ID: 976124478

View in Genome Browser
Species Human (GRCh38)
Location 4:81818941-81818963
Sequence AAGAGTGAGAAGGGAGTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 493
Summary {0: 1, 1: 0, 2: 4, 3: 42, 4: 446}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976124478 Original CRISPR AAGAGTGAGAAGGGAGTTGT TGG Intronic
900341399 1:2191002-2191024 CAGAGTGAGAAGGCAGCTGATGG - Intronic
902882402 1:19381281-19381303 GAGAGGGAGGAGGGAGTGGTTGG - Intronic
903237479 1:21959554-21959576 AAACCTGAGGAGGGAGTTGTGGG + Intergenic
903246372 1:22018782-22018804 AAGGATGGGAAGAGAGTTGTAGG - Intergenic
904420631 1:30388904-30388926 AAGAGTGGGAAGGGGGTAGGAGG - Intergenic
904633033 1:31857421-31857443 TGGAGTGAGAAGAGAGTTCTAGG + Intergenic
905038293 1:34930821-34930843 AACAGAGAGCAGGGAGTTGTTGG - Intergenic
906481761 1:46203813-46203835 AAGAGTGAGTGGGGTGTTGATGG + Intronic
906846798 1:49201151-49201173 AAAAGTGAGAATGGAGATGGTGG - Intronic
909342858 1:74551078-74551100 CAGAGTGAGAAGGGAGAGGAGGG - Intergenic
910791417 1:91054957-91054979 CAGAGTGAGAAGGCAGAGGTGGG + Intergenic
911200563 1:95039446-95039468 AGCAGTGAGAAGGGAGATTTAGG + Intronic
911592306 1:99762215-99762237 AAAAGTGAGAATGGACTTTTGGG + Intronic
911983391 1:104594100-104594122 GAGTGTGAGAAGTGAGTTTTGGG + Intergenic
912259220 1:108092674-108092696 AAGAATGAGATGGGAGTCATGGG - Intergenic
914671953 1:149877572-149877594 AAGAGCAGAAAGGGAGTTGTTGG + Intronic
914879632 1:151537582-151537604 AAGAGAGATGAGGGAGGTGTCGG - Exonic
914949369 1:152098882-152098904 AAGAGTGAGAAGGGAAAGGAAGG - Intergenic
915897975 1:159826195-159826217 AAGAGTAAAGAGGGAGGTGTGGG + Intergenic
915940154 1:160113913-160113935 GAGAGTGAGAGGGGAGTAGCGGG - Intergenic
916366860 1:164038871-164038893 AGGTGTGTGAAGGGAGTGGTAGG - Intergenic
916454566 1:164957663-164957685 AAGACTAAGAAGAGAGCTGTGGG - Intergenic
916560635 1:165931648-165931670 TAGAGTTAGTAGGGAGTTATGGG - Intergenic
916743349 1:167665088-167665110 AAGAGTGTGAAGGGTCTTTTGGG - Intronic
916869776 1:168901118-168901140 AAATGTGAGATGGGAGTTGGTGG + Intergenic
917832180 1:178903490-178903512 AAAAGTGAGAAGGGGGATGAGGG - Intronic
918371208 1:183863258-183863280 CAGAGTGAGATGGGAGTCATGGG + Intronic
918877090 1:190061800-190061822 TAGAGGGAGGAGAGAGTTGTGGG - Intergenic
919352843 1:196481306-196481328 AAGAGTGAGAAGGGAGGAAGAGG + Intronic
920263171 1:204703453-204703475 AAGAGTGTGCAGGGAGCTGGAGG - Intergenic
920335859 1:205244711-205244733 AAGGGTGACAAAGGAGTTGGGGG + Intronic
920350421 1:205334514-205334536 AAAAGTTAGAAGGGAATTTTCGG + Intergenic
920886230 1:209931291-209931313 AAGGGACAGAAGGGAGTTTTGGG - Intergenic
921062644 1:211598784-211598806 CAGAATGAGAAAAGAGTTGTGGG - Intergenic
922374906 1:224953009-224953031 AAAAGTGAGAAGGAGGTTGTTGG + Intronic
922722676 1:227906609-227906631 AGGAGGGAGAAGGGAGTAGAAGG - Intergenic
923240058 1:232075680-232075702 AAAAGAGAGAAGAGAGCTGTGGG - Intergenic
924036756 1:239945627-239945649 AAGAGTGACAGAGGAGCTGTTGG - Intergenic
924239110 1:242024409-242024431 ATGAGGGAGAAGGGAGTTAAAGG - Intergenic
924845620 1:247767177-247767199 AAGGGTGGGAAGGGGGTTGAGGG - Intergenic
1063282478 10:4645432-4645454 AAGAGTGAGAAGAGAGTGAAGGG - Intergenic
1064200540 10:13281022-13281044 AACATCGAGAAGGAAGTTGTAGG - Exonic
1064591753 10:16899801-16899823 TGAAGTGAGAAGGGAGTTTTAGG - Intronic
1064841704 10:19599771-19599793 TAGAGTGAGAAGGGAGTACTTGG + Intronic
1065498814 10:26357750-26357772 AAGAGTGAAAGGGGATATGTGGG + Intergenic
1065797834 10:29323405-29323427 GAGAGTGAGGAGGGGGCTGTGGG - Intergenic
1066363980 10:34758533-34758555 AAGAGGAAGAAGGAAATTGTGGG - Intronic
1066433595 10:35375899-35375921 AAGGGTGAGAATAGAGTGGTGGG + Intronic
1066604098 10:37142350-37142372 AAGTGTGATATGGGAGTAGTTGG + Intronic
1066629489 10:37445009-37445031 AAGAAAGAGAGGGGAGATGTTGG - Intergenic
1067248466 10:44566374-44566396 AAGAGAGAGAGGGGAGTGGGAGG + Intergenic
1068064012 10:52105959-52105981 AAGAGTGGGAGGGGAGTGGGGGG - Intronic
1068628031 10:59270520-59270542 AAGGGAGAGAAGGGAGTAGGAGG + Intronic
1069722779 10:70560280-70560302 AAGAGTGAGCAGGGAGTGGTGGG + Intronic
1070279574 10:75038693-75038715 AAGAGTTGGAAGGGAGATGGAGG + Intronic
1070376196 10:75833248-75833270 AAGAGAAAGAAGGGTTTTGTAGG + Intronic
1070606472 10:77901839-77901861 AAGAGTGTGCAGGGAGAAGTGGG - Intronic
