ID: 976121348

View in Genome Browser
Species Human (GRCh38)
Location 4:81785953-81785975
Sequence GGATAATCATAGCCACCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 199}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976121348_976121352 3 Left 976121348 4:81785953-81785975 CCATGAGGTGGCTATGATTATCC 0: 1
1: 0
2: 1
3: 22
4: 199
Right 976121352 4:81785979-81786001 CTTTACAGATGGAGAAACCAAGG 0: 4
1: 24
2: 171
3: 1087
4: 4265
976121348_976121349 -8 Left 976121348 4:81785953-81785975 CCATGAGGTGGCTATGATTATCC 0: 1
1: 0
2: 1
3: 22
4: 199
Right 976121349 4:81785968-81785990 GATTATCCCAACTTTACAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976121348 Original CRISPR GGATAATCATAGCCACCTCA TGG (reversed) Intronic
902760814 1:18579700-18579722 GAATAATCATGCCCACCTCTCGG - Intergenic
902765766 1:18613927-18613949 TGATAATAATAGCTACCTCTCGG - Intergenic
904861665 1:33542465-33542487 GGATAATAGTAGCTACTTCACGG + Intronic
905502606 1:38451575-38451597 GGATAAACAGAGACACCCCAAGG + Intergenic
905524818 1:38628453-38628475 GGATAATAGTAGCTACCTTATGG + Intergenic
906863744 1:49392212-49392234 GGCTAATTATAGCCACATTATGG + Intronic
907196182 1:52688838-52688860 TGATAATAATATCTACCTCATGG + Intronic
907445101 1:54502449-54502471 TGATAATTGTACCCACCTCACGG - Intergenic
907808321 1:57843435-57843457 GACTAATGATACCCACCTCAAGG + Intronic
907931385 1:59004136-59004158 GGATAATTACACCCACCTTAGGG + Intergenic
908519582 1:64928172-64928194 GTATTATCATAAGCACCTCATGG - Intronic
910035707 1:82784970-82784992 GAATAATAAGATCCACCTCATGG + Intergenic
910174152 1:84410906-84410928 GGATAATCATAGCCTTCTTCCGG - Exonic
911721489 1:101195934-101195956 GGATAATGAGAGTCACATCATGG - Intergenic
916715570 1:167444127-167444149 GGGTAATCATATCTACCTTAAGG + Intronic
917249251 1:173039416-173039438 GGATAATCATAGCAGACTAAGGG - Intergenic
917528450 1:175810800-175810822 GGATAATGATAGCTATCTCATGG - Intergenic
918146537 1:181761169-181761191 GGATAATAGTAGCTACCTTATGG + Intronic
919795779 1:201320657-201320679 TCATAATCATATCAACCTCAAGG + Intronic
922619892 1:226983010-226983032 GGATCTTCATGGCCACCTCGCGG - Exonic
1064980876 10:21165550-21165572 TGATAATATTAGTCACCTCAGGG - Intronic
1066508798 10:36072599-36072621 AGATAATCATAAAGACCTCAGGG - Intergenic
1069546696 10:69334328-69334350 GGATAATCAATTCCACCGCAGGG - Intronic
1070682633 10:78459624-78459646 GGACAGTCATACCGACCTCAGGG - Intergenic
1070817993 10:79337194-79337216 GGATAATAATCTCCTCCTCATGG + Intergenic
1070994880 10:80769501-80769523 GAATAATAATACCCACCTCATGG + Intergenic
1071802857 10:89084027-89084049 GGACAATAATATCCACCTCTTGG - Intergenic
1072530579 10:96314733-96314755 GGATGATCATATCTATCTCATGG + Intronic
1074204300 10:111269091-111269113 GGATGATCATAGACAAATCATGG + Intergenic
1077840903 11:5973804-5973826 AGATAATAGTAGCCACCTGAAGG + Intergenic
1079359651 11:19759727-19759749 TAATAATGATATCCACCTCATGG + Intronic
1079637162 11:22758014-22758036 GCATAATCATATGCACATCAAGG - Intronic
1080175651 11:29359618-29359640 GGATAATCATGACCACATAATGG - Intergenic
1081919669 11:46761826-46761848 GCCTAATCAGAGACACCTCAAGG + Intronic
1081926374 11:46832669-46832691 GGATAATAATATCAACTTCAAGG - Intronic
1082762709 11:57142954-57142976 TAATAATCACACCCACCTCATGG - Intergenic
