ID: 976131330

View in Genome Browser
Species Human (GRCh38)
Location 4:81887568-81887590
Sequence CACTGGGGACTACTACCGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 787
Summary {0: 1, 1: 1, 2: 22, 3: 164, 4: 599}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976131330 Original CRISPR CACTGGGGACTACTACCGAG GGG Intronic
900734173 1:4284811-4284833 CACTGTGGACTACTAGTGGGTGG + Intergenic
901571277 1:10162788-10162810 CACTGGGGACTACAAGGGAGGGG - Intronic
902528259 1:17073595-17073617 CACTGGGGACTATTAGAGTGGGG + Intronic
904957219 1:34295000-34295022 CACTGGAGACTACTAGACAGGGG + Intergenic
905592701 1:39178491-39178513 CACTGGGGTGAACTACAGAGAGG - Intronic
906750642 1:48256219-48256241 CACTGGGGCCTACTTGAGAGTGG + Intergenic
906848091 1:49216414-49216436 CACTGGGGACTAATAGAGAGGGG - Intronic
906994201 1:50772684-50772706 CACTGGGGACTACTTGAGAGTGG + Intronic
907591375 1:55675452-55675474 CACTGGGGACTACTAAAGATGGG - Intergenic
907939553 1:59074195-59074217 CACTGAGGACTACTAAAGAGGGG + Intergenic
908187915 1:61670365-61670387 CACTGGGAACTACTAGAGTGGGG + Intergenic
909313719 1:74188250-74188272 CACTGGGGCCTACTAGAGGGAGG + Intronic
909424358 1:75505004-75505026 CACTGAAGACTACTAGAGAGGGG - Intronic
909564254 1:77037383-77037405 CACTGGAGACTACTAGAGTGGGG + Intronic
909596097 1:77407788-77407810 CTCTGGGGACTACTAGAGAGGGG - Intronic
910137051 1:83984757-83984779 CTCTGGGGACTACTAGAGAGGGG + Intronic
910158765 1:84251430-84251452 CACTGGGGACTACTAGAGGGAGG - Intergenic
910374596 1:86554151-86554173 CACTGGGGTCTACTTGAGAGTGG - Intronic
911043029 1:93607081-93607103 CACTGGGGACTCCAAAAGAGGGG + Intronic
911576354 1:99583222-99583244 CACTGGGGGCTACTTGAGAGTGG + Intergenic
911639738 1:100275216-100275238 CACTGGGGACTGCTAATGGGAGG + Intronic
911692833 1:100854776-100854798 AACTGGGGACTATTAGAGAGTGG - Intergenic
912019011 1:105080902-105080924 CACTGGTGACTGCTAGAGAGGGG - Intergenic
912857610 1:113184742-113184764 CACTGGGGACTACTAGATTGGGG + Intergenic
912928596 1:113935185-113935207 CACTGGGGCCTACTTCAGGGTGG - Intronic
912948562 1:114104995-114105017 CACTGGGGACTACTAGAGTCGGG - Intronic
913076272 1:115343032-115343054 TACTGGGGACTACTAGAGTGGGG - Intergenic
913577134 1:120187416-120187438 CACTGTGGACTACTAGAGAGGGG + Intergenic
914405478 1:147367171-147367193 CATTGGGGACTACTAGCTGGGGG - Intergenic
914407589 1:147391450-147391472 CACTGGAGACTACTACAGTCGGG + Intergenic
914412150 1:147440176-147440198 CACTGGGGCCTACTGGAGAGTGG + Intergenic
914559047 1:148798851-148798873 CACTGTGGACTACTAGAGAGGGG + Intergenic
914613786 1:149331379-149331401 CACTGTGGACTACTAGAGAGGGG - Intergenic
914954607 1:152149689-152149711 CACTGGGGACCACTAGAGTGGGG - Intergenic
914955936 1:152162501-152162523 CACTGGGGACTACTAGAAGGGGG - Intergenic
915875672 1:159609727-159609749 CTCTGGGGACTGTTACGGAGTGG + Intergenic
916293794 1:163194542-163194564 CACTGGCTTCTACTACCTAGTGG - Intronic
916426072 1:164681660-164681682 CACTGGGGCCTACTTTAGAGTGG + Intronic
916828316 1:168464681-168464703 CACTGGAGAGTACTAGAGAGAGG - Intergenic
917184301 1:172335775-172335797 CACTGGGGACTACTGGATAGGGG + Intronic
917234567 1:172876923-172876945 CACTGTGGACTACTAGAGGGAGG - Intergenic
917393890 1:174570501-174570523 CACTGGGGACTGCTGGAGAGGGG + Intronic
917513341 1:175686647-175686669 CACTGGGGACTCCAAAAGAGGGG - Intronic
917730316 1:177868584-177868606 CACTGGGGACTACTAGAGGGAGG - Intergenic
918198921 1:182248710-182248732 CACTGGGGTCTACTAGAGGGTGG - Intergenic
918494731 1:185121946-185121968 CACTGGGGACTACTAGATGGGGG - Intronic
918877092 1:190061813-190061835 CACTGGGGACTACTAGAGGGAGG - Intergenic
918966201 1:191352422-191352444 CACTGGGCACTACTAGAGGGTGG - Intergenic
919304648 1:195816359-195816381 CACTGTGGACTACTAGAGTGTGG - Intergenic
919326865 1:196119154-196119176 CACTGGGGACTCCAAAAGAGGGG + Intergenic
919459414 1:197858416-197858438 CACTGGGGACTACTAGAGGGAGG - Intergenic
919566929 1:199200395-199200417 CACTGGGGACTACTAGAATGGGG - Intergenic
919599877 1:199609641-199609663 CACTGGGGACTACTACAGGAGGG + Intergenic
921585546 1:216942073-216942095 CACTGGGGACTCCAAAAGAGGGG - Intronic
922207153 1:223458057-223458079 CACTGGGGACTACTTGAGTGTGG - Intergenic
922625831 1:227041305-227041327 CTCTGGGGACTACTAGAGAAGGG - Intronic
923244026 1:232113556-232113578 CACTGAGGACTACTAAGGCGGGG + Intergenic
924283540 1:242462454-242462476 CACTGGGGACTGCTAGAGTGGGG + Intronic
1063578787 10:7286833-7286855 CACTGGGAAATAATACTGAGTGG + Intronic
1063811610 10:9715709-9715731 CACTGGGGCCTACTGGAGAGTGG + Intergenic
1064305887 10:14165838-14165860 CACTGGGGACTCCAAAAGAGGGG + Intronic
1064503240 10:15997891-15997913 CACTGGGGACTACTACAAGGGGG + Intergenic
1064676960 10:17769995-17770017 CACTGGGGACCATTACAGAGGGG - Intronic
1064748627 10:18502791-18502813 CACTGGGGACTACTTGAGGGTGG + Intronic
1064866861 10:19890407-19890429 CACTGAGGACCACTAGGGAGCGG - Intronic
1064889170 10:20149578-20149600 CACTGGGGCCTACTTGAGAGTGG - Intronic
1065292235 10:24242253-24242275 CACTGGGGACTACTAGAGTGGGG - Intronic
1065695042 10:28371958-28371980 TGCTGGGGACTACTAGAGAGAGG + Intergenic
1066097630 10:32087310-32087332 CACTGGGAACTACTAGATAGAGG - Intergenic
1066690225 10:38019141-38019163 CACTGGGGACTGTTACGGGGTGG - Intronic
1066715547 10:38281996-38282018 CACTGGGGTCTACTTGAGAGTGG + Intergenic
1067521518 10:47010634-47010656 CACTGGGAACTCCTACAGTGGGG - Intergenic
1067656797 10:48199074-48199096 CACTGTGGACTACTAGAGGGTGG + Intronic
1068021132 10:51585959-51585981 CACTGGGGACTAGTAGAGTGGGG + Intronic
1068479235 10:57568445-57568467 CACTGGGGACTACTAGAAGGAGG + Intergenic
1068491454 10:57729751-57729773 CACTGGGGACCACTAGAGAGGGG - Intergenic
1068498348 10:57813966-57813988 CCCTGGGGACTACTAGAGTGGGG - Intergenic
1068542612 10:58312398-58312420 CACTGGGGACTACCAGAGGGAGG - Intergenic
1068544823 10:58334199-58334221 CACTGTGGACTACTAGAGAGGGG - Intergenic
1068555386 10:58453144-58453166 CACTGGGGACCAGCCCCGAGTGG + Intergenic
1068609928 10:59047973-59047995 CACTGGGGACTACTAGGTGGGGG - Intergenic
1069093135 10:64226441-64226463 CACTGGGGCCTACTGGGGAGTGG - Intergenic
1069130711 10:64698617-64698639 TACTGGGGACTACTAGACAGAGG + Intergenic
1069187506 10:65443703-65443725 CACTGGGGCCTACTGCAGAGTGG + Intergenic
1069240548 10:66132883-66132905 CACTGGGGACTACCAAAGGGTGG + Intronic
