ID: 976130787

View in Genome Browser
Species Human (GRCh38)
Location 4:81881949-81881971
Sequence GGGCGTCTTTGTGAAGTTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 75}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976130787 Original CRISPR GGGCGTCTTTGTGAAGTTAA GGG (reversed) Intronic
900365393 1:2309974-2309996 GGGGGTCTGGGTGATGTTAAAGG - Exonic
907704530 1:56821019-56821041 GGGCCTATTTCTGAAGCTAAAGG + Intergenic
909174949 1:72345737-72345759 GGGCTTCTTTGAGAACTGAATGG + Intergenic
920851216 1:209629219-209629241 GGGAGTGTTTGTGAATGTAATGG - Intronic
921683675 1:218064883-218064905 AGGCGACTTTAGGAAGTTAAAGG + Intergenic
1065282900 10:24158147-24158169 GGCTGTCTTCTTGAAGTTAAAGG - Intronic
1069577878 10:69543754-69543776 GAGCCTCTTTGTGAAGTAATTGG - Intergenic
1073969514 10:109031366-109031388 GGACAGCTTGGTGAAGTTAATGG - Intergenic
1076471345 10:130720782-130720804 GGGTGTCTTTGTGTGGTTATTGG - Intergenic
1076556641 10:131327139-131327161 GGGATTCTGTGTGAAGATAAAGG - Intergenic
1078667539 11:13339111-13339133 GGGGGCCTTTGTGCAGTTCATGG + Intronic
1082229077 11:49742255-49742277 GGGCATCTTTGTGATTTTCAAGG - Intergenic
1082814277 11:57498022-57498044 GGGAGCCTTTTTGAAGCTAAAGG - Intronic
1087862034 11:103170885-103170907 GGGCATCGATGTGAAGTCAATGG + Exonic
1090904138 11:131059220-131059242 GGAGGTCTTTTGGAAGTTAAGGG - Intergenic
1091452506 12:582019-582041 GGGCCTCTGTGAGAAGTGAAGGG - Intronic
1097824480 12:64160618-64160640 GGGCTTCCTTGTGAAGACAAAGG - Exonic
1100914754 12:99407449-99407471 GGGCGTCCTTGTCAAGTTCCAGG - Intronic
1104859315 12:131916408-131916430 GGGGGTCTTCGGGAAGTCAAAGG - Exonic
1107501606 13:40983944-40983966 GGGAGGCTTTGTGAAATAAATGG - Intronic
1108468511 13:50743581-50743603 GGGCCTCTATGTTATGTTAAAGG - Intronic
1109220712 13:59638437-59638459 GGGCATTTTTGTGAAGTTAGAGG + Intergenic
1113031489 13:105998141-105998163 GGGCCTTTTTGTGGGGTTAAAGG - Intergenic
1115871979 14:37814986-37815008 GGGCTTGTTTGTGAAGTTAATGG + Intronic
1126492166 15:49249432-49249454 AGTCATCCTTGTGAAGTTAAAGG - Intronic
1127211473 15:56779053-56779075 GAGCATCTTTATGAATTTAAAGG + Intronic
1133327927 16:4953401-4953423 AGAAGTCTTTGTGAAGTGAATGG + Intronic
1133563168 16:6968235-6968257 GGGGGTCTTTGCTGAGTTAAAGG - Intronic
1138566006 16:57833350-57833372 AGGGGTCCTGGTGAAGTTAATGG - Intronic
1150599756 17:66640653-66640675 CGGTGTGTTTGTGAAGTGAACGG - Intronic
1155160079 18:23188606-23188628 GGGCCTCTTTGTGATGATTAAGG - Intronic
1156298130 18:35811033-35811055 GGGCTTCTTGGAGAAGTTACTGG + Intergenic
1158299850 18:56039157-56039179 TGGCTTCTTTTTGAAGATAATGG - Intergenic
1161177914 19:2858785-2858807 GGGCATCTTTGTGATGTCATGGG - Exonic
1163487644 19:17598089-17598111 GGGCGTCCATGTGAAGAAAAAGG - Intergenic
1163611910 19:18306018-18306040 GGGCGGGTTTGTGAGGTTCAGGG + Intergenic
1168146186 19:54421043-54421065 GGACGTCATTGTGATGTTAATGG - Intronic
924959495 2:21317-21339 TGGCATCTCTGTGAAGTTAAAGG + Intergenic
