TATTATTTTACGAAGGCAACTGG - Intronic
959985668 3:112568206-112568228 GATTAGTTTGAGAAGGTCAAGGG + Intronic
960107323 3:113812290-113812312 TTTTACTTTGAGAAAGTGAATGG + Intergenic
960438803 3:117661332-117661354 CATTATTTTAATAATGGGAAAGG - Intergenic
960523163 3:118679242-118679264 TAATTTTTTAATAAGGTGTAAGG + Intergenic
960727616 3:120686269-120686291 TCATATTTTAAGAAGTTTAAAGG - Intergenic
960766703 3:121138191-121138213 AATAAATTTAAGGAGGTGAAAGG + Intronic
960904749 3:122589232-122589254 GATTAATATAAGAAGATGAAGGG - Intronic
961106426 3:124246372-124246394 TATTAGTTTAGGAAAGTAAAAGG - Intronic
961505445 3:127368132-127368154 AAGTAACTTAAGAAGGTGAATGG + Intergenic
962217725 3:133537124-133537146 TATTATTTTCATCAGGTGGATGG - Intergenic
962621111 3:137180472-137180494 TATTTTTTTAAAAAGATAAAGGG - Intergenic
962872645 3:139511335-139511357 AATTACTTCAAGAAGGTGAGAGG + Intergenic
963069089 3:141287637-141287659 TGTTTTTGTAAGAAGGAGAAAGG - Intronic
963583715 3:147158357-147158379 TAAGAATTTAGGAAGGTGAATGG + Intergenic
964016802 3:151957509-151957531 GATTATTTTAAAAAGGGGAGAGG - Intergenic
964505045 3:157390341-157390363 TGTAATTTTAAGAAAGTCAAAGG + Intronic
964730200 3:159856814-159856836 TGTTTTTTTTAAAAGGTGAATGG + Intronic
965554551 3:170005712-170005734 GATAATTTTAAGAAGGTGAGAGG - Intergenic
965781880 3:172294741-172294763 TAGTATTTTAAGAAGGTTCTGGG + Intronic
965840485 3:172900417-172900439 TATAAATTTAAGAAGTTGAGTGG - Intronic
966238722 3:177730913-177730935 TATTATTATAAGAAGGAGGATGG + Intergenic
966245116 3:177799586-177799608 TATCATTTTACTAAGGTAAATGG + Intergenic
966264940 3:178028568-178028590 TATTATATGGAGAGGGTGAAGGG + Intergenic
966615264 3:181906669-181906691 AATGAATTAAAGAAGGTGAAAGG - Intergenic
970060711 4:12030313-12030335 TATCTTTTTTAAAAGGTGAAAGG + Intergenic
970439915 4:16071791-16071813 TATTATTCCAAGAAACTGAATGG + Intronic
970905159 4:21207367-21207389 TAATATTTTATGTAGGTGATGGG + Intronic
971070630 4:23087519-23087541 TAGTATTTTAATAAGGTTATTGG + Intergenic
971321461 4:25609327-25609349 TATTATTTTAAACAGTTGGATGG - Intergenic
971465754 4:26958710-26958732 TGTTATTTTAAAATGGTGTAGGG - Intronic
971952190 4:33366605-33366627 TATTAGTTTCAGATGCTGAATGG - Intergenic
973065626 4:45787758-45787780 AATTATTAAAAGTAGGTGAAAGG - Intergenic
973092991 4:46161445-46161467 AATTGTTTTAAGTAGGTCAATGG + Intergenic
974190826 4:58500483-58500505 TTTTATTCTAAGGAGGTGTAAGG - Intergenic
974778991 4:66527570-66527592 TATGATTTTATGTTGGTGAATGG + Intergenic
974973883 4:68866038-68866060 TATAATTATGAGAAAGTGAAGGG - Intergenic
974980872 4:68955802-68955824 TATAATTATGAGAAGGTGAAGGG - Intergenic
974997133 4:69175300-69175322 TATAATTCTGAGAAGGTGAATGG + Intronic
975007925 4:69313532-69313554 TATAATTCTGAGAAAGTGAAGGG - Intronic
975010097 4:69340227-69340249 TATAATTCCGAGAAGGTGAAGGG + Intronic
975111052 4:70626837-70626859 TCTTATTTTAAGACTGAGAAGGG + Intergenic
975178529 4:71315422-71315444 TATTATGATAAGAAACTGAAAGG + Intronic