1071158871 10:82723298-82723320 CACTGGGGACTACTGGAGAGGGG + Intronic
1071318935 10:84432412-84432434 CGCTGGGGACTACTAGACAGGGG - Intronic
1071339928 10:84636237-84636259 CACTGGGGACTACTAGAATGGGG - Intergenic
1071426580 10:85561493-85561515 CACTGGGGACTACTAGAGGAGGG + Intergenic
1072367863 10:94732787-94732809 CACTGGGGACTACTAGATGGGGG + Intronic
1072908740 10:99481101-99481123 CACTGCGGACTACTAGAGAGGGG + Intergenic
1072940808 10:99761966-99761988 CACTGAGGACTACTAGAGTGGGG + Intergenic
1073018702 10:100422951-100422973 CACTGGGGACTACTAGAGGAGGG - Intergenic
1073019074 10:100426011-100426033 CACTGGGGACTACTAGAGGAGGG + Intergenic
1073521187 10:104131031-104131053 CACTGGGGACTACTAGAGGGAGG + Intronic
1073644696 10:105288677-105288699 CACTGGGGTCTACCAGAGAGTGG - Intergenic
1074746147 10:116534482-116534504 CACTGGGGACTATTAGACAGGGG - Intergenic
1075360358 10:121826775-121826797 CATTGGGGACTACTAGAGTGGGG - Intronic
1075582433 10:123632144-123632166 CACTGGGGACTACTGGAGGGTGG - Intergenic
1077448694 11:2620019-2620041 CACTGGGGACTACTTGGGGGAGG - Intronic
1077528345 11:3082549-3082571 CACTGGGGCCTACTTGAGAGTGG - Intergenic
1077832689 11:5891988-5892010 CACTGGGGACTACTAAAGGTGGG - Intronic
1077942817 11:6861737-6861759 CACTGGGGCCTACTTGAGAGTGG + Intergenic
1079297928 11:19251103-19251125 AACTGGGGACTACTAATGGGAGG + Intergenic
1079465514 11:20725907-20725929 CACTGAGGACTACTAGAGTGGGG - Intronic
1079473170 11:20799864-20799886 CACTGGGGACTACTAGAAGGAGG - Intronic
1079894867 11:26105698-26105720 CACTAGAGACTACTACAGGGAGG - Intergenic
1080091966 11:28359090-28359112 CACTGGGGACTACTAGAGTAGGG - Intergenic
1080519206 11:33052082-33052104 CACTGGGGTCTACTGGAGAGTGG + Intronic
1080684828 11:34506320-34506342 CACTGGGGACTACCAGAGGGAGG + Intronic
1080714048 11:34781106-34781128 CACTAGGGACTACTAGACAGGGG - Intergenic
1081188069 11:40069842-40069864 CATTGGGGACTACTAGAGAGGGG + Intergenic
1081259848 11:40946093-40946115 CACTGAGGACTACTAGAGGGAGG - Intronic
1081842218 11:46210876-46210898 CAGTGGGGACTACTAGGGGGAGG - Intergenic
1081928574 11:46851356-46851378 CACTTGGGACTACTAGAGATGGG - Intergenic
1082108935 11:48251636-48251658 CACTGGGGACTATTAGAGTGGGG - Intergenic
1082878777 11:58016487-58016509 CACTGGTGACTACTAAAGAAGGG + Intergenic
1082919330 11:58475472-58475494 CACTGGGGACTACTAGAGGAGGG - Intergenic
1082957829 11:58890105-58890127 CACTGTGGACTACTAGAGGGTGG - Intronic
1083513830 11:63237175-63237197 CACTGTGGACTACTAGAGGGAGG + Intronic
1084774825 11:71368403-71368425 CGCTGGGGACTCCTAGGGAGGGG - Intergenic
1084841750 11:71857312-71857334 CACTGGAGACTACTAGAGTGGGG - Intergenic
1085244113 11:75084184-75084206 CACTGGGGACTAATAGAGGGTGG + Intergenic
1085335747 11:75693268-75693290 CACTGGGGACTACTAGAGTGGGG - Intergenic
1086170641 11:83832589-83832611 CACTGGGGACTCCTAGAGTGGGG + Intronic
1086188065 11:84043541-84043563 CACTGGGGCCTACTTGAGAGTGG - Intronic
1086505716 11:87502103-87502125 CACTGGGGACTACCAGAGGGAGG - Intergenic
1086627219 11:88971438-88971460 CACTGGGGCCTACTTGAGAGTGG - Intronic
1086760534 11:90625044-90625066 CACTGGGGCCTACCAGAGAGTGG + Intergenic
1086803675 11:91211365-91211387 CATTGGGGACTACTAGACAGGGG - Intergenic
1087107871 11:94429649-94429671 CACTGTGGACTACTAGAGAGTGG + Intronic
1087159209 11:94932786-94932808 CACTGGGGACTACTAGAGTGGGG + Intergenic
1087233574 11:95693652-95693674 CACTGGGAACTACTAGAGGGGGG + Intergenic
1087439879 11:98170003-98170025 CACTGGGGACTACAGCAGTGGGG + Intergenic
1088063478 11:105686230-105686252 CACTGAGGACTACTAGAGAAGGG - Intronic
1088188280 11:107197740-107197762 CACTGTGGACTACTAGTCAGAGG - Intergenic
1088471603 11:110193351-110193373 CACTGGGGACCACTAGAGACGGG + Intronic
1088842237 11:113636755-113636777 AACTGGGGACTACTAGAGTGGGG - Intergenic
1089361652 11:117892674-117892696 CACTGGGGACTACTAAAGAGTGG - Intergenic
1089481408 11:118808145-118808167 CACTGGGGCCTACTTGAGAGTGG + Intergenic
1089872273 11:121686178-121686200 CACTGGGGACTATTAGAGGGTGG - Intergenic
1089889084 11:121861171-121861193 CACTGGGGACTATTGTGGAGTGG + Intergenic
1090684995 11:129106506-129106528 CACTGGGGACTACTAGATAGGGG + Intronic
1092636731 12:10459088-10459110 CACTGGGGCCTACTTGAGAGTGG - Intergenic
1092751266 12:11721561-11721583 CACTGTGGACTACTAGAGGGAGG + Intronic
1093009963 12:14096262-14096284 CACTGGGGACTACTAGAGGTGGG - Intergenic
1093016100 12:14156232-14156254 CACTGTGGACTACTAGAGAGGGG + Intergenic
1093400890 12:18745293-18745315 CACTGGGGCCTACTTCAGGGTGG + Intergenic
1093495968 12:19758058-19758080 CACTGGTGACTACTTGAGAGTGG - Intergenic
1093500762 12:19809479-19809501 CGCTGGGGACTACTAGAGGGAGG + Intergenic
1093979247 12:25456811-25456833 CACTGGGGACTACAAAAGTGGGG + Intronic
1094257106 12:28444663-28444685 CACTGGGGTCTACTTGAGAGTGG + Intronic
1094762176 12:33546680-33546702 CACTGGGGACTACTGGGGTGGGG + Intergenic
1095298201 12:40551088-40551110 CACTGGGGACCACTATAAAGGGG - Intronic
1095384385 12:41633450-41633472 CACTGGAGCCTACTAGAGAGGGG + Intergenic
1095636136 12:44435712-44435734 CACTGGGAACTACTAGAGTGAGG + Intergenic
1095652695 12:44631518-44631540 CACTGGGGTCTACTAGGGTGGGG + Intronic
1095681379 12:44980484-44980506 CACTGGAGACTACTAGAGGGCGG - Intergenic
1095903698 12:47355387-47355409 CAGTGGGGACTACTAGAGGGAGG - Intergenic
1095905773 12:47376693-47376715 CACTGGGGACTATTAGAGTGGGG + Intergenic
1095908475 12:47402178-47402200 TACTGGGGACTACTAGAGTGAGG + Intergenic
1096702091 12:53391756-53391778 CACCGGGGACTACTAGATAGGGG - Intronic
1096764141 12:53869175-53869197 CACTGGGGACTACTGGAGAGGGG - Intergenic
1098371363 12:69763765-69763787 AACTGGGGACTACTAGACAGGGG - Intronic
1098512158 12:71329327-71329349 CACTGGTGACTACCAGAGAGGGG + Intronic
1098669109 12:73202253-73202275 CACTAGGGACTACTAGAGTGGGG - Intergenic
1098839224 12:75459007-75459029 CACTGGGGAATACTAGAGTGGGG - Intergenic
1099060294 12:77900040-77900062 CACTGAGGACCACTAGAGAGAGG - Intronic
1099559371 12:84153570-84153592 CACTGGGGACTACTAACAGGAGG + Intergenic
1099646324 12:85361943-85361965 CACTGGGGACTACAAGAGGGAGG + Intergenic
1099721469 12:86366554-86366576 CACTGGGGACTACTAGGAGGAGG + Intronic
1099833927 12:87882573-87882595 CACTGGGGCCTACCAGAGAGTGG + Intergenic
1099946376 12:89249390-89249412 TCCTGGGGACTACTACAGGGAGG + Intergenic