1083901236 11:65644518-65644540 GGATAACCATGCCCAGCTCAAGG - Intronic
1083904370 11:65660476-65660498 GGACACTCATTCCCACCTCAAGG + Intronic
1084401170 11:68944070-68944092 GAATATTCATAGCAGCCTCATGG - Intergenic
1084639340 11:70415224-70415246 GGATGATCATACCTATCTCACGG + Intronic
1085311850 11:75521464-75521486 GGATAACAGTAGCTACCTCAGGG + Intronic
1086115910 11:83249855-83249877 GAATAATAATACCTACCTCATGG + Intronic
1086849155 11:91788099-91788121 TGAAAATCATATCCAACTCATGG + Intergenic
1088947696 11:114531403-114531425 GGATTATAGTGGCCACCTCAAGG + Intronic
1089915653 11:122153209-122153231 GCATAATCATAAGCACTTCAGGG + Intergenic
1090709066 11:129369815-129369837 GGATAATGACAGCCAACTCAGGG - Intergenic
1091613830 12:2034133-2034155 GAATAAAGATATCCACCTCATGG - Intronic
1094156524 12:27342925-27342947 CAATAATCATAGCTACCTCTGGG + Intronic
1094351100 12:29525749-29525771 GGATAATCAGATCCACTTCCAGG - Intronic
1097327877 12:58299797-58299819 GGATCATAATACCCACCTCATGG - Intergenic
1100695507 12:97088444-97088466 GGATAATAATATGCACCTCAAGG + Intergenic
1100944487 12:99765186-99765208 GGATAATAAAACCTACCTCATGG + Intronic
1101285532 12:103308111-103308133 GAATAATCATATCTACCTCTAGG + Intronic
1102363457 12:112310138-112310160 GGATAATAATATGTACCTCAAGG + Intronic
1102497655 12:113330501-113330523 AGATAATCACTCCCACCTCACGG + Intronic
1107988854 13:45799538-45799560 TGATAATGATACCCACCTCCTGG - Intronic
1110747364 13:79070050-79070072 TGATAATAATAGCCAACTCATGG + Intergenic
1112130189 13:96514973-96514995 TGAAAGTCAGAGCCACCTCAAGG + Intronic
1112682333 13:101781028-101781050 TGCTACTCATGGCCACCTCACGG + Intronic
1113612238 13:111655282-111655304 GGACCATAATATCCACCTCATGG - Intronic
1114777885 14:25505755-25505777 GTATAGTCATAGCTACCTCTCGG - Intergenic
1118377033 14:65186446-65186468 GGACAATAATGCCCACCTCATGG - Intergenic
1119431584 14:74571425-74571447 GGATGATCATTGCTACCTTATGG - Intronic
1119492634 14:75050265-75050287 GGTTAAGTATAGTCACCTCAGGG + Intronic
1119689434 14:76659761-76659783 GTTAAATCATAGCCTCCTCAGGG + Intergenic
1119876371 14:78063137-78063159 GGACAATCAAAGTCACCTGATGG + Intergenic
1121044785 14:90779700-90779722 GCATAATCACACCCACTTCATGG - Intronic
1130037866 15:80378103-80378125 GGAGAATGATATCCAGCTCAGGG + Exonic
1130948167 15:88564925-88564947 GGATGATACTACCCACCTCACGG - Intergenic
1131795200 15:96009212-96009234 AGAAAAACATAGCTACCTCATGG + Intergenic
1132713261 16:1278571-1278593 TGATACTCACAGCCACCGCAGGG + Intergenic
1133068932 16:3232817-3232839 GGAAAACCAAACCCACCTCAGGG + Exonic
1133390771 16:5408187-5408209 GGATAATAAAAGCCTCCTCCTGG - Intergenic
1133694915 16:8253825-8253847 TAATAATCATAGCAACCCCATGG - Intergenic
1134463036 16:14446335-14446357 GGATGATGATTCCCACCTCAGGG + Intronic
1135043039 16:19132614-19132636 GGAGTATCTTTGCCACCTCACGG + Intronic
1136633115 16:31500865-31500887 GGATAGTCATAGCTACATAATGG + Intronic
1137675410 16:50301530-50301552 GGAGATTAATAACCACCTCATGG - Intronic
1138081056 16:54091862-54091884 TAATAATCATAGCAACCTGATGG + Intronic
1138352389 16:56352949-56352971 GGGTAATCATGCCCACCCCAAGG + Intronic
1138967038 16:62096934-62096956 GGATAATCATGCCCAGTTCAGGG - Intergenic
1141077393 16:81019813-81019835 GCATGATCATAGCCTGCTCACGG - Intronic
1143253491 17:5539208-5539230 GGAGTATCATACCCACTTCATGG - Intronic