1072073959 10:91949802-91949824 AAGAATGAGAAGAGAGTTAGGGG - Intronic
1072081229 10:92034006-92034028 AAGACTGAAAAGGGAGTATTAGG + Intergenic
1072486359 10:95859701-95859723 AAGAGTAAAAAGGCAGTTATAGG + Intronic
1072822142 10:98568640-98568662 AAGGCAGAGAAAGGAGTTGTTGG - Intronic
1072837938 10:98736855-98736877 AAGTGTGAAATGGGAGTTGGAGG - Intronic
1073085106 10:100883287-100883309 AGGGGTGAGAAGGGGGGTGTTGG + Intergenic
1073529156 10:104215733-104215755 GAGATTGAGAAGGGAGTAGAGGG - Intronic
1073716071 10:106108861-106108883 AAGAGGGAAAAGGGAGAGGTGGG - Intergenic
1073845426 10:107548469-107548491 AGGAGTGTGAAGGGATGTGTGGG - Intergenic
1074172562 10:110957545-110957567 AAGAGTGAGTTGGAAATTGTGGG - Intronic
1074936659 10:118188517-118188539 GAGAGTGAGAAGGGAGACATGGG + Intergenic
1076895432 10:133309109-133309131 AAGAGGGAAAAAGTAGTTGTAGG + Exonic
1078536491 11:12179198-12179220 GCCTGTGAGAAGGGAGTTGTGGG - Intronic
1078724430 11:13916872-13916894 AAGAGTGTGAAGGGAATTGAGGG + Intergenic
1078752688 11:14180030-14180052 AAGGGTCAGATGGGAGGTGTGGG - Intronic
1079242821 11:18732746-18732768 AAGAGAGTGTAGAGAGTTGTGGG - Intronic
1079989483 11:27231785-27231807 GAGAGTGAGAAGGAAGCTGTTGG - Intergenic
1083387000 11:62318472-62318494 AAGAGAGAGAAGGTTGCTGTGGG - Intergenic
1083581975 11:63830805-63830827 AAAACTGAGGAGGGGGTTGTGGG - Intergenic
1083681452 11:64353687-64353709 AGGAGTGAGAAGGGAGAGGTGGG - Intronic
1083722225 11:64609043-64609065 AAGAGTGGGCAGGGAGGAGTTGG + Intronic
1084936028 11:72587114-72587136 GAGAGTGAGAAGGGTATTCTAGG - Intronic
1085453258 11:76650394-76650416 GAGAGTGTCAAGGGAATTGTGGG + Intergenic
1086019548 11:82210186-82210208 ATGAGAAAGAAGGGAGATGTAGG - Intergenic
1087008209 11:93489395-93489417 CAGGGAGAGAAGGGAGATGTTGG + Intronic
1087509462 11:99072153-99072175 ATGAATGGGAAGGGAGTTGAGGG + Intronic
1087746375 11:101952226-101952248 TACAGTGAGAAGAGAGTTGTGGG + Intronic
1089463217 11:118665206-118665228 AAGAGGGAGGGCGGAGTTGTTGG + Intronic
1089851191 11:121498027-121498049 CAGAATGAGAAGAGAGATGTGGG + Intronic
1090857195 11:130620840-130620862 AAGTGGGAGAGGGGAGTTGGGGG - Intergenic
1092583486 12:9873730-9873752 CACAGTGAGAAGGCAGTAGTCGG - Intergenic
1092782832 12:12003247-12003269 AACATAGAGAAGGGAGTTGAAGG - Intergenic
1093378061 12:18455668-18455690 AACAGTGAGAAGACAGCTGTCGG - Intronic
1093384454 12:18534351-18534373 AGGGGTGAGAAGTGAGTTGGTGG - Intronic
1094298597 12:28935796-28935818 AACAGTGAGAAGGGAGGGGCGGG - Intergenic
1094719229 12:33045966-33045988 AAGGGTGGGAAAGGAGCTGTGGG - Intergenic
1095403390 12:41840603-41840625 AAAAGTGCCAAGGGAGTAGTTGG + Intergenic
1095593880 12:43937236-43937258 AAGAGTGAAAAGGGCTTAGTGGG + Intronic
1095716474 12:45351564-45351586 CAGAGTGGGAAGTGAGTTGAGGG + Intronic
1095840074 12:46683208-46683230 AAGAACGAGAATGGAGTCGTTGG + Intergenic
1096160017 12:49368031-49368053 AAGGGAGAGAAGGGCGTTCTTGG + Intronic
1096228513 12:49884387-49884409 AGGAGTGAGAAGGGGGATGTGGG + Intronic
1096794085 12:54063097-54063119 GAGAGAGAGTAGGGAGTGGTAGG - Intergenic
1097221914 12:57456106-57456128 AAAAGTGAGCAGGGAGCTGTAGG - Exonic
1097480570 12:60119370-60119392 AAGTGGGAGCAGGGAGTTTTTGG + Intergenic
1098228286 12:68347135-68347157 AAGAGTGAGGAGGGAAATTTAGG - Intergenic
1098442568 12:70534124-70534146 TAGAATGTGAAGGGAGTTATTGG + Intronic
1099328587 12:81251999-81252021 AAGAGTGAGAATGGAGGAGATGG - Intronic
1099991154 12:89721721-89721743 AAGAATAAGAAGGTAGTTATTGG - Intergenic
1100171262 12:91977693-91977715 GAGAGAGTGAAGGGAGATGTGGG + Intergenic
1100468507 12:94870782-94870804 AAAAGTTAGAAAGCAGTTGTGGG - Intergenic
1100731977 12:97480785-97480807 AAGAGTGAGAAGAGACTTAGAGG - Intergenic
1101660348 12:106759752-106759774 AAGAGGGAGAAGGGCGTAGGTGG - Intronic
1102548706 12:113675131-113675153 GAGAGAGAGAAGGGTGGTGTTGG + Intergenic
1102672324 12:114630617-114630639 AAGAGTGAGATGTGAGATGAAGG + Intergenic
1104051360 12:125195997-125196019 CTGAGTGAGATGGGAGCTGTTGG + Intronic
1104310740 12:127652419-127652441 AAGAGGGAGAATGGATTTCTTGG - Intergenic
1104947979 12:132425527-132425549 GAGAGAGAGAAGGGAGATGGCGG + Intergenic
1105617364 13:22030827-22030849 AAAGGTTAGAAGGGAGTTGTAGG - Intergenic
1106811168 13:33359699-33359721 AAGAATGGCAAGGGAGCTGTGGG - Intergenic
1107664944 13:42679123-42679145 AAGTGTGTGAAGGGTGTTCTAGG + Intergenic
1108372008 13:49779521-49779543 TAGAGTAAGTAGGGAGTTGTTGG - Intronic