1099961626 12:89402528-89402550 CACTGGGGTCTACTAGAGAGTGG - Intergenic
1100416999 12:94388417-94388439 AACTGGGGACTACCAGAGAGGGG + Intronic
1100863750 12:98833751-98833773 CACTGGGGACGACAAAGGAGGGG - Intronic
1100938376 12:99695923-99695945 CACTGGGGACTACTAGAGCGCGG + Intronic
1100952759 12:99870099-99870121 AACTGGGGACTACTAGAAAGGGG - Intronic
1101075138 12:101121231-101121253 CACTGGGGACTACTATAGAGGGG - Intronic
1101861915 12:108489419-108489441 CACTGGGGACTACCAGATAGAGG + Intergenic
1102637565 12:114337359-114337381 CACAGTGGACTACTAGAGAGGGG - Intergenic
1103076935 12:117991117-117991139 CACTGGGGACTACTAGAGGAGGG + Intergenic
1104168586 12:126257898-126257920 CACTGTGGACTACTAGAGGGTGG + Intergenic
1105694845 13:22877473-22877495 CACTGGGGACTACTAGAGGTAGG - Intergenic
1105902973 13:24773534-24773556 CACTGGGGACTGCTAGAGAGAGG + Intronic
1107067158 13:36226778-36226800 CACTGGGGACCACTAGAGGGTGG + Intronic
1107269608 13:38599814-38599836 CACTGGGGACTGCTTGAGAGAGG + Intergenic
1108233438 13:48374870-48374892 CACTGGAGACTACTAGAGGGAGG - Intronic
1108955978 13:56157410-56157432 CACTGGGGACTACTACAGGGAGG + Intergenic
1109145698 13:58776743-58776765 CACTGTGGACTACCACAGTGGGG + Intergenic
1109181406 13:59218432-59218454 CACTGGGGACTACTAGATGGGGG + Intergenic
1109308576 13:60665603-60665625 CACTGGGGACTACTAGAGGTGGG - Intergenic
1109598603 13:64592528-64592550 CACTGGGGTCTACTTAAGAGTGG - Intergenic
1109655245 13:65382312-65382334 CACTGGGGCCTACTTGAGAGTGG - Intergenic
1109815696 13:67581191-67581213 CACTGGGGACTACAAGAAAGGGG - Intergenic
1109864638 13:68246726-68246748 CACTGGGGACTACTTGTGGGTGG - Intergenic
1110013196 13:70365196-70365218 CACTGGGCACTACTAGAGAGTGG + Intergenic
1110492536 13:76125674-76125696 CATTGGGGACTACTTCAGGGAGG + Intergenic
1111010234 13:82303343-82303365 CACTGTGTACTACTAGAGAGTGG + Intergenic
1111357396 13:87126403-87126425 CACTGGGGACTCCTAGAGTGGGG + Intergenic
1111470180 13:88670825-88670847 CAATGGGGACTACTAGAGCGGGG + Intergenic
1111664854 13:91254247-91254269 CACTGGAGACTACTAAGGGGAGG + Intergenic
1111677898 13:91409867-91409889 CACTGGGAACTTCTAGAGAGGGG - Intronic
1111927304 13:94477473-94477495 CACTGGGGACTGCTAGAGAGGGG + Intronic
1112587560 13:100732897-100732919 CACTGGGGACTACTAGAGGGGGG - Intergenic
1113593539 13:111516786-111516808 AACTGGGGACTACTAGACAGGGG - Intergenic
1113704802 13:112421944-112421966 CACTGGGGCCTACTTGAGAGTGG + Intronic
1114434347 14:22691754-22691776 CACTGGGGACTACAAGATAGGGG - Intergenic
1115413805 14:33107413-33107435 CACTGGGAACTACTAGACAGGGG - Intronic
1115971418 14:38948931-38948953 CACTGGGGACTACTAGAGGGAGG + Intergenic
1115975628 14:38993479-38993501 CACGGGAGACTACTAGAGAGAGG + Intergenic
1115998427 14:39217331-39217353 CACTGGGGACTGCTAGGGGGAGG + Intergenic
1116211618 14:41953492-41953514 CACAGGGGACTACTAGGGAGGGG + Intergenic
1116496963 14:45572685-45572707 CACTGGGGTCTACTTGAGAGGGG - Intergenic
1116983923 14:51199897-51199919 CACTGGGGACTACTAGAGTGGGG - Intergenic
1117527131 14:56620122-56620144 CACTGGGGCCTACTTGAGAGTGG + Intronic
1117622475 14:57601468-57601490 CATTGGGGACTACTAGAGGGAGG - Intronic
1118158419 14:63264180-63264202 CAGTGGGGACTACTAGAGTGGGG - Intronic
1118190401 14:63574908-63574930 CACTGGGGACTACTAGAGAAGGG - Intergenic
1118676185 14:68187189-68187211 CACTGGGAACTACTAGAGAAGGG + Intronic
1118997662 14:70851577-70851599 CACTGTGGACTACTATAGCGGGG - Intergenic
1120820934 14:88911282-88911304 CAATGGAGACTACTAGAGAGGGG + Intergenic
1121157545 14:91700801-91700823 CACTGGGGACTACTAGCTGGGGG + Intronic
1123773794 15:23556883-23556905 CACTGGGTACTACTAGAGTGGGG + Intergenic
1124396148 15:29303651-29303673 CACTGGGGCCTACTTCAGGGTGG - Intronic
1125424024 15:39532020-39532042 CACTGGGGACTACTAGAGTGGGG - Intergenic
1125843154 15:42824700-42824722 CACTGGGGACTACTTCAGGATGG + Intronic
1126438404 15:48660371-48660393 AACTGGGGACTACTACAGAGAGG + Intergenic
1126540657 15:49819096-49819118 CACTGGGGACTACTAGAGTGGGG + Intergenic
1127743942 15:61944619-61944641 CACTGCGGACTACTACAGAGAGG + Intronic
1127845909 15:62870715-62870737 CACTGGGGCCTACTGGAGAGTGG - Intergenic
1128088731 15:64904643-64904665 CACTGGGGCCTACTAGAGGGTGG + Intronic
1130179487 15:81610634-81610656 CACTGGGGACTACCAGAGGGTGG + Intergenic
1130239366 15:82171702-82171724 CGCTGTGGACTACTAGAGAGTGG + Intronic
1130680900 15:85995910-85995932 CACTGGGGACTCCAAAAGAGGGG + Intergenic
1130752701 15:86729434-86729456 CACTGGGGACTACTAAAGTGGGG - Intronic
1132168338 15:99620347-99620369 CACTGGAGACTACTAGAGGGAGG - Intronic
1132242364 15:100267685-100267707 CACTGCGGACTACTAGAGAAGGG - Intronic
1132823592 16:1890907-1890929 CACTGGGGACCTCCACCGTGTGG - Intergenic
1133722816 16:8510752-8510774 CACTGGGGACTACCAGAGTGGGG - Intergenic
1134297129 16:12956707-12956729 CACTGGGGACTCCAAAAGAGGGG + Intronic
1134389776 16:13808641-13808663 CACTGGGGACTCCAAAAGAGGGG - Intergenic
1134590529 16:15449354-15449376 CACTGGGGACTACAAGAGGGAGG + Intronic
1134869573 16:17639450-17639472 CACTGGGAGCTACTAGAGAGGGG - Intergenic
1135161130 16:20097332-20097354 CACTGGGGACTACTAGAGGGAGG - Intergenic
1135790027 16:25385411-25385433 CGCTGGGGACTACTAAAGTGGGG - Intergenic
1136646026 16:31616223-31616245 CAATGGGGACTTATACAGAGGGG + Intergenic
1138742626 16:59328503-59328525 AACTGGGGACTGCTAAAGAGAGG - Intergenic
1139013188 16:62658694-62658716 TACTGGGGACTACTAGAGGGAGG - Intergenic
1139196776 16:64928721-64928743 CAATGTGGACTACTACAGAGTGG + Intergenic
1139381154 16:66531944-66531966 CACTGGGGACTCCTAGAGTGGGG + Intronic
1140551183 16:75867590-75867612 CACTGGGGCCTACCAGAGAGTGG - Intergenic
1141337267 16:83168033-83168055 CAGTGGGGACTACTAGAGTGGGG + Intronic
1142712441 17:1730758-1730780 CACTGTGAACTGCTGCCGAGTGG - Exonic
1143075452 17:4338975-4338997 GACTGAGAACTACTCCCGAGCGG - Intronic
1143376537 17:6470685-6470707 CACTGGGAACTGCCACTGAGCGG - Intronic
1146201758 17:30864506-30864528 CACTGGGGACTACAAAAGGGAGG - Intronic
1146822547 17:35996042-35996064 CGCTGGGGACTACTACAGGAGGG + Intronic
1149147733 17:53517731-53517753 CACTGGGGACTACTAAAGAGGGG - Intergenic
1149304887 17:55338102-55338124 CACTGGGGACTACTAGAGGTGGG - Intergenic
1149710359 17:58736180-58736202 CACTGGGGTCTACTACCTAAGGG - Intergenic
1149894527 17:60419348-60419370 CACTGGGGCCTACCAGAGAGTGG + Intronic