1143634217 17:8155147-8155169 GGATAATAATACCTATCTCACGG - Intronic
1144005409 17:11095008-11095030 GGAAAATCACTGCCACCTTAGGG - Intergenic
1144755697 17:17679376-17679398 GGATAATAGTACCTACCTCATGG - Intergenic
1144814952 17:18027515-18027537 TGATAATAGTACCCACCTCACGG - Intronic
1149527229 17:57366206-57366228 GGATAATAATAGCCAACGCTGGG - Intronic
1149625851 17:58080333-58080355 TGAGAATCATATCCACTTCATGG - Intergenic
1149975196 17:61258509-61258531 GAATAATCATACCTACTTCATGG + Intronic
1150061834 17:62075203-62075225 GGAAAATCCTAGCTTCCTCATGG - Intergenic
1150329141 17:64281097-64281119 TGATAATAATACCCACCTCATGG + Intergenic
1150368937 17:64619015-64619037 GGATACTAAGAGCCACCTCATGG + Intronic
1151224982 17:72641103-72641125 GGATAATAATATCTACCTCACGG + Intergenic
1154304592 18:13220959-13220981 GTAAAACCAAAGCCACCTCAGGG + Intronic
1155500824 18:26485234-26485256 GGATAATGGTACCTACCTCATGG - Intronic
1158438340 18:57450646-57450668 GGAAAATTTTACCCACCTCAGGG + Intronic
1159168531 18:64732895-64732917 GGATAATCATAGCATGATCAAGG + Intergenic
1159543992 18:69816617-69816639 GGATAATAATACCTACTTCATGG - Intronic
1161887203 19:7006028-7006050 TGATGATCATAGGCTCCTCAAGG - Intergenic
1161887999 19:7011874-7011896 TGATGATCATAGGCTCCTCAAGG + Intergenic
1162295468 19:9810644-9810666 GGATGATCATAGCTACCTCACGG - Exonic
1163092013 19:15026798-15026820 GGATAATGACACCCACCTCATGG - Intergenic
1165719972 19:38072230-38072252 TAATAATGATACCCACCTCATGG + Intronic
1165828035 19:38716760-38716782 GCATGATCATAGCAACCTCCCGG - Intronic
1166711997 19:44943818-44943840 GGGTAATAATATCTACCTCAGGG - Intronic
926361770 2:12094911-12094933 GCATAATTTTTGCCACCTCATGG - Intergenic
926430336 2:12779045-12779067 GGATAATCATACCCACCAGCAGG - Intergenic
928198179 2:29229648-29229670 GGATAATAAGACCCACCTGATGG + Intronic
932512314 2:72305664-72305686 AGATAATAATAGCTACCTCATGG + Intronic
932794389 2:74681979-74682001 GGATAATAAAACCTACCTCAGGG + Exonic
934971336 2:98766816-98766838 GGATGATGATATCTACCTCATGG + Intergenic
935898466 2:107763878-107763900 GGATAATGACACCTACCTCATGG - Intergenic
938608604 2:132922688-132922710 GGATAATAATATGCACTTCATGG - Intronic
938635544 2:133222082-133222104 TGATAATAATACCTACCTCATGG - Intronic
939052327 2:137322477-137322499 TGATAATAGTACCCACCTCATGG - Intronic
944307109 2:198191229-198191251 GGCTAATCATACTTACCTCATGG + Intronic
945594980 2:211779536-211779558 GGATAATCAGAGTAACGTCAAGG - Intronic
948521085 2:238538370-238538392 GGATGATCCTAGACACCTCCTGG + Intergenic
948521782 2:238543813-238543835 GGATGATCCTAGACACCTCCTGG + Intergenic
948522265 2:238547450-238547472 GGATGATCCTAGACACCTCCTGG + Intergenic
948522498 2:238549129-238549151 GGATGATCCTAGGCACCTCCTGG + Intergenic
948522642 2:238550182-238550204 GGATGATCCTAGACACCTCCTGG + Intergenic
1170929047 20:20752209-20752231 GGATTATAATACCTACCTCATGG - Intergenic
1170971332 20:21119354-21119376 GGATAATCCTGGAGACCTCATGG + Intergenic
1174393379 20:50231868-50231890 TGATAATAATACCTACCTCATGG - Intergenic
1175327498 20:58140050-58140072 TGATAATGGTACCCACCTCAGGG - Intergenic
1178048580 21:28723679-28723701 TGATAATCATCCCCGCCTCATGG + Intergenic
1179835787 21:44031858-44031880 GGAAAATCACACCCACCCCATGG + Intronic