1108670673 13:52684883-52684905 AAGAGAGAGCAGGGGTTTGTTGG + Intronic
1109712168 13:66176232-66176254 TAGAATGTGAAGGAAGTTGTGGG - Intergenic
1109738213 13:66515121-66515143 AAGGCTCAGAAAGGAGTTGTGGG + Intronic
1109745021 13:66613472-66613494 AATTGTGAGAAAGGATTTGTGGG + Intronic
1110703751 13:78580469-78580491 AAAAGGGAGTAGGGAGTTTTTGG - Intergenic
1111038000 13:82704713-82704735 AAACCTGAGGAGGGAGTTGTGGG + Intergenic
1111330560 13:86759059-86759081 AAGAGTTAGAAAGGTGTTGGTGG + Intergenic
1111424334 13:88059318-88059340 TAGTGTGAGAAGGGGGTTATTGG - Intergenic
1111802211 13:92995086-92995108 AAGAATGAGAAGAGAGGGGTGGG - Intergenic
1112221451 13:97495314-97495336 AAGAGTGAAAAGGGTGGTCTAGG + Intergenic
1112889657 13:104213513-104213535 AAGAGAGTGAAGGGAGATATGGG + Intergenic
1113049857 13:106198997-106199019 GAGCCTGAGGAGGGAGTTGTGGG - Intergenic
1114617144 14:24074387-24074409 AGGAGTGACAGGGGAGTTGGGGG - Intronic
1115110893 14:29820522-29820544 AAAAGTGAGAAGGGAATTCCAGG + Intronic
1115765038 14:36614571-36614593 AAGAGGGAGATGGGAGGTGCTGG - Intergenic
1115772715 14:36683010-36683032 AAGGGAGAGAGGGGAGGTGTAGG + Intronic
1115865638 14:37743660-37743682 AATAATGAGAAGGGATTTGTGGG + Intronic
1117015706 14:51514912-51514934 TAGATTGAGAAGGTGGTTGTGGG + Intronic
1119722333 14:76899651-76899673 AAGAGTGAGGAGGGCGGTGAAGG + Intergenic
1119866284 14:77977930-77977952 AAGAGTTTGAGAGGAGTTGTTGG + Intergenic
1119904519 14:78289494-78289516 AAGAGTCAGAATGAGGTTGTAGG - Intronic
1120179458 14:81328799-81328821 GAGAGTGAGAGGGGAGGTGCCGG - Intronic
1120492840 14:85198436-85198458 AAGAGTGAAATGTGAGTTCTAGG + Intergenic
1121987707 14:98523988-98524010 AAGTTTGAGAAGGGAGGTATGGG - Intergenic
1122000381 14:98646019-98646041 AAGAGTGTGAAGGGATGTGGAGG - Intergenic
1124820199 15:33037467-33037489 GTTAGTGGGAAGGGAGTTGTTGG + Intronic
1125148559 15:36503739-36503761 AAGAGAGAGAAGAGAGGTGTTGG + Intergenic
1125280388 15:38036407-38036429 AAGAGAGAGAAGGATGTTGTAGG - Intergenic
1125476911 15:40053994-40054016 AAGAGTGAGAAGAAAGTTGGGGG + Intergenic
1126355605 15:47792661-47792683 AAGAGGGAGAGGGGAGAGGTTGG - Intergenic
1127305026 15:57697052-57697074 AAGTGTGAGAAGGCAGTTTGGGG + Intronic
1128127714 15:65205216-65205238 AAGAATGAGGAGGGAGTTAGAGG - Intronic
1129930737 15:79408598-79408620 AGGAGTGGGAAGAGAGGTGTGGG + Intronic
1134244098 16:12527135-12527157 AAGAAGGAGAAGGGGGCTGTGGG - Intronic
1134647162 16:15878195-15878217 AAGAGGGAGAAAGGTGATGTAGG + Intronic
1135263386 16:21000372-21000394 AAGGTGGAGAAGGAAGTTGTTGG + Exonic
1135627796 16:24011228-24011250 AACAGTGAGACTGGAATTGTGGG - Intronic
1135637431 16:24090519-24090541 AAGAGGGGCAAGGGAGTTGAGGG + Intronic
1136114393 16:28085562-28085584 AAATCTGAGGAGGGAGTTGTGGG + Intergenic
1136346499 16:29679380-29679402 AAGAGTGAGAAGGGGCCTCTGGG - Intronic
1137500279 16:49005664-49005686 CAGAGTGAGAAGGGTGTATTTGG + Intergenic
1137676610 16:50306700-50306722 AAGAGAGAGACGGGTGGTGTAGG + Intronic
1137721978 16:50632812-50632834 AAAGGGGAGAAGGGAGTTGTGGG - Intronic
1137948979 16:52764024-52764046 AAGAGAGAGCCGGGAGTTGGAGG - Intergenic
1138041667 16:53677688-53677710 AAATGTGAGAAGGATGTTGTAGG + Intronic
1139178446 16:64717195-64717217 AAAAGGGAGAAGGGAGCAGTTGG + Intergenic
1139323535 16:66134380-66134402 AAGAGATAGAGGGGATTTGTTGG - Intergenic
1139583060 16:67884649-67884671 AGGAGGGAGAAGGGAGATCTGGG - Intergenic
1140082585 16:71762814-71762836 AAAACTGAGGAGGGGGTTGTGGG + Intronic
1141782465 16:86172616-86172638 AAGAGTGGGAGGGGAGATGGAGG - Intergenic
1142249591 16:88985294-88985316 CAGAGTGGGAAGGGTGTTTTAGG - Intergenic
1143363209 17:6388056-6388078 CAGAGTGAGAAGGGGGATGTGGG + Intergenic
1143563893 17:7710030-7710052 AAGAGGGTGAAAGGAGATGTGGG - Exonic
1143600773 17:7944391-7944413 AAGAGCCAGAAGGGAAATGTTGG - Intronic
1143730412 17:8879519-8879541 CAGAGTGAGATGGGAGTGGGAGG + Exonic
1143873890 17:9977393-9977415 ATGAGTGAAAAGGGAGATGCTGG - Intronic
1144193257 17:12866037-12866059 AAGAGTGGGGTGGGAGTTGGGGG + Intronic
1144873323 17:18383397-18383419 GAGAGTGAGAAGGGACGTGGTGG + Intronic
1145173522 17:20680138-20680160 AAGTCAGAGAAGGGAGATGTTGG - Intergenic
1145747486 17:27331193-27331215 AACAGTGAGAAGTGAGTTGGGGG + Intergenic
1146464981 17:33079357-33079379 AAGGGTGGGAAGGGTGTTGCTGG + Intronic
1146629683 17:34460791-34460813 AAGGTCGAGAAAGGAGTTGTTGG - Intergenic