1150513564 17:65782799-65782821 CACTGGGGACTACTAGAGGTGGG + Intronic
1151273180 17:73012700-73012722 CACTGGGGACTACTAGAGAGGGG - Intronic
1153072189 18:1118001-1118023 CACTGGGGACTACTAGATGGGGG - Intergenic
1153086186 18:1290705-1290727 CACTGGGGACAACCAGAGAGAGG - Intergenic
1153209217 18:2741367-2741389 CACTGTGGACTACTACTGGCAGG - Intronic
1153318641 18:3750130-3750152 CTCTGGGGACTACTAGAGAGGGG - Intronic
1153353837 18:4112765-4112787 CACTGGTGACTACTGGAGAGGGG - Intronic
1153450236 18:5219062-5219084 CACTGGGGCCTACTGGAGAGTGG - Intergenic
1154094256 18:11396075-11396097 CACTGGGGACTACTAGAGGAGGG + Intergenic
1154961332 18:21311987-21312009 CACTGGGGCCTACTTGCGGGTGG - Intronic
1155226209 18:23731752-23731774 CACTGGGGACTACTAGAGGAGGG + Intronic
1155234011 18:23801281-23801303 CACTGGGGACTTCTAGAGGGAGG + Intronic
1155435549 18:25808970-25808992 CACTGTGGACTACTAGAGGGTGG + Intergenic
1155480458 18:26281125-26281147 CACTGGGAACTACTAGAAAGTGG + Intronic
1155614583 18:27706434-27706456 CACTGGGGACTACTGGGGTGGGG - Intergenic
1156168508 18:34453571-34453593 CACTGGGGCCTACTTGAGAGTGG + Intergenic
1156603498 18:38638725-38638747 CACTGGGGACTACTAGTCAAGGG + Intergenic
1156926788 18:42591190-42591212 CACTGGGGACAACTAGAGTGGGG - Intergenic
1157155398 18:45260822-45260844 TACTGGGGACTACTAGAGAGGGG + Intronic
1158110110 18:53931412-53931434 CCCTGGGGACTACTTGAGAGAGG + Intergenic
1159096711 18:63910463-63910485 CACTGGGGACTACTAGAATGGGG - Intronic
1159185389 18:64965432-64965454 CACTGGTGACTACTAGAGTGAGG - Intergenic
1159224080 18:65508791-65508813 CACTGGGGACTACCAGAGGGTGG + Intergenic
1159268522 18:66117401-66117423 CACTGGGGACGACTAGAGGGGGG + Intergenic
1159300047 18:66552041-66552063 CACTCAGGACTACTAGAGAGGGG + Intronic
1159634649 18:70789981-70790003 CACTGGGGACTAGTGCCTAGTGG - Intergenic
1159641391 18:70866437-70866459 CACTGGGAACTACTACAGTTTGG - Intergenic
1159817245 18:73090547-73090569 CACTGTGGACTACTAGAGGGTGG + Intergenic
1160117552 18:76095584-76095606 CACTGAGGACTACCAGAGAGGGG + Intergenic
1163069235 19:14824382-14824404 CACTGGAGACTACTATAGTGGGG - Intronic
1163094281 19:15044652-15044674 CACTGGTGACTACTAGAGGGAGG - Intergenic
1164452269 19:28376956-28376978 CACTGGGGGCTACTTCAGGGGGG + Intergenic
1164499474 19:28803858-28803880 CACTGTGGACTACTAGAGGGTGG + Intergenic
1164604545 19:29588115-29588137 CACTGGGGACTCCTACAGCAGGG - Intergenic
1166203900 19:41256509-41256531 CAATGGGGACTACTACCGCCAGG + Exonic
1167133986 19:47606162-47606184 CACTGGGGACTACCAGAGTGGGG - Intergenic
925954417 2:8948498-8948520 CACTGGGGACTACTAGAGGTGGG - Intronic
925992796 2:9267302-9267324 AACTGGGGACTACTAGAGAGCGG - Intronic
926736237 2:16075127-16075149 CACTGGGCACTACTAGAGAAGGG - Intergenic
927029519 2:19105869-19105891 CACTGGGGACTACTAGAGGGTGG + Intergenic
927402287 2:22726490-22726512 CACTAGGGACTACTAGAGTGGGG - Intergenic
928408674 2:31035843-31035865 CACTGGGGACTACTGTAGGGTGG + Intronic
928525691 2:32137818-32137840 CACTGCGGACTACTACATGGGGG - Intronic
928875761 2:36037119-36037141 AACTGGGGACTACTAAAGGGGGG + Intergenic
929367803 2:41181925-41181947 CACTGGGGACTACTAAAGAAGGG - Intergenic
929821084 2:45274323-45274345 CACTGGGGATTTCTACCAATGGG - Intergenic
930311873 2:49752355-49752377 CACTGGGGACTACTAAAGAGGGG + Intergenic
930628444 2:53725269-53725291 TACTGGGGACTAATAGAGAGGGG + Intronic
931145658 2:59514336-59514358 CACTGGGGACTACTAGATAGGGG + Intergenic
932060646 2:68494659-68494681 CAATGGGGCCTACTAAAGAGTGG - Intronic
932121861 2:69108625-69108647 CACTGGGGCCTACTAGAGGGTGG - Intronic
932507815 2:72253681-72253703 CACTGGGGCCTACTCCAGGGTGG + Intronic
932845011 2:75126081-75126103 CACTGGGGTCTACTTCAGGGTGG - Intronic
932856177 2:75236091-75236113 CACTGGGGACTCCTAAAAAGGGG - Intergenic
933107051 2:78343619-78343641 CACTGGGGACTACTAGATGGTGG - Intergenic
933626573 2:84607468-84607490 CACTGGAGACTACTAAAGAGGGG + Intronic
933918190 2:87017897-87017919 CACTGGGGACTACCAGAGAAGGG + Intronic
934004804 2:87752016-87752038 CACTGGGGACTACCAGAGAAGGG - Intronic
935611368 2:105029299-105029321 CACTGGGGACTACTAGAGGGAGG + Intergenic
935750287 2:106226636-106226658 CACTGGGGACTAGTAAAGGGGGG + Intergenic
935764105 2:106347428-106347450 CACTGGGGACTACTAGATGGGGG - Intergenic
935767762 2:106386049-106386071 CACTGGGGACTACCAGAGAAGGG - Intergenic
935936520 2:108190578-108190600 CACTGGGGACTGCTGGAGAGGGG - Intergenic
936439532 2:112539151-112539173 CACTGGGGACTACTAGAGCCAGG + Exonic
936459096 2:112698370-112698392 CACTGGGGACTACTAGAGAGGGG - Intergenic
937498765 2:122454461-122454483 CACTGGGGACCACTAAACAGGGG + Intergenic
937582535 2:123504597-123504619 CACTGGGGCCTACTACCAGAGGG - Intergenic
937823680 2:126340928-126340950 CACTGGGGACTACTACAAGGGGG + Intergenic
938632581 2:133184122-133184144 CACTGGGGACTACTAGAGCAGGG - Intronic
938999384 2:136716374-136716396 CACTGGTGACTACTAGAGTGAGG + Intergenic
939503648 2:143016898-143016920 CACTGCGGACTACTAAAGCGAGG - Intronic
939639482 2:144621943-144621965 CACTGGGGGCTACCAGAGAGTGG - Intergenic
939786030 2:146514258-146514280 CACTGGGAACTACTAGAAAGGGG - Intergenic
939947833 2:148431547-148431569 CACTGGGGCCTACTTGAGAGTGG - Intronic
940166045 2:150773187-150773209 CACTGGGAACTACTACAGAGGGG + Intergenic
940372012 2:152913129-152913151 CACTGGGGCCTACTAGAGGGTGG + Intergenic
940384001 2:153049075-153049097 CACTGAGGACTACTAGAGAGGGG + Intergenic
940779082 2:157914348-157914370 CACTGGGGACTACTAGAGCAGGG + Intronic
941139230 2:161757103-161757125 CACTGTGGACTACTAGAGGGTGG + Intronic
941304572 2:163846606-163846628 CACTGGGGACTACTAGAGTGGGG + Intergenic
941758946 2:169219671-169219693 CACTGTGGACTACTAGAGAGGGG + Intronic
942755139 2:179331784-179331806 CAATGGGGACTACTAGAGAGGGG + Intergenic
943028950 2:182663657-182663679 CACTGGGGCCTACTGGAGAGAGG + Intergenic
943225539 2:185169498-185169520 CACTGGGGACTACTACAGCAGGG - Intergenic
943386978 2:187213341-187213363 CACTGGGGGCTACTGGAGAGTGG + Intergenic
943844196 2:192622418-192622440 CACTGGGGACTATTAAAGTGGGG + Intergenic
943894051 2:193330552-193330574 CACTGGGGACTACTGGAGACTGG + Intergenic
944092712 2:195931016-195931038 CACTGGGGACTACTACAAGGAGG + Intronic
944764164 2:202848065-202848087 CACTGGGGACTACTGGAGTGGGG + Intronic
945315223 2:208363185-208363207 CACTGGGGCCTACTTCAGGGTGG - Intronic