1180928056 22:19570051-19570073 TGATAATCATATCTAACTCATGG - Intergenic
1182166908 22:28184127-28184149 GGGTAATGATATCCACCTTATGG + Intronic
949596378 3:5552210-5552232 GGATAATAGTAGCTGCCTCATGG - Intergenic
950117793 3:10462570-10462592 GCATAATAATACCTACCTCATGG - Intronic
950191070 3:10976514-10976536 GGATAATAGTAGCCACCTCCTGG + Intergenic
953163579 3:40444402-40444424 TGAGAATAAGAGCCACCTCATGG + Intergenic
953372970 3:42405847-42405869 GGATAACGGTACCCACCTCATGG + Intronic
954966729 3:54618199-54618221 AGATAATTATAACAACCTCATGG - Intronic
956522000 3:70115176-70115198 TAATAATAATAGCTACCTCATGG - Intergenic
956788727 3:72663914-72663936 TGATAATACTACCCACCTCATGG + Intergenic
960154982 3:114290615-114290637 AGATCCTCAGAGCCACCTCACGG + Intronic
960674519 3:120181455-120181477 GGATAATAATACCTACCTTAAGG + Intronic
960797961 3:121508399-121508421 AGATAATAATACCCACCTCAGGG - Intronic
961737489 3:129011167-129011189 TGATAATAATACCCACTTCATGG + Intronic
962425641 3:135266892-135266914 GTGTGATCATAGACACCTCAGGG + Intergenic
962939089 3:140109289-140109311 AGAGAATCATAGTCACCTCCTGG + Intronic
969233387 4:5847817-5847839 GAATAATTATATCTACCTCACGG + Intronic
969567657 4:7988385-7988407 TGATAATCATGCCCACCTCCTGG - Intronic
970023773 4:11598518-11598540 GAATAATAAGAGCCACTTCATGG - Intergenic
970474969 4:16412814-16412836 GGCAAATCATAGCATCCTCATGG + Intergenic
970486856 4:16533353-16533375 AAATAATAATAGCTACCTCATGG + Intronic
971185600 4:24372781-24372803 GGATAATAATAGCTATTTCATGG + Intergenic
975469250 4:74746240-74746262 GGATTATAATAGCTATCTCATGG + Exonic
976121348 4:81785953-81785975 GGATAATCATAGCCACCTCATGG - Intronic
976506361 4:85852375-85852397 GGATATTCAAACCCACCGCAAGG - Intronic
977327951 4:95601118-95601140 GGGTAATAATATTCACCTCATGG + Intergenic
977447135 4:97145009-97145031 AAATAATCATACTCACCTCAAGG - Intergenic
977539220 4:98295538-98295560 TGATAATAATACCTACCTCATGG - Intronic
979209415 4:118081100-118081122 TGATAATAATACCTACCTCATGG + Intronic
980198295 4:129620458-129620480 GGAGAATCATAGCCATTTCACGG + Intergenic
980861191 4:138501269-138501291 GGATGTTCAGAGTCACCTCAAGG - Intergenic
982714039 4:158788127-158788149 GAATAATAGTAACCACCTCATGG + Intronic
987251942 5:16109044-16109066 GGATAATAATACCTACTTCAGGG + Intronic
987989686 5:25194156-25194178 GGATGGTCAAAGCCACCACATGG + Intergenic
988908192 5:35811593-35811615 CAATGATCATAGTCACCTCATGG + Intronic
989178044 5:38548993-38549015 GGATAATAATATCCAGCTCACGG - Intronic
992899902 5:81284107-81284129 GAATAAGCATAGCCACCAGAAGG - Intergenic
994371444 5:98972024-98972046 GAATAATGATATCCAGCTCATGG + Intergenic
998447794 5:142211762-142211784 GCATAACCAAGGCCACCTCAGGG - Intergenic
998616539 5:143746700-143746722 GGATAATCAGACCTACCTTATGG + Intergenic
998705611 5:144756230-144756252 GGTCAATCATACCAACCTCATGG + Intergenic
999802321 5:155049562-155049584 GGATAATTGTATCTACCTCAGGG - Intergenic
1000956349 5:167548115-167548137 GAATAATTTTACCCACCTCAGGG + Intronic
1001379938 5:171298342-171298364 GGATACTCATACCTACCTCAGGG + Intronic
1004290301 6:14360919-14360941 GGAAAATCATAACCAGGTCAGGG - Intergenic
1005997757 6:30941787-30941809 GGATATTATTAGCCACCTCAGGG - Intronic
1006311454 6:33264121-33264143 GGAAAATCACACCCACCTCCTGG + Intronic
1006387005 6:33736847-33736869 TAATAATGATACCCACCTCATGG + Intronic
