ID: 976122718

View in Genome Browser
Species Human (GRCh38)
Location 4:81800583-81800605
Sequence AAACCCTGCTTCACAAAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 20, 1: 32, 2: 26, 3: 28, 4: 193}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976122717_976122718 10 Left 976122717 4:81800550-81800572 CCGTAATCTCGTTCTGGTTGCTG No data
Right 976122718 4:81800583-81800605 AAACCCTGCTTCACAAAGATAGG 0: 20
1: 32
2: 26
3: 28
4: 193
976122715_976122718 20 Left 976122715 4:81800540-81800562 CCAGTCTACTCCGTAATCTCGTT 0: 2
1: 11
2: 26
3: 30
4: 48
Right 976122718 4:81800583-81800605 AAACCCTGCTTCACAAAGATAGG 0: 20
1: 32
2: 26
3: 28
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976122718 Original CRISPR AAACCCTGCTTCACAAAGAT AGG Intronic