975202004 4:71602044-71602066 TATTATTTTAAGTATGTTAGGGG + Intergenic
975621778 4:76304063-76304085 TATTATTTTAAATAAATGAATGG + Intronic
976069291 4:81222985-81223007 TAATCATTTCAGAAGGTGAAGGG + Intergenic
976089626 4:81442982-81443004 TATTCTTTTAAGAATGTTGAGGG - Intronic
976120938 4:81780585-81780607 TATTATTTTAAGAAGGTGAAGGG - Intronic
976376249 4:84348892-84348914 TATTATTATCAGAAGGAGACTGG + Intergenic
976710632 4:88067371-88067393 TATTATTTTAAGATGGCTCATGG + Intronic
977196617 4:94069987-94070009 TATATTTTTAAAAAGGAGAAGGG - Intergenic
977376009 4:96204838-96204860 TACTATTTTAAAAAGGGGAGAGG + Intergenic
977484936 4:97633137-97633159 TATTATTATAAGAATGTAAATGG - Intronic
977858947 4:101932049-101932071 AAGTATTTTAAGAAAGTAAAGGG + Intronic
978056709 4:104278569-104278591 TTTTATTTTAAGATGATAAAAGG + Intergenic
978158642 4:105518511-105518533 GATTATTTTGAGATGGTGAATGG - Intergenic
978644379 4:110911727-110911749 TATTATTTTAAGTGAGGGAATGG + Intergenic
978869593 4:113559008-113559030 TATTAATTTAAAGAGGTAAATGG + Intronic
978963330 4:114710708-114710730 TATTAAAGCAAGAAGGTGAAGGG + Intergenic
979351640 4:119650485-119650507 TGTTTTTTTAAGAAAGTGGATGG + Intergenic
979465134 4:121028394-121028416 TATTATTTTATGAACAGGAAAGG + Intergenic
979623523 4:122821846-122821868 TATTGTTCTCAGAAGGTGAGTGG - Intergenic
979896169 4:126160646-126160668 TATAATTTTAAGTAGGTGAAAGG + Intergenic
981024053 4:140058107-140058129 TATTCATTTAAGAAGTTAAAAGG + Intronic
982295726 4:153826836-153826858 AATTATTTGAAGAAGGTCAATGG - Intergenic
982866327 4:160516961-160516983 TATTATTCTATGTAGTTGAAAGG + Intergenic
982961442 4:161843289-161843311 AATTATTTGAAGAAAGTCAATGG + Intronic
983096650 4:163570442-163570464 TTTTATTTCAAGAAAGGGAAAGG - Intronic
984408985 4:179371085-179371107 TATTATATGGAAAAGGTGAAGGG - Intergenic
984496267 4:180501400-180501422 TATTATTAAAAGCAGATGAATGG - Intergenic
984840513 4:184063265-184063287 TACTATTTTGCCAAGGTGAAGGG - Intergenic
984971194 4:185192701-185192723 TCTGATCTTAAGAAGGTCAAAGG - Intronic
985139356 4:186822743-186822765 TAATTTTTTAAGAAGGTCTATGG + Intergenic
985369766 4:189273839-189273861 TATTATTTTAAAAATGTTGAAGG + Intergenic
985798583 5:1985263-1985285 TATTATTTTATGAAAATAAAGGG + Intergenic
986031785 5:3901573-3901595 TATTATTTTAAGTTGGGGGAGGG + Intergenic
986185577 5:5433353-5433375 GATTCTTTTGAGAAGGTGAAGGG - Intronic
987739803 5:21892741-21892763 GATTTTTTTAAGGAGGAGAATGG - Intronic
987885941 5:23812273-23812295 TTTTATTTTTAGGGGGTGAAAGG + Intergenic
988413990 5:30922576-30922598 AATTATTTTAAGAGTTTGAAGGG - Intergenic
989342799 5:40395356-40395378 TATTATTTTATGAAAGAAAAAGG + Intergenic
989456744 5:41652876-41652898 TAATATTTTAAAAAGCTGACAGG - Intergenic
989530266 5:42499775-42499797 TCTTTTTTTGAGAAGGAGAAAGG + Intronic
989774142 5:45182386-45182408 TATAATTTAAAAAAGGTAAATGG + Intergenic
990525292 5:56619618-56619640 AAGTATTTTAAGAAGTTAAATGG - Intergenic