1146815376 17:35937960-35937982 CTGAGTGAGAAGGGAGATGGAGG + Intronic
1147807219 17:43140371-43140393 AAACCTGAGGAGGGAGTTGTGGG + Intergenic
1148169115 17:45504629-45504651 AAACCTGAGGAGGGAGTTGTGGG + Intergenic
1148279705 17:46338379-46338401 AAACCTGAGGAGGGAGTTGTGGG - Intronic
1148301923 17:46556235-46556257 AAACCTGAGGAGGGAGTTGTGGG - Exonic
1148435365 17:47679991-47680013 AAGAGAGAGAAGGTATTGGTCGG - Intronic
1150172257 17:63010796-63010818 AACAGTGAGATGGAAGATGTGGG + Intronic
1150283528 17:63943228-63943250 GAGAGAGAGAAAGGAGGTGTTGG + Intronic
1150400309 17:64851095-64851117 AAACCTGAGGAGGGAGTTGTGGG + Intergenic
1150930544 17:69580020-69580042 AAGACAAAGAAGGGAGATGTAGG + Intergenic
1151112742 17:71698184-71698206 AAGAGTAGGAAGGGAATTGAAGG + Intergenic
1151368271 17:73630977-73630999 AAGACAGAGAAGGGAGGTGTTGG - Intronic
1151747918 17:76021634-76021656 GAGAGTGAGAAGGGACGTGGTGG - Intronic
1151854618 17:76711777-76711799 AAGAGTGGGTGGGGAGTGGTAGG - Intergenic
1153024614 18:661114-661136 AAGATTGAGAAATGATTTGTTGG + Intronic
1153330362 18:3867398-3867420 AAGTGAGAGAAGGGAGTACTGGG + Intronic
1153649873 18:7230386-7230408 TTTAGTGAGAAGGGAGTTGTGGG - Intergenic
1154476426 18:14764150-14764172 AAGTGTGATATGGGAGTTGTTGG + Intronic
1155116501 18:22773547-22773569 GAGAGAGAGGAGGGAGTTGCCGG - Intergenic
1155355088 18:24944177-24944199 AAAAATGAGAAGGGGGTTGAGGG + Intergenic
1156513364 18:37660069-37660091 AAGGGTGAGAAGGGGGTTTTGGG + Intergenic
1156548781 18:37992889-37992911 TAGAGTGAGATGTTAGTTGTAGG - Intergenic
1156792432 18:40991688-40991710 AAGACTGAGAAGATAGTTGGTGG - Intergenic
1158308973 18:56138752-56138774 ATGAGTGGGAAGGGAGTGGGAGG + Intergenic
1159548861 18:69874331-69874353 AAGGGTGAGAGGTGTGTTGTGGG - Intronic
1160173255 18:76571876-76571898 AAGAGGGGGATGGGAGGTGTGGG + Intergenic
1160210126 18:76870866-76870888 ATGAGTGAGATGGGAGTCCTTGG + Intronic
1161168113 19:2799526-2799548 AAGAGTGAGACGGGAGGCGGAGG - Intronic
1161344067 19:3759363-3759385 TAGAGTGAGAAGGGGACTGTGGG - Intronic
1161415719 19:4145416-4145438 AAGGGGGAGAAGGGAGAGGTGGG + Intergenic
1162125480 19:8497595-8497617 ACCAGTGAGAAGGCTGTTGTAGG - Intronic
1162318196 19:9954034-9954056 AGGTGTGAGAAGGGAATTCTGGG - Intergenic
1165289732 19:34873641-34873663 AAGAGTGAGCAGAAAGTTGCTGG + Intergenic
1165294962 19:34919159-34919181 AAGACTTACAAGGGAATTGTTGG - Intergenic
1165481180 19:36065359-36065381 AAAAGAGAGAAGGGAGTAGAAGG + Intronic
1165883640 19:39061399-39061421 AAGAGAGCGGAGGGAGCTGTGGG - Intergenic
1165921903 19:39304273-39304295 AAGAGTGAGAGGAGAGTAGGTGG - Intergenic
1166648728 19:44553679-44553701 AACAGGAAGAAGAGAGTTGTCGG + Intergenic
1166818307 19:45560495-45560517 GAGAGAGAGAAGGGAGATGGGGG - Intronic
1167224157 19:48225702-48225724 ATGAGTGAGAAGAGAGTGATAGG + Intronic
1167409633 19:49337262-49337284 AGGAGAGGGAAGGGAGTGGTGGG + Intronic
1167736142 19:51295695-51295717 AAGAGTAAGGAGGGATTTCTAGG + Intergenic
925417213 2:3678762-3678784 AAGGGTGAGAAGCACGTTGTCGG + Intronic
925886001 2:8394244-8394266 TAGAGGGGGAAGGGAGCTGTGGG - Intergenic
926608719 2:14923734-14923756 AGGAGTGAGAAGTGATTTTTAGG + Intergenic
927315495 2:21676385-21676407 AATAGTGAGAAGGGGGTTGTGGG + Intergenic
927706826 2:25301627-25301649 CTGAGTCAGAAGGGACTTGTGGG - Intronic
927753708 2:25692027-25692049 CAAAGTGTTAAGGGAGTTGTGGG + Intergenic
928030658 2:27775814-27775836 CAGAGTGAAAAGGGAATTCTAGG + Intronic
928321088 2:30283427-30283449 AAGAGTGAGCTGTGATTTGTAGG + Intronic
929174018 2:38959509-38959531 AAGGGAGAGAAGAGAGTTGAAGG + Intronic
929302771 2:40325024-40325046 AAGAGTGAGAAGGGATGTGGTGG - Intronic
929427800 2:41861704-41861726 AAAAGTGAGTAGGCATTTGTTGG - Intergenic
930490898 2:52070324-52070346 AAGGGTGAGAATTGAGATGTTGG - Intergenic
930788773 2:55301035-55301057 AAGAGGCAGAAGGGAGTATTAGG + Intronic
931634934 2:64332556-64332578 AAGAGTGGGGAAGGAGTTGGTGG + Intergenic
932173196 2:69576138-69576160 GAGAGTGAGGAGGGTTTTGTAGG - Intronic
932701089 2:73992110-73992132 AAGAGTGAGAGGGAAGAGGTAGG + Intronic
934937044 2:98473049-98473071 AAGAGTGAGGAGGGCAGTGTGGG + Intronic
934977110 2:98810450-98810472 AAGGGTAAGAAGAGAGTTGGAGG + Intronic
935873917 2:107485681-107485703 AAGAGAGAGAGGGGAGGTCTAGG - Intergenic
937383045 2:121398940-121398962 AAGAGAGAGAAGGGGCTTCTGGG - Intronic