945639429 2:212404807-212404829 TACTGGGGACTACTTGAGAGTGG - Intronic
945891221 2:215433414-215433436 CACTGGGAACACTTACCGAGTGG - Exonic
946598280 2:221331000-221331022 CACTGGGGCCTACTTCAGATTGG + Intergenic
946784488 2:223228229-223228251 CACTGGGGACTACTAGAGTGGGG - Intergenic
948896779 2:240931329-240931351 CACTGGGGTCTCCTACAGTGAGG + Intronic
1169526798 20:6437234-6437256 CACTGGGGACTGCTAGAGAAGGG + Intergenic
1169739708 20:8878965-8878987 CACTGGGGACTAATAAAGTGGGG - Intronic
1169944426 20:10973808-10973830 CACTGGGGACTACTAAAGAAGGG - Intergenic
1169983607 20:11416138-11416160 AACTGGGGACTACTAGAGGGAGG - Intergenic
1169996474 20:11563185-11563207 CACTGGGGACTACTAAAGGGAGG + Intergenic
1170106951 20:12762042-12762064 CACTGGGGGCTGCTACAGAGAGG - Intergenic
1170339806 20:15311767-15311789 CACTGGGGACTACTAGAGTGGGG + Intronic
1170674122 20:18463344-18463366 CACTGGGGACTACCAGAGGGTGG + Intronic
1170678810 20:18507040-18507062 CGCTGGGGACTACTAGAGTGGGG + Intergenic
1170859232 20:20087293-20087315 CACTGGGGACTTCTAGGGAGGGG - Intronic
1171082636 20:22203238-22203260 CACTGGGGACTACTAGAAAGGGG + Intergenic
1171195709 20:23197182-23197204 CACTGGGGACTACTAGAGAAAGG + Intergenic
1171949721 20:31410344-31410366 CACTGGGGACTACTAGAGTCAGG + Intronic
1173281103 20:41628718-41628740 CACTGGGGACTACTAGTGGTGGG - Intergenic
1173477014 20:43367017-43367039 CACTGGGGACTACCAGAGGGAGG + Intergenic
1173877118 20:46380348-46380370 CACCTGTGACTACTATCGAGAGG + Intronic
1174782556 20:53403064-53403086 CACTGGGAACTACTGGAGAGCGG - Intronic
1176779340 21:13174584-13174606 CACTGGGGACTACTAGAGGATGG + Intergenic
1176981825 21:15390931-15390953 CACTGGGGACTACTAGAGAGAGG - Intergenic
1177086981 21:16718110-16718132 CACTGGGGACTACTAGACATGGG + Intergenic
1177121106 21:17138103-17138125 CACTGGGGACTACTAAAGGGAGG + Intergenic
1177454742 21:21322286-21322308 CACTGAGGACTACTAGAGAAGGG + Intronic
1177479394 21:21667461-21667483 CACTGTGGACTACTACAGTGGGG + Intergenic
1177542127 21:22507826-22507848 CACTGAGGACTACTAGACAGTGG - Intergenic
1177664820 21:24141161-24141183 CACTGCGGACTACTAGAGTGGGG + Intergenic
1177976984 21:27863618-27863640 CACTGGGGACTACTAGAGGATGG + Intergenic
1178870073 21:36366194-36366216 CACTGGGGACCACTACAGTGGGG - Intronic
1179359338 21:40690916-40690938 CACTGGGGCCTACTTCGGGGTGG + Intronic
1179980582 21:44893635-44893657 CACTGGGGACTTGCACTGAGAGG - Intronic
1181143516 22:20825889-20825911 CACTGGGGCCTACTTAAGAGTGG - Intronic
1182611537 22:31552036-31552058 CACTGGGGACTCCAAACGAGGGG - Intronic
1184311588 22:43648540-43648562 TACTGGGGACTACTAGAGTGGGG + Intronic
950090437 3:10290866-10290888 CACTGTTGACTTCTACCCAGAGG - Exonic
950393071 3:12711892-12711914 CACTGGGGACTACTAGAGCGGGG - Intergenic
950608183 3:14103348-14103370 CACTGGGGACTACTAGAGGAGGG + Intergenic
951160446 3:19413362-19413384 AACTGGGGACTACTAGAGAAGGG + Intronic
951683077 3:25314851-25314873 CACTGTGGACTACAAGAGAGGGG - Intronic
952030447 3:29135836-29135858 CACTGAGGACTACTAGAGGGAGG + Intergenic
952456700 3:33479288-33479310 CACTGGGGACTACTAGAAAGGGG - Intergenic
952562116 3:34606912-34606934 CACTGGGGACTACTAGTCAGGGG - Intergenic
953030423 3:39176325-39176347 GAGTGGAGACTACTACAGAGGGG - Intergenic
953151065 3:40325295-40325317 CACTGGGGACTACTAGAGTAGGG + Intergenic
953230358 3:41059102-41059124 CACTGGGGACTACTAGAGGGAGG - Intergenic
953249165 3:41227879-41227901 CACTGGGGCCTACTTACGGGTGG - Intronic
953807589 3:46084777-46084799 CACTGGGGGCTACTAGAGGGTGG + Intergenic
954521432 3:51230276-51230298 CACTGGGGACTACTAGAGTGGGG - Intronic
954716590 3:52529897-52529919 CACTGAGGACTCCAACCCAGAGG + Intronic
955616577 3:60814364-60814386 CACTGGGGACTACTAGAGCAGGG - Intronic
956135966 3:66099166-66099188 CACTGGGGACTACTGGCTGGTGG - Intergenic
956261053 3:67341972-67341994 CACTGGGGACTACTAGGTTGGGG + Intergenic
956330326 3:68099982-68100004 CACTGGGGACAACTAGAAAGGGG + Intronic
956879410 3:73495006-73495028 CACTGGGGACTACTAGAGGGGGG + Intronic
956963060 3:74425244-74425266 CCCTGGGGACGACTACAGTGGGG - Intronic
957307113 3:78471489-78471511 CACTGAGGACTACTACAGGTTGG - Intergenic
957442345 3:80265812-80265834 CACTGGGGACTACCAGAGGGTGG + Intergenic
957495526 3:80986576-80986598 CACTGGGGTCTACTTGAGAGGGG - Intergenic
957668516 3:83268936-83268958 CACTGGGGACTACTAGAGGAGGG - Intergenic
958054745 3:88394864-88394886 CACTGGGGTCTACTTGAGAGAGG + Intergenic
958173995 3:89972117-89972139 CACTGGGGACTACTAGACAAGGG + Intergenic
958254119 3:91304989-91305011 CACTGGGGACTACTAGAGGGAGG - Intergenic
958414743 3:93860379-93860401 CACTGGGGCCTACTACAGCAGGG + Intergenic
958438658 3:94129476-94129498 CACTGGTGACTACTAGAGTGGGG + Intergenic
958705685 3:97652004-97652026 CACTCGGGACTACTAGACAGAGG - Intronic
959182443 3:102998717-102998739 CACTGGGGACTACTAGAGAGGGG + Intergenic
959424392 3:106168315-106168337 CACTGGGGACTACTAAAAGGGGG + Intergenic
959431753 3:106262693-106262715 CACTGGAGACTACTAGAGAGGGG + Intergenic
959610595 3:108290498-108290520 CACTGGGGTCTACTTGAGAGTGG - Intergenic
959788978 3:110333885-110333907 CACTGGAGTCTACTTCAGAGTGG + Intergenic
959912496 3:111779405-111779427 TACTGGGGACTACTAGAGGGAGG - Intronic
960435195 3:117618201-117618223 TACTGGGGACTATTAGAGAGGGG + Intergenic
961476349 3:127148713-127148735 CACTGGGTACAACTAATGAGAGG + Intergenic
963176175 3:142299822-142299844 CACTGGGGACTACTAGAGTGGGG - Intergenic
963180907 3:142355059-142355081 CACTGGGGGTTACTACAGATGGG + Intronic
963411031 3:144928014-144928036 CACTGGGGACTACTAGGGATGGG + Intergenic
963965067 3:151359088-151359110 CACTGGGGACTACTGAAGTGGGG - Intronic
964022756 3:152033990-152034012 CACTGGGGGCTACTACAGTGGGG + Intergenic
964093788 3:152907811-152907833 CACTGGGGACTCCTAGACAGGGG + Intergenic
964162362 3:153660531-153660553 CACTGGGGACTACTAGAGCAGGG - Intergenic
964443359 3:156735308-156735330 CACTGGGGACTACTAGAGGGGGG + Intergenic
964460091 3:156914946-156914968 CACTGGGGCCTACTTGAGAGTGG - Intronic
964514642 3:157494580-157494602 CACTGGGGACTAATAATGGGTGG + Intronic
964651852 3:159020295-159020317 CACTGGGGACTATTAGAGGGAGG - Intronic
964810435 3:160657665-160657687 CACTGGGGACTACTACACAGGGG - Intergenic
965048337 3:163610091-163610113 CACTGGAGACTACTAGAGAGAGG - Intergenic
965172794 3:165289691-165289713 CACTGGTGACTACTAGAGTGGGG - Intergenic