925567401 2:5271096-5271118 GGGTGTTTCTGTTAAGTTAAAGG + Intergenic
926317847 2:11724554-11724576 GGGCCTTTATCTGAAGTTAATGG + Intronic
927043770 2:19256233-19256255 GGTGGTTTCTGTGAAGTTAAAGG - Intergenic
932013310 2:67999762-67999784 TGGGGTCTTTGGGAAGTGAATGG - Intergenic
932438199 2:71715612-71715634 GGGCATCTTTGTGGAATGAAGGG + Intergenic
939343498 2:140931306-140931328 GGACGTGTGTGTGAGGTTAAAGG - Intronic
942058513 2:172206923-172206945 TGGGGTCTTTGGGAAGTGAATGG - Intergenic
944151631 2:196565090-196565112 GGACTTCATTGTGAAGTTAGTGG - Intronic
1171359181 20:24574771-24574793 GTTTGTCTTTGTGAAGGTAATGG - Intronic
1173854541 20:46241558-46241580 GGACTTCTTTGTGAAGGCAATGG - Intronic
1182028394 22:27138156-27138178 GGGCGTCTGTTTGGAGATAAAGG + Intergenic
1184028705 22:41878012-41878034 GAGCGTCTTTGTGAAGCTGCTGG + Exonic
1184055301 22:42043557-42043579 GTGCATCCTTGTGAATTTAAGGG + Intronic
954601859 3:51876430-51876452 GGGTGTCAGTTTGAAGTTAATGG + Intergenic
971927419 4:33030607-33030629 GGGCGTTTTTCTGAAGTGCAAGG + Intergenic
976130787 4:81881949-81881971 GGGCGTCTTTGTGAAGTTAAGGG - Intronic
986742371 5:10715281-10715303 GGGAGTATTTGTGAAGTAATAGG + Intronic
987293692 5:16531633-16531655 GGGTGCCTCTGTTAAGTTAAAGG + Intronic
995844586 5:116480187-116480209 GTGCGTCTTGATGAAGTTCAGGG + Exonic
1001050890 5:168413497-168413519 TGGAGTCTTAGAGAAGTTAAGGG + Intronic
1003254742 6:4465195-4465217 TGGGGTCTTTGAGAGGTTAAAGG + Intergenic
1003835470 6:10067966-10067988 GTGTGGCTATGTGAAGTTAATGG - Intronic
1004791367 6:19030226-19030248 GGGCATCTTTGAGAGGTGAATGG + Intergenic
1005804207 6:29458939-29458961 GTGCTTCTGTGTGGAGTTAATGG + Intronic
1009053218 6:58303817-58303839 AAGCCTCTTCGTGAAGTTAAAGG + Intergenic
1009237891 6:61146746-61146768 AAGCCTCTTCGTGAAGTTAAAGG - Intergenic
1017096591 6:150810611-150810633 GTGAGTCTTTTTGATGTTAATGG - Intronic
1019896706 7:3988718-3988740 GAGCTTCTTTGTGGAGGTAATGG - Intronic
1020116080 7:5477238-5477260 GGGGGTCTTTGTGATGGTCATGG - Intronic
1023830953 7:44038816-44038838 GGGCGTCTTCGCGAAGCTGAGGG + Intergenic
1029741287 7:102493125-102493147 GGGCGTCTTCGCGAAGCTGAGGG + Exonic
1029759277 7:102592294-102592316 GGGCGTCTTCGCGAAGCTGAGGG + Exonic
1029776646 7:102688204-102688226 GGGCGTCTTCGCGAAGCTGAGGG + Intergenic
1032011089 7:128348540-128348562 TGGCCTCTTTATGAAGTAAAAGG + Intergenic
1033010967 7:137622362-137622384 TGGTGTCTTGGTGAGGTTAAAGG - Intronic
1050736454 9:8768599-8768621 GGGTGTCATTTTGTAGTTAAAGG - Intronic
1057271883 9:93656160-93656182 GGGCCTCTTTGTGATGTGGAGGG + Intronic
1060749324 9:126158657-126158679 GGGTGTCTGTGTGAAGATCAGGG + Intergenic
1187321650 X:18244272-18244294 TTGTGTCTTTGTTAAGTTAAAGG - Intronic
1193939645 X:87665544-87665566 TGGCATCTTTGAGATGTTAAAGG + Intronic
1193975809 X:88117335-88117357 TGGGCTCTTTTTGAAGTTAATGG + Intergenic
1197555202 X:127944652-127944674 TGGGGGGTTTGTGAAGTTAATGG + Intergenic