937588025 2:123579806-123579828 AAGAGTGAGAAATGAGTCTTAGG + Intergenic
939684333 2:145179468-145179490 AAGAGTGAGTAGTGAATTGTGGG + Intergenic
939740298 2:145898107-145898129 GAGAGTGAGTAGAGAGTTCTGGG + Intergenic
940534138 2:154917063-154917085 TAGAGAGAGAAGGGTTTTGTGGG + Intergenic
940794118 2:158058867-158058889 GAGAGGGAGAAGAGAGTTGCAGG + Intronic
941391283 2:164918093-164918115 AAGAGAGAGAAGAAAGTTCTCGG + Intronic
941538098 2:166745862-166745884 AGGTATGAGAAGGGAGTTGCAGG - Intergenic
941584781 2:167343994-167344016 AAAAGGGAGAAGGGAGTATTGGG + Intergenic
942625479 2:177895755-177895777 AAAAGTGAGTAGACAGTTGTTGG + Intronic
944267691 2:197746957-197746979 GCGAGTGAGATGGGAGATGTTGG + Intronic
944336892 2:198544493-198544515 AAGAGTGTGTTGGGAATTGTGGG - Intronic
944537464 2:200725386-200725408 AGGAGTGAGATGGGAGGGGTGGG - Intergenic
944605608 2:201349185-201349207 GCGAGTGAGCAGGGAGTGGTGGG - Intronic
944818959 2:203409635-203409657 AAGTGTGGGAAGAGAGTAGTTGG - Intronic
945149500 2:206773693-206773715 AAGATTGAGAAGGAAATTGGAGG + Intronic
946863278 2:224020303-224020325 AGGAGTCAGAAGAGAGTTGGGGG + Intronic
947286758 2:228525335-228525357 GAGAGGGAGGAGGGAGGTGTTGG + Intergenic
947563372 2:231177409-231177431 AAGAGTGAGAAGAGACATTTAGG - Intergenic
948931153 2:241133296-241133318 CAGAGTCAGATGGGAGCTGTTGG - Intronic
1168737194 20:151137-151159 CAGAGTGAGAAGGCAGTTTATGG - Intergenic
1168758824 20:334639-334661 AAGAGTGAGAAGGACCTTGAAGG + Intergenic
1168767025 20:388590-388612 AAGTGGGAGATGGGAGTTGCAGG + Intronic
1168955981 20:1834700-1834722 AGGAGGGAGAAGGGAGAAGTTGG + Intergenic
1169393076 20:5205924-5205946 CAGAGAGGGAAGGGAGTTCTTGG + Intergenic
1169452597 20:5724886-5724908 AAGACTGGGCAGAGAGTTGTAGG + Intergenic
1170073052 20:12389848-12389870 AAGCCTGAGGAGGGGGTTGTGGG - Intergenic
1170370188 20:15639863-15639885 AAGAGAGAGGAGAGAGATGTAGG + Intronic
1171203235 20:23258341-23258363 AGGAGTGAGCAGGGGGTTATTGG - Intergenic
1171334288 20:24369826-24369848 AAAAGTGAGAAGAGTGATGTTGG + Intergenic
1172433963 20:34915112-34915134 ACCAGTGAGAAGGGAGTTTGGGG + Intronic
1172637022 20:36416843-36416865 ATGGGAGAGAAGGGAGTTGATGG - Intronic
1172650772 20:36500035-36500057 AAGAATGAGATGGGGGCTGTGGG + Intronic
1172998724 20:39090522-39090544 AAGAATGAGATGGGAGATATGGG + Intergenic
1174434489 20:50496172-50496194 AAGAGTTAAAAGTAAGTTGTGGG + Intergenic
1174530421 20:51208379-51208401 CAGAGTGAGACAGGAGTGGTGGG + Intergenic
1174705589 20:52652718-52652740 AAAACTGAGGAGAGAGTTGTGGG - Intergenic
1174722343 20:52826477-52826499 AAGTGTGAGAAGGAAGTAGCTGG - Intergenic
1174725263 20:52854847-52854869 AAGAGAGAAAAGGGAATTGGAGG - Intergenic
1176969030 21:15244617-15244639 AAGTGTGAGAAGAGATTTCTTGG + Intergenic
1179243504 21:39611505-39611527 AAGGGTGGGAAGGGAGTGGGGGG + Intronic
1179626737 21:42653471-42653493 AAGAGGGGGAAGGGAGGTGCAGG + Intergenic
1180129078 21:45814357-45814379 AATAGTGAGTAGTGAGTGGTGGG + Intronic
1182070019 22:27456964-27456986 AAGAGTGAGAAGGGATCAGCCGG - Intergenic
1183702704 22:39458722-39458744 AAAGGTGGGAAGGGCGTTGTGGG + Intronic
1183928817 22:41224678-41224700 GAGGGAGAGAAGGGAGTTGGAGG - Intronic
1184037118 22:41923583-41923605 CAGAGAGAGAAGGGAGTTCAAGG + Intergenic
1184536998 22:45094231-45094253 GAGAGTGAGAGGGGAGTCGAGGG - Intergenic
1185114680 22:48925434-48925456 AGGAGAGAGAAGGTAGGTGTTGG + Intergenic
1185116607 22:48941621-48941643 AAGAGGGAGAAGGAAGTGCTCGG + Intergenic
949465460 3:4339090-4339112 CAGAATGAGGAGGGAGTAGTGGG - Intronic
950048048 3:9962850-9962872 AAGGGAGAGACGGCAGTTGTTGG - Exonic
950175971 3:10874692-10874714 AAGAGTGGGATGGCAGTTGTGGG - Intronic
950235924 3:11320126-11320148 AAGAGAGAGAAGAGAGTTCCAGG - Intronic
950521658 3:13501286-13501308 CAGAGTGGCAGGGGAGTTGTGGG - Intronic
950550665 3:13664146-13664168 AAGGGTGAGAAGGGAGAGCTGGG - Intergenic
951806213 3:26646941-26646963 AAGATGGAGAAGGAAGATGTGGG - Intronic
951883787 3:27504556-27504578 AGCACTGAGAAGGGAGCTGTGGG - Intergenic
953195864 3:40732394-40732416 AACAGTGGGAAGAGACTTGTAGG - Intergenic
953210151 3:40868462-40868484 CAGAGGGAGAATGGAGATGTAGG - Intergenic
953510601 3:43534516-43534538 GAGAGAGAGAAGGGGGTTGGGGG + Intronic
953988113 3:47461134-47461156 AAGAGTGTGGAGGGAGTCTTAGG - Intronic
955296006 3:57735642-57735664 GAGAGGGAAAAGGGAGATGTTGG - Intergenic
955874194 3:63473145-63473167 AAGAGGGAGAAGGGTGTTTTAGG - Intronic