965239497 3:166176860-166176882 CACTGGGGTCTACTTGGGAGTGG - Intergenic
965755142 3:172018096-172018118 CACTGGGGACTACTAGAGATGGG + Intergenic
966618540 3:181938907-181938929 CACTGGGGACTACTAGAGGGGGG + Intergenic
967210617 3:187165021-187165043 CAGTGGGGACTACTAGAGCGGGG + Intronic
967453930 3:189659215-189659237 CACTGGTGACTACTAGAGTGGGG - Intronic
969190107 4:5511483-5511505 CACTGTGGACCACTACAGGGTGG + Intergenic
970109873 4:12625796-12625818 CACTAGGGACTACTAGAGTGGGG - Intergenic
970702569 4:18759772-18759794 CACTGTGGACTACTAGAGGGTGG - Intergenic
971630762 4:28990298-28990320 CACTGGGGGCTACTACCAGGTGG - Intergenic
971737929 4:30481222-30481244 CACTGGGGCCTACTAGTCAGGGG + Intergenic
972147687 4:36048371-36048393 CACTGTGGACTACTAGAGGGAGG - Intronic
972681714 4:41312505-41312527 CACTGGCCACTCCTCCCGAGAGG - Intergenic
972834107 4:42847912-42847934 CACTGGGGACTAGCAGAGAGTGG - Intergenic
972867412 4:43250623-43250645 CACTAGGGACTACTAGAGACAGG + Intergenic
972919179 4:43917173-43917195 CACTGGGGCCTACTAGAGGGTGG + Intergenic
973047099 4:45548243-45548265 CACTGGGGACTACTACCAAGAGG + Intergenic
973556953 4:52092975-52092997 CACTGGGGACCACCAGAGAGTGG + Intronic
973711984 4:53639316-53639338 CACTGGGTACTACTACAGCAGGG + Intronic
974366261 4:60953550-60953572 CACTGGTGACTACTAGAGAGGGG - Intergenic
974531530 4:63114552-63114574 CACTGGGGACTACTAGAGGGAGG - Intergenic
974543496 4:63269837-63269859 TACTGGGGACTACTACAGTGGGG - Intergenic
975351185 4:73349178-73349200 CACTGGAGACTACTAGAGGGGGG + Intergenic
975363836 4:73504776-73504798 TACTGGGGACTACTACAGAGGGG - Intergenic
975891142 4:79029155-79029177 CACTGGGGACTACTACAGGCAGG - Intergenic
975909627 4:79251459-79251481 CACTGGGGCCTACTTGAGAGTGG + Intronic
976105272 4:81610587-81610609 CACTGGGGACTACCAGAGTGGGG + Intronic
976131330 4:81887568-81887590 CACTGGGGACTACTACCGAGGGG + Intronic
976466240 4:85372024-85372046 CACTGGGGACTAATAGAGTGGGG + Intergenic
976962717 4:90998891-90998913 CACTGGGGACTACTAGGGCATGG - Intronic
976979364 4:91207386-91207408 CAATGGGGCCTACTTCAGAGAGG - Intronic
977040514 4:92011453-92011475 TACTGTGGACTACTAGAGAGTGG - Intergenic
977487077 4:97662772-97662794 CACTGTGGACTACTAGAGTGGGG + Intronic
977769780 4:100844681-100844703 CACTGTGGACTACTAGAGAGTGG + Intronic
978628433 4:110714675-110714697 CACTGTGGACTACTAAAGTGAGG + Intergenic
978744783 4:112180187-112180209 CACTGGGGACTACTGGAGGGTGG + Intronic
979064253 4:116107957-116107979 CACTGAGGACTACTAGAGAGTGG - Intergenic
979182306 4:117745733-117745755 CACTGGGGACTACTACACACAGG + Intergenic
979217223 4:118180262-118180284 CACTGGGGACTGCCAGAGAGGGG - Intronic
979550931 4:121990243-121990265 CACTGGGGACTACTAGATAGGGG + Intergenic
979988897 4:127350695-127350717 CACTGGGGTCTACTTGCGAGGGG + Intergenic
979996810 4:127441053-127441075 CACTAGGGTCTACTTGCGAGGGG + Intergenic
980155390 4:129098328-129098350 CACTGGGGACTACTAGAGGGGGG - Intronic
980271651 4:130591773-130591795 CACTGTGGACTACTAGAGGGTGG - Intergenic
980555626 4:134400109-134400131 CACTGTGGACTACTAGAGAGTGG - Intergenic
980908029 4:138968074-138968096 CACTGGGGACTACTGGAGGGAGG + Intergenic
981122009 4:141062836-141062858 CACTGGGGCCTACTAGAGGGCGG - Intronic
981325686 4:143444772-143444794 CACTGGGTACTACCAGAGAGGGG - Intronic
981565841 4:146100473-146100495 CACTGGGGACTACTAGAATGGGG - Intergenic
981586598 4:146309977-146309999 CACTGGGGACTAATAGAGTGGGG - Intronic
981592989 4:146385757-146385779 CACTGGGGACTACTAGAGTCGGG - Intronic
981645635 4:146995697-146995719 CACTGGGGACTACTAGAGCGGGG + Intergenic
982009771 4:151095489-151095511 CACTGGGGACTACTTGAGAATGG + Intergenic
982533237 4:156574314-156574336 CACTGGGAACTACTAGAGGGAGG + Intergenic
982629528 4:157814382-157814404 CAATGGGGAATACTAGAGAGGGG + Intergenic
982755795 4:159217329-159217351 CACTGGGGACTACAAGAGTGAGG - Intronic
983135166 4:164070099-164070121 CACTGTGGACTACTAAAGTGGGG + Intronic
983174741 4:164575208-164575230 CGCTGGGGACTACTAGAGAGGGG + Intergenic
983671189 4:170239689-170239711 CACTGGGGACTACTAGAGGTGGG - Intergenic
984052591 4:174884217-174884239 CACTGGGGACTGCTTGAGAGGGG - Intronic
984171329 4:176362757-176362779 CACTGGGGACTACTAGAGAGGGG - Intergenic
984640182 4:182156507-182156529 CACTGAGGACTACTAGGGCGGGG - Intronic
984728377 4:183042670-183042692 CACTGTGGACTACTAGAGCGGGG - Intergenic
985366747 4:189239019-189239041 CAATGGGGACTACTAGAGTGGGG - Intergenic
986557033 5:9020726-9020748 CACTGGGGATTACTAGAGAGAGG - Intergenic
986899825 5:12417891-12417913 CACTGTGGACTAGTAGAGAGTGG + Intergenic
987178907 5:15346085-15346107 CACTGGGGACTACTAGAGGGTGG + Intergenic
987615431 5:20267957-20267979 CACTGGGGACTACTAGAGAGTGG - Intronic
987806416 5:22774816-22774838 CACTGGGGACTATTAGAGTGGGG + Intronic
987831519 5:23101839-23101861 CGCTGGGGACTTCTAGAGAGGGG + Intergenic
988207844 5:28163325-28163347 CACTGAGGACCACTAGAGAGGGG + Intergenic
988444949 5:31275360-31275382 CACTGGGGACTACTAGAGTGGGG - Intronic
988788952 5:34589816-34589838 CACTGGGGGCTACTAACAGGAGG + Intergenic
988897166 5:35689512-35689534 CACTGGGGACTACTAGAGGGAGG - Intronic
989395480 5:40951448-40951470 CACTGGGGACTGCTAGAGAGGGG + Intronic
989488235 5:42017598-42017620 CACTGGGGACTACTAGAGGGGGG - Intergenic
989969692 5:50508051-50508073 CACTGAGGACTACTAGAGTGGGG + Intergenic
990022993 5:51151430-51151452 CACTGGGGACTACTAGAGGAGGG + Intergenic
990682657 5:58262912-58262934 CACTGGGGACCACTAGACAGGGG - Intergenic
992280490 5:75170667-75170689 CACTGGGGACTACTTATGGGAGG - Intronic
992519758 5:77538461-77538483 CACTGGGGAATACTATAGTGGGG - Intronic
992736324 5:79725448-79725470 CACTGGGGACTACAAAAGTGGGG + Intronic
992809670 5:80374042-80374064 CACTGGGGCCTACTTGAGAGTGG - Intergenic
992900976 5:81295083-81295105 CACTGGGGACTGCTAGAGGGAGG + Intergenic
993156213 5:84227905-84227927 CACTGCAGACTACTAGAGAGTGG + Intronic
993590154 5:89784393-89784415 CACTGGGGACTACTAGAGGGTGG + Intergenic
993944543 5:94101776-94101798 CACTGGGGTCTACTTAAGAGAGG + Intronic
994437377 5:99755500-99755522 AACTGAGGACTACTAGGGAGGGG + Intergenic
994470653 5:100200665-100200687 CACTGGGGCCTACTTGAGAGAGG - Intergenic
994567230 5:101465624-101465646 CACTGTGGACTGCTAGAGAGTGG - Intergenic
994591510 5:101779143-101779165 TACTGGGGACTACTGGAGAGGGG + Intergenic
994852931 5:105079381-105079403 CACTGAGGACTACTAAGTAGGGG - Intergenic