990687070 5:58316502-58316524 AATTATTTTAAGAAAGCAAATGG + Intergenic
990836933 5:60031960-60031982 TATTATCTTAAGAAGCTATAAGG + Intronic
991141972 5:63254930-63254952 TATTCTTTTAGGAAACTGAATGG - Intergenic
991312543 5:65260064-65260086 CATTAAAGTAAGAAGGTGAAAGG + Intronic
991410642 5:66342094-66342116 TACCATTTTAACAAGGAGAAGGG - Intergenic
992087653 5:73292288-73292310 TAATATTTTAAGAAAGTTTATGG + Intergenic
992990171 5:82275795-82275817 TATTACTTTAAGAACTTTAAGGG - Exonic
992993331 5:82307661-82307683 TAAGATCTTAAGAAGGAGAATGG + Intronic
993092790 5:83447663-83447685 CATTATTTTAAGATGGCTAATGG + Intergenic
993297369 5:86158874-86158896 GATTAGTTTAACAAGGTTAATGG - Intergenic
993733003 5:91445011-91445033 TTTTATTATAAGCATGTGAAAGG + Intergenic
993777793 5:92023006-92023028 TATTTTTTTAAAAAATTGAAAGG + Intergenic
993821818 5:92629034-92629056 TATAAGTTTAAGAAAGTTAAGGG - Intergenic
993915283 5:93737222-93737244 AATAACTTTAAGAAAGTGAAAGG + Intronic
994412113 5:99419706-99419728 CATTATTTTAAGGAGGGAAAGGG - Intergenic
994481709 5:100345546-100345568 CATTATTTTAAGGAGGGAAAGGG + Intergenic
994714440 5:103304912-103304934 TATTATCAAAAGAAGGGGAATGG + Intergenic
995150472 5:108838795-108838817 TATTATTTTTAGAATGTTTAAGG - Intronic
995269997 5:110209021-110209043 TGTTAGTTTAATAAGGAGAATGG + Intergenic
995666573 5:114549059-114549081 AATTATTTGAAGAAAGTCAATGG - Intergenic
996907350 5:128616167-128616189 TCTTATTTTAAGTAGGTCAAAGG + Intronic
997553662 5:134776058-134776080 TATTATTTTAATATGGTAAGCGG + Intronic
998390566 5:141784576-141784598 CCTTATTTTAAAAAGGGGAAAGG - Intergenic
1000733730 5:164871293-164871315 TATATTTGTAAGTAGGTGAATGG - Intergenic
1001034637 5:168288928-168288950 CATAATTTTCAGAAGGGGAAAGG + Intergenic
1001765248 5:174240677-174240699 TATTACTCCAAGAAAGTGAAAGG - Intronic
1002837213 6:875020-875042 TGTTATTTTTAGAAGATGGAGGG + Intergenic
1003620557 6:7695701-7695723 AAATATTTTAAGAATGAGAAGGG - Intergenic
1004074329 6:12331285-12331307 TTTTATTTTAAGGAAGGGAAAGG - Intergenic
1004803385 6:19175595-19175617 TATTAATTCAAAAAAGTGAATGG - Intergenic
1005737068 6:28757687-28757709 TTTTATTTTAACGAGGAGAATGG + Intergenic
1005740794 6:28788747-28788769 TTTTATTTTAACAAGGAAAATGG + Intergenic
1008001884 6:46369291-46369313 TATTTTTTTAAAAAAGTTAACGG - Intronic
1008788519 6:55199368-55199390 AATTATTTTAGGAATGTAAATGG + Intronic
1008827576 6:55716132-55716154 TCTTATTTTAAAAAAATGAATGG - Intergenic
1009382701 6:63052761-63052783 TAATATTTTTATATGGTGAAAGG - Intergenic
1009560879 6:65241178-65241200 TATTATTTTAACAATGTGAAAGG - Intronic
1009717849 6:67423969-67423991 AATTATTTGAAGAAAGTCAATGG + Intergenic
1009739831 6:67730122-67730144 AATTATTTGAAGAAAGTCAATGG + Intergenic
1009848427 6:69164086-69164108 TATTTTTTTCCCAAGGTGAAAGG + Intronic
1010176980 6:73040013-73040035 TTTTTTTTTAAGAAGGTGAGGGG - Intronic
1010624497 6:78120806-78120828 TATTTTTTTAATATGGTGAGAGG + Intergenic