956021253 3:64935492-64935514 GAGAGTGGGGAGGGAGTTGTAGG + Intergenic
957369067 3:79267501-79267523 AAGAGTGAGAGGATAGTGGTGGG + Intronic
957526820 3:81388669-81388691 AAGAGTGGGAAGTGATTTCTGGG - Intergenic
957605427 3:82392389-82392411 ATGAGTCAGAAGCAAGTTGTAGG - Intergenic
958061270 3:88484614-88484636 ATGAGGGAAAAGGGAGTTGATGG + Intergenic
958456885 3:94343570-94343592 AAATGTCAGAAAGGAGTTGTGGG - Intergenic
958573377 3:95915268-95915290 AGGAAGGAGTAGGGAGTTGTAGG - Intergenic
959933131 3:112003824-112003846 AAGAGTCAGAGGGCAGCTGTGGG - Intronic
964201993 3:154128232-154128254 AAGAAGAAGATGGGAGTTGTGGG - Intronic
964979864 3:162665668-162665690 AATTGTGAAAAGGGACTTGTGGG + Intergenic
965865312 3:173198526-173198548 AAGAGAGAGAAGGAAGTTTCAGG + Intergenic
966749764 3:183310748-183310770 AAAAGTGAGAAGGGGGTTGGAGG + Intronic
967011572 3:185439758-185439780 GAGAGTCAGAAGGGAGAGGTGGG - Intronic
967124416 3:186411519-186411541 AAGAGGGAAAAGTGAGTTCTAGG + Intergenic
969367559 4:6707157-6707179 AGGAGTGTGGAGGGGGTTGTGGG - Intergenic
969985445 4:11204232-11204254 AAGAGTAAGAGGGGCCTTGTGGG - Intergenic
970334388 4:15019717-15019739 AAAAAGGAGAAGGGAGTTGGAGG + Intronic
971173861 4:24262130-24262152 AGGGGTGGGAAGGGAGTTATGGG - Intergenic
972379559 4:38506417-38506439 AAGTGGGGGAAGGCAGTTGTGGG - Intergenic
974451095 4:62061156-62061178 AAAAATGAGAAGGGAAGTGTGGG - Intronic
975530508 4:75395053-75395075 AAGTGTGTGAAGGGAATTGAGGG - Intergenic
975833895 4:78400231-78400253 AAGCTTGAGCAGGGAGCTGTGGG - Intronic
976124478 4:81818941-81818963 AAGAGTGAGAAGGGAGTTGTTGG + Intronic
976132222 4:81896759-81896781 AAGGGTGAGAAGGGGCCTGTAGG - Intronic
977088074 4:92630421-92630443 AAGAGTGAGAAGGTTTTCGTGGG - Intronic
977150009 4:93499467-93499489 AAAAGTGAGAAGGAATTTGTTGG - Intronic
977211934 4:94228314-94228336 AAGAGTGATAATGCAATTGTGGG - Intronic
978465865 4:109008267-109008289 AAGAGGGACAAGGAAGTTGATGG - Intronic
978617431 4:110611390-110611412 AAGGGTGAGAAGGGATGTGGCGG + Intergenic
979878566 4:125925858-125925880 CAGAGTGAGGAGGGTGCTGTAGG - Intergenic
980830329 4:138123804-138123826 GAGAGAGAGAAGGGACTTTTGGG + Intergenic
981793517 4:148568189-148568211 TAGAATGAGCAGTGAGTTGTTGG + Intergenic
981807867 4:148737982-148738004 TAGAGTGAGAAGAGAATCGTGGG - Intergenic
981902208 4:149879859-149879881 AAGAAGGAGAAGGGAGAAGTGGG + Intergenic
982325126 4:154122149-154122171 GAGAATGAGATGGGAGCTGTGGG - Intergenic
982368128 4:154603134-154603156 AAGATTAAGAAGGAAATTGTGGG + Intergenic
982531410 4:156549158-156549180 AAGAGTGGGAAGGGAAGTGAGGG - Intergenic
982727680 4:158922320-158922342 CAGAGTGAGAAGGGGTCTGTTGG - Intronic
983428189 4:167614529-167614551 AGGTGAGAGATGGGAGTTGTAGG - Intergenic
984342084 4:178470117-178470139 TAGAGTGAGTAGGGACTTGAGGG + Intergenic
985363663 4:189203028-189203050 AAGAATGAGAAGAGTGTTTTCGG - Intergenic
985717345 5:1470046-1470068 AAGCAAGAGAAGGGAGTTCTTGG + Intronic
986343787 5:6815624-6815646 ATGAGTGAGAAGGAACTTTTTGG - Intergenic
987640731 5:20608652-20608674 AAAAGTAAGAGGGAAGTTGTTGG - Intergenic
987748141 5:22004477-22004499 AACAGTGAGAAGAGAGTAATAGG - Intronic
987825867 5:23029690-23029712 AAGAGGGGCAAGGGAGTTGAGGG - Intergenic
988403931 5:30799840-30799862 AAGAGTGAGAAGGTGGGAGTGGG - Intergenic
988985480 5:36614410-36614432 AAGAGAGCCAAGAGAGTTGTAGG + Intronic
989189557 5:38657152-38657174 GAGAGTGAGGAGGGAGTGGCAGG - Intergenic
990477193 5:56173124-56173146 AAGAATGAAGAGGAAGTTGTAGG - Intronic
992594303 5:78330128-78330150 AAGTGAGAGAAGGGTGTTGTAGG - Intergenic
993224279 5:85145879-85145901 GAGAGTGAGAAAGGAGAGGTTGG - Intergenic
994148088 5:96417017-96417039 AAGAGTGTGAAGGCTGTTGGTGG + Intronic
994458222 5:100041770-100041792 CAGAGAGAGCAGGGAGTTGAGGG + Intergenic
995590527 5:113694987-113695009 ATGAGTGAGAAGGGAGGGGTGGG + Intergenic
995753656 5:115478942-115478964 AAGAGTGGGAGGGGAGGTGAGGG - Intergenic
996628627 5:125600897-125600919 AAGATGGATGAGGGAGTTGTAGG + Intergenic
997294395 5:132760714-132760736 GAGAGCGAGAAGGGAGGTGAGGG + Intronic
997670510 5:135667562-135667584 AAGAGAGGGAAGGGAGTAGGGGG - Intergenic
999184779 5:149698922-149698944 GAGAGAGATGAGGGAGTTGTGGG - Intergenic
999508677 5:152225054-152225076 AAGAGTAAGAAGTGAGCTTTGGG + Intergenic
999595726 5:153202064-153202086 AAGAGTGATAAGGGGGTGGATGG - Intergenic