1007284813 6:40740023-40740045 GGATAATGATACCCATCTAATGG - Intergenic
1007992844 6:46275256-46275278 ATATAATCTTAGCCACCTCAGGG - Intronic
1011239542 6:85256315-85256337 GGTTTATCATTACCACCTCATGG + Intergenic
1013044495 6:106470830-106470852 GGATAATGATACCTAACTCAGGG - Intergenic
1015716304 6:136195889-136195911 GTAAAAACATAGCCAACTCAGGG + Intergenic
1017524013 6:155226931-155226953 GGACAGTCAGAGCCAACTCAAGG - Intronic
1021770312 7:23993945-23993967 AGAAAATGATACCCACCTCATGG + Intergenic
1024584283 7:50827528-50827550 ACATACACATAGCCACCTCAAGG - Intergenic
1027140268 7:75651743-75651765 GGCTAATCATAGCTACCTCTTGG + Intronic
1027700973 7:81469881-81469903 GGAAAATTAAAGCGACCTCAGGG + Intergenic
1030068311 7:105677356-105677378 GGACAATAATACCCACATCATGG + Intronic
1030942146 7:115666123-115666145 GGATAATAATATCTAACTCACGG - Intergenic
1031026999 7:116690273-116690295 GGATAATGATATACATCTCATGG - Intronic
1031423700 7:121580629-121580651 GGATAATGGTAGCTACCACATGG + Intergenic
1032391474 7:131557669-131557691 GGATAATAACACCTACCTCAGGG + Intronic
1035852225 8:2932135-2932157 GGATAATATTATCTACCTCATGG - Intergenic
1041141642 8:54826337-54826359 GCATTATCATTGCCACCTCCTGG + Intergenic
1043359170 8:79450867-79450889 TGATAATCATACCCAGCTCATGG + Intergenic
1043823504 8:84897121-84897143 GAGTAATAATACCCACCTCATGG + Intronic
1044023210 8:87133491-87133513 GGATAATTATACCTACCTTATGG - Intronic
1044617517 8:94157502-94157524 GGACTATCATAGCTACCTCTGGG - Intronic
1045356208 8:101391386-101391408 TGATAATAATAGTTACCTCAAGG - Intergenic
1045906420 8:107351008-107351030 AGAAAATGACAGCCACCTCAAGG + Intronic
1047529537 8:125662726-125662748 GGAAAATAATATCCACCTCACGG - Intergenic
1049928325 9:431405-431427 GGAAAAACATGGCTACCTCAAGG - Intronic
1051025889 9:12610293-12610315 AAATAATTATAGTCACCTCAAGG - Intergenic
1051707653 9:19897710-19897732 GGATCATAATACCTACCTCATGG - Intergenic
1056529577 9:87474984-87475006 GGATAATGATACCTATCTCATGG - Intergenic
1060019198 9:120114547-120114569 GGGTAATCTCAGCCACCCCATGG + Intergenic
1060235285 9:121858406-121858428 AGATAATCATATCTACCTCTAGG + Intronic
1060483801 9:124034362-124034384 GGAAAATCATGGCCACCTGGAGG + Intergenic
1186247183 X:7626602-7626624 GCAAAATCATACCCACCTAAGGG - Intergenic
1188464112 X:30459034-30459056 GGATAATAATATCAACCCCATGG - Intergenic
1188520153 X:31029925-31029947 GGACAATCATACACATCTCATGG - Intergenic
1190456462 X:50632764-50632786 GGAATATCATGGCCGCCTCATGG - Intronic
1192035533 X:67558858-67558880 TGATAATTGTAGCTACCTCATGG - Intronic
1194172043 X:90599143-90599165 GGATAATAATACCTACCTCCCGG - Intergenic
1194623784 X:96203781-96203803 GGATAATCATATCCTTCTCCAGG - Intergenic
1194758147 X:97762261-97762283 GGATAATCCTTCCAACCTCAGGG + Intergenic
1196318381 X:114257115-114257137 GGATAATCAAATCTACCTCATGG + Intergenic
1196858224 X:120003129-120003151 TGATAATAATATCTACCTCATGG + Intergenic
1198434471 X:136602739-136602761 GGATAATACCACCCACCTCATGG - Intergenic
1199255556 X:145715219-145715241 TAATAATGATAGCTACCTCATGG - Intergenic
1199493026 X:148422222-148422244 GGATAATAATAGATAGCTCATGG + Intergenic
1200518274 Y:4176884-4176906 GGATAATAATACCTACCTCCCGG - Intergenic
1201714379 Y:17028244-17028266 TGATTGTCATAGCCACCACAGGG + Intergenic