1011141442 6:84162172-84162194 TATAATTTTAAAAAGGTTAGTGG - Intronic
1011861374 6:91761212-91761234 TTTTATTTGAAGAAGATGCATGG + Intergenic
1012126805 6:95439682-95439704 TTTTTTTTTAATAAGGAGAATGG - Intergenic
1012140191 6:95616975-95616997 TTTTATTTAAAGAAGATTAAGGG - Intergenic
1012554821 6:100498553-100498575 TAATTTTTTTAGAAGGTGTAAGG + Intergenic
1012581478 6:100875242-100875264 TAGGATTTAAAGAAGGAGAAAGG + Intronic
1013919530 6:115385890-115385912 TGTTATTTTAAAAAGGAAAATGG + Intergenic
1013969573 6:116000864-116000886 TATTACTTTTAGAAGTTGCATGG - Intronic
1014410316 6:121109251-121109273 TGTTATTTTAAGAAGAGTAAGGG + Intronic
1016195115 6:141326533-141326555 GACTATTGTAAGAAGGTGACTGG - Intergenic
1017667673 6:156736866-156736888 CATTATTTTAGGAAATTGAATGG + Intergenic
1018334218 6:162768015-162768037 TATTACTTTAAATAGGTGATTGG + Intronic
1018516653 6:164587496-164587518 TTTTATTTTTAAATGGTGAATGG + Intergenic
1018648747 6:165973013-165973035 TATGTTTTTAAGCAGCTGAATGG - Intronic
1018684068 6:166289680-166289702 AAAGACTTTAAGAAGGTGAAGGG - Intergenic
1018959017 6:168433250-168433272 TATTATTTTAAGAATCTGTCAGG - Intergenic
1020669406 7:11087855-11087877 GATTATTTTAAGAAGTCGAATGG + Intronic
1021377422 7:19925014-19925036 TTTTATATTAAAAAGGAGAATGG + Intergenic
1022736161 7:33078076-33078098 TGTTTTTATATGAAGGTGAAGGG + Intergenic
1022827605 7:34031841-34031863 TATTATTTTATGGAGCTGCATGG + Intronic
1023039636 7:36160943-36160965 TATTATTTTAACATGATGCAAGG + Intronic
1023387912 7:39678576-39678598 TATCACTTTAAAAAGTTGAACGG + Intronic
1023643249 7:42282759-42282781 CACTATTTTAATAAGGTAAAAGG - Intergenic
1023666105 7:42525092-42525114 TAGGATTTTAAGCAGGTGAGTGG - Intergenic
1023695602 7:42843069-42843091 TATTATTTTAAAAAAGAGATGGG - Intergenic
1024452378 7:49562953-49562975 TATTATTTTAAAAAGTAGGAAGG - Intergenic
1025042536 7:55660854-55660876 TTTTATTTTAAAAAGGTAAGTGG + Intergenic
1025164277 7:56697297-56697319 TGTTCTTTTCAGAAGGTTAAAGG - Intergenic
1025753743 7:64314538-64314560 TTTTATTTTTAAAAGGAGAAAGG - Intronic
1026241237 7:68577212-68577234 TATATATTTAAGGAGGTGAAGGG + Intergenic
1026456141 7:70574211-70574233 TATATTTTTAAAAAGTTGAAAGG + Intronic
1027527644 7:79290825-79290847 TATTATTTTAAAAAACAGAAAGG - Intronic
1027545071 7:79517365-79517387 CCTTATATCAAGAAGGTGAAGGG - Intergenic
1027805694 7:82818866-82818888 TATTATTTTCAGAATGCGGATGG + Intronic
1027816900 7:82985735-82985757 TTTTGTTTTAAGAATGTGTAAGG + Intronic
1027980329 7:85211179-85211201 AATTAATTTAATAAGGTAAACGG + Intergenic
1028028023 7:85871055-85871077 TATTATGTGAAGAATGTCAATGG - Intergenic
1028080182 7:86566248-86566270 TATTATATTAAAAGGTTGAAAGG - Intergenic
1028432676 7:90765608-90765630 TTTTTTTTTAAGAATGTTAAGGG + Intronic
1030624267 7:111826895-111826917 TATTTTTTTAAAAAAGAGAAAGG + Intronic
1030750100 7:113221829-113221851 TATTCTTTTAAGAAGGAGATAGG + Intergenic
1030919429 7:115362640-115362662 TATTATGTGAAGAAAGTCAATGG + Intergenic