1000452420 5:161406399-161406421 AAGGTTGAGAAGGGTGATGTTGG + Intronic
1001015687 5:168138998-168139020 AACAGTGAGAAGGGTGTCTTGGG - Intronic
1001571526 5:172733437-172733459 GAGACTGAGAAGGGTATTGTTGG - Intergenic
1001595544 5:172896505-172896527 GAGAGGCAGAAGGGAGTGGTGGG + Intronic
1002209180 5:177585837-177585859 AAGGGTGCGAAGGGGGTTGAGGG - Intergenic
1002679043 5:180946615-180946637 AAGAGAGAATGGGGAGTTGTTGG + Intronic
1003899623 6:10641941-10641963 AAAAGTGATAAGGGAGTAGAGGG - Intergenic
1005642048 6:27805743-27805765 AAGGTTGGGAAGGCAGTTGTTGG + Intergenic
1006301625 6:33196465-33196487 AAGAGTGACCAGGGCGTTGAGGG - Exonic
1006750228 6:36372385-36372407 CCGAGTGAGAAGGGAGCTGCTGG + Intronic
1006845481 6:37058404-37058426 GATAGTGAGAAGGGAGTGGAGGG + Intergenic
1007142251 6:39587800-39587822 AAGAGAGAGGAGGTAATTGTAGG - Intronic
1007261603 6:40567906-40567928 AAGAATGTGATGGCAGTTGTGGG - Intronic
1007617983 6:43193382-43193404 AAAAGGGAAAAGGGAGTTTTGGG + Intronic
1010086355 6:71923089-71923111 AAGAGTAGGATGGAAGTTGTGGG - Intronic
1011410738 6:87063323-87063345 TAGAGTGAAAAGGGAGATGGAGG + Intergenic
1011775123 6:90721609-90721631 AAGAGTGAGGAGGGAAGTGAAGG + Intergenic
1012946871 6:105475702-105475724 GACAGGGAAAAGGGAGTTGTTGG - Intergenic
1013411208 6:109885523-109885545 AAGAGAGATAAGAGAGTTCTTGG + Intergenic
1013689071 6:112618189-112618211 AAGAATGAGAAGGAAGCTCTGGG - Intergenic
1015927402 6:138323898-138323920 GAGAGTGAGAAAGAAGTTGCTGG + Intronic
1017126464 6:151069229-151069251 AAGAGAGAGAAGATAGTTTTGGG - Intronic
1017219785 6:151952460-151952482 AATAGAGAGAAGGGAGTTCAGGG - Intronic
1017254902 6:152322877-152322899 AAGTGTGAAAAGGGAGCTGAGGG - Intronic
1017286383 6:152681203-152681225 AAGAGAGAGAAGGGAGGGGAGGG + Intergenic
1017445444 6:154503282-154503304 AGTAGTAAGAAGGGAGTTGTGGG - Intronic
1017693216 6:156988194-156988216 AAGGGTGAGAAGGGAGTTTAAGG + Intronic
1017941559 6:159057765-159057787 AAGAGTCAGAAGGGAGGAGGAGG + Intergenic
1018055050 6:160044874-160044896 TGGTGTCAGAAGGGAGTTGTGGG + Intronic
1018106294 6:160490452-160490474 AAGAATGAGAACGGATTTGTGGG - Intergenic
1018106803 6:160495968-160495990 AAGAATGAGAACGGATTTGTGGG - Intergenic
1018702267 6:166436570-166436592 AAGAGTGGGAAGAGAAGTGTCGG - Intronic
1019573827 7:1726638-1726660 TAGAGGGAGAAGGGACTTGGGGG - Intronic
1019901943 7:4027864-4027886 AAGGGGGAGAAGGGGCTTGTGGG + Intronic
1020127456 7:5541037-5541059 AGGAGAGAAAAGGGAGGTGTTGG + Intronic
1020440230 7:8209796-8209818 AAGAGGGAGAAGGGAATTTCTGG + Intronic
1021775475 7:24050505-24050527 ACCAGTGAGAAGGGAGCTGTAGG + Intergenic
1022153294 7:27632679-27632701 AAAAGTGTGAAGGGAGTTGAGGG + Intronic
1022573808 7:31478644-31478666 AGGACTGAAAAGGGAGTTGAAGG - Intergenic
1022674803 7:32489278-32489300 AAGAGTGATAAGGAAATTGTTGG - Exonic
1024781663 7:52857894-52857916 ATGAATGAGCAGGGAGGTGTTGG + Intergenic
1024993620 7:55254880-55254902 GAGAGGGAGAAGGGAGGAGTCGG + Intronic
1025607614 7:63050731-63050753 ATGAGTGTGAGGGGAGTGGTGGG - Intergenic
1026129921 7:67611929-67611951 AAGAGGCAGAAGGGAGATGGTGG - Intergenic
1026651103 7:72216609-72216631 AGGAGTGAGAAGGCAGGTGAAGG - Intronic
1027507184 7:79031207-79031229 AATGATGAGAATGGAGTTGTGGG - Intronic
1027587971 7:80081621-80081643 GAGAGAAAGAAGGGAGATGTTGG + Intergenic
1027588522 7:80088540-80088562 AAGAGTGAAAAGCGGGATGTTGG + Intergenic
1028754573 7:94420592-94420614 AAGGGTGAAAACGGTGTTGTTGG + Exonic
1030250745 7:107441286-107441308 AATCCTGAGGAGGGAGTTGTGGG + Intronic
1030354253 7:108525724-108525746 AAAATTGAGGAGGGAGTCGTGGG + Intronic
1031120869 7:117720173-117720195 AAGAGAGAGAAGGGAGATGAAGG - Intronic
1031507365 7:122602243-122602265 ATGTGTGAGATGGGAGGTGTAGG + Intronic
1031713561 7:125078868-125078890 AAGAGAGAGAAGGGGGCTTTGGG + Intergenic
1031893386 7:127321219-127321241 AAGATTCAGAAGTGAGTAGTGGG + Intergenic
1033009568 7:137605799-137605821 AAGACTGGGAAGGGTGTGGTGGG + Intronic
1033305358 7:140221561-140221583 CAGAGTGAGCAGGAAGTTGCTGG - Intergenic
1033598087 7:142870682-142870704 TAGAGTAAGCAGGGAGTGGTGGG + Exonic
1033648751 7:143323935-143323957 AAGACTTAGAAGGGGGTTTTGGG + Intronic
1035916374 8:3628812-3628834 AAGAGAGAGATGAGAGTTCTTGG - Intronic
1035993889 8:4523856-4523878 AAGAAGGAGAAAGGAGTTGGAGG - Intronic
1036595140 8:10205223-10205245 AAGAGTTAGAAGGCAGATGTCGG + Intronic
1037618330 8:20541421-20541443 GAGAGTGAGAGGAGAGTTGCTGG + Intergenic