994859511 5:105170289-105170311 CACTGGGGACTGGTAGAGAGGGG - Intergenic
995752365 5:115466478-115466500 CACTGGGGACTACTAGATGGGGG + Intergenic
995990093 5:118227892-118227914 CACTGGGGCCTACTTCAGAATGG + Intergenic
996044338 5:118853045-118853067 CACTGGAGACTACTAGAGAGAGG + Intronic
996301382 5:121990411-121990433 CACCGTGGACTACTAGCGGGTGG + Intronic
996783430 5:127213249-127213271 CACTGGGGACTACTAGAGAATGG - Intergenic
997455595 5:134015194-134015216 CACTGTGGACTACAAGAGAGGGG + Intergenic
997882131 5:137600671-137600693 CACTGGGGAATACAAGAGAGGGG - Intergenic
998804050 5:145901131-145901153 CACTGGGGACTACTAGAGGGGGG + Intergenic
999374188 5:151075496-151075518 CACTGGGGACTGCTAGAGTGGGG - Intronic
999929016 5:156410370-156410392 CACTGGGGGCTACTGGGGAGGGG + Intronic
1000322278 5:160143982-160144004 CACTGGGGACTCCAAAAGAGCGG - Intergenic
1000526613 5:162366798-162366820 CACTGGGGACTACTAAAGGAGGG + Intergenic
1000822316 5:165999748-165999770 CACTGGAGACTACTAGAGGGAGG - Intergenic
1001346745 5:170908497-170908519 AACTGGGGACTACTAGATAGGGG + Intronic
1001415192 5:171540728-171540750 CACTGGGAACTACTAGAGTGGGG + Intergenic
1001703834 5:173727520-173727542 CACTGGGGACTACTACAGTGGGG + Intergenic
1002984739 6:2178120-2178142 CACTGGGGACTACTGGCGGGAGG + Intronic
1003484981 6:6567677-6567699 CACTGGGGACTCCTAGAGTGGGG - Intergenic
1004276728 6:14243272-14243294 CACTGGGGACTACTTGAGGGTGG + Intergenic
1005003571 6:21266435-21266457 CACTGGGGACTACTAGAGAGGGG + Intergenic
1005919222 6:30383955-30383977 CACTGGGGCCTACCAGAGAGTGG - Intergenic
1006572728 6:35018697-35018719 CACTGGGGACTACTGGAGAGGGG - Intronic
1007954614 6:45904882-45904904 CACTGGGGACTACTTGGCAGAGG - Intronic
1008026383 6:46640779-46640801 CACAGGGGACTACTAGAGGGAGG - Intronic
1008081564 6:47200101-47200123 CACTGGGGACTACTAGAGTGGGG - Intergenic
1008165871 6:48137562-48137584 CATTGTGGACTACTAGAGAGGGG - Intergenic
1008213692 6:48758393-48758415 CACTGGGGACTACTAAAATGGGG + Intergenic
1008233888 6:49019769-49019791 CACTGGTGACTACTAAAGAATGG - Intergenic
1008904861 6:56665682-56665704 CACTGGGGACTACTATGGGGTGG + Intronic
1009189707 6:60615492-60615514 CACTGGGCACTACTAGAGGGAGG + Intergenic
1009484746 6:64206980-64207002 CACTGGGGCCTATTACGGGGTGG - Intronic
1009509103 6:64525506-64525528 CACTGGGGACTACTTGAGGGTGG + Intronic
1009729603 6:67583128-67583150 CACTGGAGACTACTACAGGTGGG - Intergenic
1009836782 6:69011460-69011482 CACTGGGGACTAATAGAGTGGGG + Intronic
1009849235 6:69174260-69174282 CAATGGGGACTACTAGAGGGAGG - Intronic
1010061270 6:71625634-71625656 CACTAGGGAGTACCACAGAGGGG - Intergenic
1010066568 6:71688825-71688847 CACTGGGGACTACTAGAGGGAGG - Intergenic
1010467161 6:76181691-76181713 CACTGGCGACTACTAGAGTGGGG + Intergenic
1010708278 6:79140318-79140340 CACTGGGGCCTATTAGAGAGTGG + Intergenic
1010817711 6:80378239-80378261 CACTGGGGACTACAAAAGAAGGG - Intergenic
1011325062 6:86141546-86141568 CACTGGGGTCTACTCGAGAGTGG - Intergenic
1011624630 6:89272916-89272938 CACCCGGGACTACTTCCAAGAGG - Intronic
1011732133 6:90275660-90275682 CACTGGGGCCTACTGGAGAGTGG - Intronic
1011862487 6:91777117-91777139 GAATGGGGACTACTAGAGAGGGG + Intergenic
1012238883 6:96849992-96850014 CACTGGGGCCTACTTCAGGGTGG + Intergenic
1012640062 6:101599076-101599098 CACTGGGAACTACTAGAGTGGGG - Intronic
1012641982 6:101629871-101629893 CACTGGAGACTACAAGCGTGGGG - Intronic
1012695522 6:102377149-102377171 CACTGTGGACTACTAGAGAGGGG - Intergenic
1012842581 6:104347767-104347789 CACTGGGGACTACTAGAAGGAGG + Intergenic
1013338868 6:109193135-109193157 AACTGGGAACTACTAGAGAGGGG - Intergenic
1013479280 6:110539289-110539311 CACTGTGGACTACTAGAGGGAGG - Intergenic
1013661678 6:112304074-112304096 CACTGGGGACTACTAGACTGGGG - Intergenic
1014059477 6:117053823-117053845 CACTGGGGACTACAAGAGAAGGG - Intergenic
1014129423 6:117813646-117813668 CACTTGGGACTACTAAAGGGAGG + Intergenic
1014217036 6:118762280-118762302 CACTGGGGACTACTAGAGGCTGG - Intergenic
1014907911 6:127052613-127052635 CACTGGGGACTACTAATGAGAGG + Intergenic
1015063359 6:128995661-128995683 CACTGGGCAATACAACAGAGGGG - Intronic
1015268451 6:131313903-131313925 AACTGGGGACTACTACAAAGGGG - Intergenic
1015841762 6:137484740-137484762 CACTGGGGACTACCAGTGAGGGG + Intergenic
1016093515 6:140007939-140007961 CACTGCGGACTACTAGAGGGTGG + Intergenic
1016253413 6:142073717-142073739 CACTGGGGACTCCAACAGTGGGG + Intronic
1016617307 6:146066227-146066249 CACTGGGGAATACAAGAGAGAGG - Intronic
1016642689 6:146367571-146367593 CACTGGGGACTACTACTATGGGG - Intronic
1017543885 6:155430419-155430441 CACTGGGGACTACCAAGCAGAGG - Intronic
1017567623 6:155705159-155705181 CAGTGGGGACTACTAGAGTGGGG + Intergenic
1018006783 6:159629767-159629789 CACTGGGGACCACTAGAGTGGGG - Intergenic
1018128599 6:160706176-160706198 CACTGGGGACTACCAGAGAAGGG - Intronic
1018298268 6:162372543-162372565 CACTGGGGACTACTAGAGAGGGG + Intronic
1018671631 6:166182550-166182572 CACTGGGGTCTACTTGAGAGTGG - Intergenic
1018769933 6:166961724-166961746 CAGTGGGGACTATTACAGAAGGG - Intergenic
1019847028 7:3513789-3513811 CACTGGGGACTACTAAGGGTGGG - Intronic
1019853516 7:3582498-3582520 CACTGGGGCCTACTTGAGAGTGG - Intronic
1020503343 7:8951911-8951933 CACTGGGGACTACTAGAGGCAGG + Intergenic
1020689335 7:11335452-11335474 CACTGGGGCCTACCAGAGAGTGG + Intergenic
1022762900 7:33376189-33376211 CACTGGGGCCTACCTCAGAGTGG - Intronic
1026073817 7:67147582-67147604 CACTGGGGCCTATCACAGAGTGG - Intronic
1026183485 7:68062676-68062698 CACTGGTGACTACTAGAGTGGGG + Intergenic
1026486626 7:70827272-70827294 CACTGGGGATTACTAGAGGGTGG - Intergenic
1026652021 7:72223983-72224005 CAGTGGGGACTACTAGAGGGAGG + Intronic
1026703063 7:72664585-72664607 CACTGGGGCCTATCACAGAGTGG + Intronic
1027337590 7:77170134-77170156 CACTGCAGACTACTAGAGAGTGG - Intronic
1027444941 7:78262985-78263007 CACTGGGGACTACTAGACAGAGG - Intronic
1027450980 7:78331195-78331217 CACTAGGGACTACTAGAGTGGGG + Intronic
1027949392 7:84794915-84794937 CACTGGGGACTACTAGAGTGAGG - Intergenic
1028413479 7:90556113-90556135 CACTGGGGACTACTAGAGGTGGG + Intronic
1028699987 7:93766258-93766280 CACTGGAGACTACAAGAGAGGGG + Intronic
1028921325 7:96313596-96313618 CACTGGGGACTACTAGAGGGAGG + Intronic
1029778152 7:102700668-102700690 CACTGCAGACTACTAGAGAGTGG + Intergenic