1030973628 7:116093007-116093029 TAATTTTTTACAAAGGTGAAGGG + Intronic
1032474263 7:132201718-132201740 TTTTATTTTAAGAGGGAGCAAGG + Intronic
1032677046 7:134140747-134140769 TAGTATTTTAAGAATGAAAATGG - Intronic
1032924453 7:136587377-136587399 AATTATTTTTAAAAGATGAATGG - Intergenic
1032984181 7:137318508-137318530 TATAATTTTAAGAAAATAAATGG + Intronic
1033550546 7:142443373-142443395 TAATATTTTTTGAAAGTGAAAGG + Intergenic
1033711940 7:143956211-143956233 TATTCTTATATCAAGGTGAATGG - Intergenic
1034332138 7:150292062-150292084 TTTCATTTTGAGAAGGTGATGGG - Intronic
1034601409 7:152260481-152260503 TATTTTTTTAAAAAGGTGCTGGG + Intronic
1034665898 7:152817811-152817833 TTTCATTTTGAGAAGGTGATGGG + Intronic
1035855818 8:2975218-2975240 TATAATTTTAAGGAAATGAAGGG - Intronic
1037372681 8:18196766-18196788 TATTATTTTAAGAAAGAGGAAGG + Intronic
1038632298 8:29257514-29257536 TATTGTTTTATGGAGGTGAGAGG + Intronic
1039668483 8:39565634-39565656 TATTATTTTAAGAAGCTTTTGGG - Intergenic
1039675645 8:39662948-39662970 TATTATTTTTAAAAAGTAAATGG - Intronic
1040857573 8:51964185-51964207 TATTATTTACCAAAGGTGAATGG + Intergenic
1042289861 8:67158736-67158758 TATTATTTTATTAAGGTGAAAGG + Intronic
1042500482 8:69503191-69503213 TATTACGTGAAGAAAGTGAATGG + Intronic
1042514770 8:69647592-69647614 TATTTTTTTTGTAAGGTGAAAGG - Intronic
1042785589 8:72543133-72543155 TATTATTTCAGGAAAGTAAAGGG - Intronic
1042850399 8:73210922-73210944 TATAATTTTAATAAGATGAAAGG - Intergenic
1043267154 8:78280410-78280432 TTTTATTTTACAAAGGTGGAGGG - Intergenic
1044445773 8:92273617-92273639 TATTTTTTTAAGAAAATCAAAGG + Intergenic
1044512747 8:93101741-93101763 TAAAATTACAAGAAGGTGAAAGG + Intergenic
1045137814 8:99241520-99241542 TTTGATTTTAACAAGTTGAAAGG + Intronic
1045427315 8:102080089-102080111 TTTTTTTTTAAGAAGGTAAGTGG - Intronic
1045566554 8:103322214-103322236 TAATATTTTGGCAAGGTGAATGG + Intronic
1046461591 8:114544203-114544225 TATTGTTTTAAAAAGTTTAAGGG + Intergenic
1047305394 8:123649135-123649157 TTTTATTCTCAGAAGGTCAATGG + Intronic
1048129674 8:131680847-131680869 TAATATTTTAAGAAGCTCCATGG - Intergenic
1048608583 8:135996922-135996944 TAGAATTTTAAAAAAGTGAAAGG + Intergenic
1050727258 9:8664886-8664908 TGTTATTGTTAGAAGTTGAATGG - Intronic
1050780399 9:9326547-9326569 TTTTATTTTCAGAAGATCAAGGG - Intronic
1050910285 9:11059569-11059591 GATTATTAAAATAAGGTGAAGGG - Intergenic
1051008610 9:12381567-12381589 AATCACTTTAAGAAGGTGATTGG - Intergenic
1051288472 9:15521020-15521042 TAATATTTAATGAAAGTGAAAGG + Intergenic
1052654806 9:31343765-31343787 TATTATTTTAAAAACTTGCATGG - Intergenic
1054339190 9:63840864-63840886 TGTTAATTTAAGAATGTAAATGG - Intergenic
1054963646 9:70997520-70997542 TCATATTTTGAAAAGGTGAAAGG - Intronic
1055063153 9:72091587-72091609 TATTATATAAAGAGGGTCAAAGG - Intergenic
1057006025 9:91560784-91560806 TATAATTTTAAGAACATAAATGG + Intergenic
1057079182 9:92159545-92159567 GAATACTTTAAGAATGTGAATGG - Intergenic