1037867343 8:22456489-22456511 AAGAGAGGGAAGGGAGTTAGGGG - Intronic
1038539998 8:28384425-28384447 GAGTCAGAGAAGGGAGTTGTGGG - Intronic
1038814753 8:30890475-30890497 GAGATTGAGAAGGGAGTGGGAGG - Intronic
1039342442 8:36665682-36665704 AATAGATAGAAGGCAGTTGTTGG - Intergenic
1039514806 8:38123708-38123730 GAGAGTGAGAAGGGCACTGTAGG - Intronic
1040560168 8:48516841-48516863 AAGAGGAAGAAGAGAGTGGTTGG - Intergenic
1041413532 8:57582379-57582401 AAAACTGAGGAGGGAATTGTGGG + Intergenic
1041635919 8:60144167-60144189 GAGTGTGAGAAGGTACTTGTTGG + Intergenic
1041847474 8:62347333-62347355 TAGAGAGAAAAAGGAGTTGTTGG + Intronic
1041881172 8:62751205-62751227 AGGAGGGAGAAGGGACTTGGGGG - Intronic
1041961569 8:63623220-63623242 AAGAGGGAGAAGGGACTTGGTGG + Intergenic
1043148413 8:76682889-76682911 AGGAGCGAGAAGGGGGTTGGGGG - Intronic
1043705732 8:83347614-83347636 CAGATTGAAAATGGAGTTGTTGG - Intergenic
1044021617 8:87112148-87112170 AAGAGTGAGCAGGCAGATGATGG - Intronic
1044914604 8:97099095-97099117 AAGAGAGAGAAGGGAGTTTTGGG - Intronic
1045471275 8:102514401-102514423 AAGAAAGAGAATGGAATTGTAGG + Intergenic
1046057638 8:109097752-109097774 AAAACTGAGAAGGCAGGTGTTGG - Intronic
1046619102 8:116509064-116509086 AAGAGGGTCAAGGGAGTTGAGGG + Intergenic
1047399604 8:124534840-124534862 AAACCTGAGAAGGGGGTTGTGGG - Intronic
1047868757 8:129059159-129059181 AGGAATGTGAAGGTAGTTGTGGG - Intergenic
1048629692 8:136228642-136228664 GAGAGTGAGTAGGGACTTCTAGG + Intergenic
1049978568 9:883069-883091 AAGAGTGAAAAGGGTGGGGTGGG - Intronic
1050730056 9:8698854-8698876 AACAGTGAGAAGGTATTTATTGG - Intronic
1051348008 9:16169973-16169995 GGGAGGGAGAAGGGAGTTGGGGG + Intergenic
1052023819 9:23553623-23553645 AAGAGTGAGTAGTGATTTGAAGG + Intergenic
1052841453 9:33294851-33294873 GAGAGTGAGAAGGAAGTTGTGGG + Exonic
1053302045 9:36959177-36959199 AAGAATGAGAAGGGTCTGGTGGG - Intronic
1055003542 9:71480931-71480953 AGGAAGGAGAAGGGGGTTGTAGG - Intergenic
1055398606 9:75899521-75899543 GAGAGGGAGGAGGGAGATGTAGG - Intronic
1056278112 9:85013190-85013212 AAGAGTGATAAGGGGCTTCTAGG - Intronic
1056835978 9:89955416-89955438 AAGTGTGAGATGGGAGAAGTGGG - Intergenic
1057633472 9:96740401-96740423 GAGAGAGAGAAGGGAGGTGCCGG + Intergenic
1057644496 9:96860053-96860075 GAGAGTGGGAAGGGATTTGCCGG + Intronic
1057723014 9:97547907-97547929 AGGGGTGAGTAGAGAGTTGTTGG + Intronic
1058619015 9:106863754-106863776 ATGAGTGAGAAGAGAGCTGGAGG + Intronic
1060690950 9:125659630-125659652 AAGAGAGAGAAGAGAATTGCTGG - Intronic
1061099899 9:128484645-128484667 AAGAGAGACAAGGAGGTTGTGGG - Intronic
1061704389 9:132441701-132441723 CAGAGTGAGCAGTGAGTTCTGGG + Intronic
1062408311 9:136408681-136408703 AAGAGGGAGAAGGGAAAAGTGGG - Intronic
1186104181 X:6188008-6188030 AGAAGTGGGAAGGGCGTTGTAGG - Intronic
1186235639 X:7506123-7506145 AAAAGTGAGAAGGGTGCTATTGG - Intergenic
1186244168 X:7603167-7603189 CAGAGTGAGAGGGGCATTGTTGG + Intergenic
1187539510 X:20178206-20178228 AAGAGTGACAAGGGAACAGTAGG + Intronic
1189023171 X:37363838-37363860 AAGAATGAGGTGGAAGTTGTGGG - Intronic
1189352225 X:40284359-40284381 AAGAGTGCAAAGAGTGTTGTAGG - Intergenic
1189577295 X:42367871-42367893 AAATCTGAGAAGTGAGTTGTGGG - Intergenic
1192335970 X:70220074-70220096 AAGAGGGACAAGGGAGAGGTTGG + Intergenic
1194819251 X:98486009-98486031 AGGTGTGAGTAGGCAGTTGTAGG + Intergenic
1195007822 X:100703808-100703830 ATGAGTGAAAAAGTAGTTGTAGG + Intronic
1195761067 X:108247105-108247127 AGGGGTGAGAGGTGAGTTGTGGG - Intronic
1195944241 X:110192103-110192125 GAGAGTGAAAAGGGAGAGGTTGG - Intergenic
1196804500 X:119572605-119572627 AAGAGTGAGAGGGATGTGGTGGG + Intergenic
1196893016 X:120308750-120308772 AAAAGGGAGAAGGGGGTTGCTGG + Intronic
1197899690 X:131356920-131356942 AGGAGTGAGAAGAGGGCTGTGGG + Intronic
1198685912 X:139227934-139227956 ACCAGTTAGAAGGCAGTTGTAGG + Intergenic
1199917799 X:152363054-152363076 AAGATTGAGATGGGAGTCATTGG + Intronic
1200367626 X:155684118-155684140 GAGAGTGAGAAGTGAGATGATGG + Intergenic
1201463386 Y:14253531-14253553 CAGGGTGAGATGGGAGTTGTTGG + Intergenic
1201554795 Y:15256684-15256706 AAGAGGGAAAAGGGGGTTCTGGG + Intergenic
1202050008 Y:20770804-20770826 AAGAGTGGGACGGTGGTTGTTGG - Intronic
1202365024 Y:24154230-24154252 AAGAGTGTGACGGTAGTTGAGGG + Intergenic
1202505757 Y:25515892-25515914 AAGAGTGTGACGGTAGTTGAGGG - Intergenic