1057083427 9:92189188-92189210 TTCTATTTTTAGAAGGTGAGAGG + Intergenic
1058067156 9:100562432-100562454 TGTTTTTTTAAGCAGGAGAAAGG - Intronic
1058292523 9:103259602-103259624 TATTATTTTAAGAAAATGAGTGG - Intergenic
1059046863 9:110878442-110878464 TATTGTTTTCAGAAGCTCAAGGG - Intronic
1059920553 9:119155860-119155882 CACTATTCTAAAAAGGTGAATGG + Intronic
1061691217 9:132332942-132332964 TTTTTTTTTAAGATGGTTAAGGG + Intronic
1203526104 Un_GL000213v1:89810-89832 AAATATTTTAAAAAGGGGAAAGG + Intergenic
1203445584 Un_GL000219v1:52062-52084 TATTATTTTAAAAATGTTGAAGG + Intergenic
1186110019 X:6245700-6245722 TATTATGTTAAATATGTGAAGGG - Intergenic
1186345350 X:8686323-8686345 AATTATTTTAAGAGTGAGAAAGG - Intronic
1186691696 X:11984729-11984751 TATCATCTCAAGAAAGTGAAAGG + Intergenic
1186847351 X:13543914-13543936 TATTATTGTAAGGGGGTGCAAGG + Intergenic
1186906401 X:14115647-14115669 TAATTTCTTAATAAGGTGAATGG + Intergenic
1187395402 X:18915029-18915051 TATTATTCTAAGAATATTAATGG - Intronic
1187721559 X:22156171-22156193 TATTGTCTTAAGAAGGGGTAGGG + Intronic
1188090211 X:25954393-25954415 TATTATTTTAATGAGGTGTCAGG + Intergenic
1188469722 X:30524648-30524670 TATTATTTTAAAATGGGCAAAGG - Intergenic
1188564254 X:31507768-31507790 TATTATTTTATGGAAGTGATAGG + Intronic
1188692177 X:33143248-33143270 TATAATTTTTACAAGGAGAAAGG + Intronic
1188748423 X:33875165-33875187 GAATATTTAAAAAAGGTGAAAGG - Intergenic
1189906555 X:45766279-45766301 TATTATTTTATAAAGGTAATAGG + Intergenic
1190077416 X:47328013-47328035 TTTTATTTTAAGAAAGTGTTGGG + Intergenic
1190241086 X:48658760-48658782 TTTTATTTGCAGAAGGTAAAAGG - Intergenic
1190916008 X:54811639-54811661 TATTCCTTGGAGAAGGTGAAGGG + Exonic
1190939851 X:55029739-55029761 TATTGTTTTAAGAAGATGCCTGG - Intronic
1191613449 X:63141523-63141545 TATTATTTTAAGGAGCTCAATGG + Intergenic
1191622848 X:63237404-63237426 TATTATTTTAAGGAGCTCAATGG - Intergenic
1191930789 X:66368955-66368977 TATTATTTAAAGAAATTGAAAGG - Intergenic
1193453847 X:81704443-81704465 TAATGATTTAAGAATGTGAACGG + Intergenic
1194148787 X:90297442-90297464 TATTACTTTAAGAATATTAAAGG - Intergenic
1194710560 X:97231597-97231619 TAATATTTTCAAAATGTGAATGG - Intronic
1194916268 X:99713002-99713024 TATTACTTTAAGAAGGTGGTAGG + Intergenic
1197127563 X:122965485-122965507 CATCCCTTTAAGAAGGTGAATGG + Intergenic
1197267334 X:124388943-124388965 AATTATTTTAGGAAACTGAAAGG + Intronic
1198131354 X:133698516-133698538 TGTTATTTTAATAAGGCAAAGGG + Intronic
1198708091 X:139471191-139471213 TATTATTATCAGAAGTTGCATGG - Intergenic
1198735566 X:139781340-139781362 TATTATTTCAAGCAGATCAATGG + Intronic
1199813688 X:151377212-151377234 TATTATTTTGAGGAAATGAATGG + Intergenic
1199938781 X:152603659-152603681 TTTTATTTTAAGAAAATGATGGG - Intergenic
1199994569 X:153013321-153013343 GATTTTTTTTAGAAGGTTAAAGG - Intergenic
1200495156 Y:3874174-3874196 TATTACTTTAAGAATATTAAAGG - Intergenic
1201619010 Y:15934284-15934306 TATTTTTTTAAGGATGTGGAGGG + Intergenic