1029880803 7:103807619-103807641 CACTGGGGACTGCTTGAGAGGGG - Intronic
1030590387 7:111474156-111474178 CACTGGGGACTACTTGAGTGGGG + Intronic
1030682079 7:112444782-112444804 CACTGGGGACTACTAGAGGCGGG + Intronic
1030924555 7:115435857-115435879 TGCTGGGGACTACTAGAGAGGGG + Intergenic
1031143692 7:117973750-117973772 CACTGGGGACTACTAGAGTAGGG - Intergenic
1031242392 7:119263146-119263168 AACTGGGGACTACTAGAGGGGGG - Intergenic
1031731310 7:125304390-125304412 CACTGTGGACTACTAGAAAGTGG + Intergenic
1031911720 7:127523860-127523882 CACTGGGGACTACTGGAGGGGGG + Intergenic
1032956515 7:136978048-136978070 CACTGGGAACTACTAGAGAGGGG + Intronic
1033874587 7:145799133-145799155 CACTGGGGACTACTAGATGGGGG + Intergenic
1035088812 7:156286959-156286981 CACTGGGGACTACGAGAGGGAGG + Intergenic
1036495112 8:9263237-9263259 CACTGGTGACTACTAGAGAGGGG + Intergenic
1036950695 8:13136340-13136362 CACTGGGAACTACTAGAGTGGGG - Intronic
1037470694 8:19206962-19206984 CACTGGGAACTACTAGATAGGGG + Intergenic
1037966981 8:23142581-23142603 CACTGGGGACTACCAGGGCGGGG + Intronic
1038966334 8:32576978-32577000 CACTGGGGACTACTAGAGCAGGG - Intronic
1039014939 8:33136817-33136839 CACTGGGGACTACTAGAAGGAGG - Intergenic
1039090786 8:33827615-33827637 CACTGGGGACTCCTAATGGGAGG + Intergenic
1039214164 8:35250825-35250847 CACTGGGGACTACTAGAGTGGGG - Intronic
1039451974 8:37682385-37682407 CACTGGGGACTACTGGGGGGCGG + Intergenic
1039653601 8:39373199-39373221 CACTGGGGGCATCTACCCAGAGG + Intergenic
1039738483 8:40357912-40357934 CACTGGGGACTCCAAGGGAGAGG + Intergenic
1040866344 8:52052313-52052335 CACTGGGGACTACCAGGGTGGGG - Intergenic
1040973312 8:53161572-53161594 CATTGGGGACTACTAGAGAGGGG - Intergenic
1040985475 8:53289765-53289787 CACTGGAGACTACTAGAGTGGGG + Intergenic
1041288054 8:56281158-56281180 CACTAGAGACTACTAGAGAGGGG - Intergenic
1041572195 8:59350235-59350257 CACTGGGAACTTCTAGAGAGGGG + Intergenic
1041579289 8:59438825-59438847 CACTGGGGACTACTAGAGTGGGG - Intergenic
1041731492 8:61067807-61067829 CACTGGGGACTACTAGAAGGGGG + Intronic
1042401028 8:68347119-68347141 CACTGGGGTCTACTTGAGAGTGG - Intronic
1042518028 8:69680291-69680313 CACTGGAGACTACTAGAGGGTGG - Intronic
1042703761 8:71644787-71644809 CACTGGGAACTACAAGAGAGGGG - Intergenic
1042868275 8:73374873-73374895 CACTGGGGACTAGTAGAGGGAGG + Intergenic
1043007548 8:74838570-74838592 CACTGGGGACTACTTGAGAGGGG - Intronic
1043233861 8:77835687-77835709 CACTGGGGACTGCTAGGGGGTGG + Intergenic
1043374725 8:79635740-79635762 CACTGTGGACTACTAGAGGGGGG + Intronic
1043483115 8:80672745-80672767 CACTGGGGACTACTAGAGGAGGG + Intronic
1043533272 8:81173097-81173119 CACCGGGGACTATTAGAGAGGGG + Intergenic
1043628815 8:82300336-82300358 CACTGAAGACTACTACAGGGAGG - Intergenic
1043680144 8:83013321-83013343 CACTGGGGAATACTGGAGAGGGG - Intergenic
1043835911 8:85045679-85045701 CACTGTGGACTACCAGAGAGGGG - Intergenic
1043871071 8:85433679-85433701 CACTGGGGCCTACCAGGGAGTGG + Intronic
1043950119 8:86299293-86299315 CACTGGGGACTACTACAGCAGGG - Intronic
1044009149 8:86970612-86970634 CACTGTGGACTACTACAGGTGGG - Intronic
1044068191 8:87723593-87723615 CTCTGGGGACTACTAAAGCGAGG - Intergenic
1044196525 8:89383479-89383501 CACTGGGGACAACTAGAGGGGGG + Intergenic
1044479126 8:92664330-92664352 CACTGTGGACCACTTCAGAGGGG + Intergenic
1044596399 8:93962884-93962906 CACTGGGGACTACCAGAGAGGGG - Intergenic
1044928491 8:97229840-97229862 CACTGCAGACTACTACAGATGGG + Intergenic
1045048061 8:98297689-98297711 CAATGCGGACTACTAGAGAGGGG - Intergenic
1045670818 8:104551523-104551545 CACTGGGGACTACTAGAGGTAGG - Intronic
1046371221 8:113309389-113309411 CACTGGGGACTAATAGTGTGGGG - Intronic
1046421337 8:113987144-113987166 CACTGTGGACTACTAGAGAGGGG + Intergenic
1047359623 8:124156176-124156198 CACTGGGGACTACTAGAGGGAGG - Intergenic
1047575973 8:126155647-126155669 CACTGGGGACTGCTAGAGAGGGG + Intergenic
1047632859 8:126727185-126727207 CACTGGGGACTACTAGAGGTGGG - Intergenic
1047834590 8:128674650-128674672 CACTGCAGACTATTAGCGAGGGG - Intergenic
1047895640 8:129363489-129363511 CACTGTGGACTACTAGAGGGTGG + Intergenic
1047919828 8:129623408-129623430 CACTGGGAACTACTAGAGAGGGG - Intergenic
1048041987 8:130739530-130739552 CACTGGGGACTACAAGAGAGGGG + Intergenic
1048124706 8:131621013-131621035 TACTGAGGACTACTAGAGAGGGG + Intergenic
1048724462 8:137366717-137366739 CACTGGGGACTCCAAAAGAGGGG - Intergenic
1048788058 8:138073035-138073057 CCCTGGGGACTACTAGAGAGGGG + Intergenic
1050079610 9:1902788-1902810 TACTTGGGACTACTACAGAAGGG + Intergenic
1050094816 9:2053131-2053153 CACTGGGGACTACTAGACGGGGG - Intronic
1050677046 9:8067992-8068014 CACTGGGAACTACTAGGGGGAGG - Intergenic
1051309618 9:15756543-15756565 CACTGGGGACTACTAGAGTAGGG - Intronic
1052005802 9:23346902-23346924 CACTGGGAACTACTGGGGAGTGG + Intergenic
1052151318 9:25119964-25119986 AACTGGGGACTACTAGAGGGAGG + Intergenic
1052242241 9:26288072-26288094 CACTGGGGACTACTAGAGAGTGG - Intergenic
1052718637 9:32148232-32148254 CACTGTGGACTACTAGAGGGTGG - Intergenic
1054821616 9:69527062-69527084 CAGTGGGGACTACTAGAGTGGGG + Intronic
1054998477 9:71421196-71421218 CACTGGGGACTACTAGAGGTGGG + Intronic
1055140295 9:72869505-72869527 CACTGGGGACTACTAGAAAGAGG - Intergenic
1055148706 9:72967926-72967948 CACTGGAGACTACTAGAGAGTGG - Intronic
1055237752 9:74144269-74144291 CACTGGGAACTACTAGAGAAGGG + Intergenic
1055978703 9:81978881-81978903 CACTAGGGACTACTAGAGGGGGG - Intergenic
1056362063 9:85868392-85868414 CACTGGGGACTACTAGAAAGAGG + Intergenic
1057985885 9:99713299-99713321 CACTGGGGACTACTAGAGCGGGG - Intergenic
1058016320 9:100036478-100036500 CACTGTGGACTACTAGAGAGAGG + Intronic
1058061971 9:100507029-100507051 CACTGGACACTACTACAGTGGGG - Intronic
1058102464 9:100932413-100932435 CACTGGGAACTACTAGAGGGGGG - Intergenic
1058102549 9:100933282-100933304 CACTAGGGACTACTAGAGCGGGG - Intergenic
1059577427 9:115505585-115505607 CACTAGGGACTACTAGAGTGGGG - Intergenic
1059631344 9:116126242-116126264 CACTGGAGACTACTAGATAGAGG - Intergenic
1059797127 9:117710223-117710245 CCCTGGGGATTACTAGAGAGGGG - Intronic
1059983093 9:119794798-119794820 CCCTGGGGACTATTAACGATGGG - Intergenic
1060080622 9:120640864-120640886 CACTGGGGACTACTAGAAGGGGG - Intronic
1060465013 9:123895994-123896016 CACAAGGGACTGCTACTGAGTGG + Intronic
1060706027 9:125802268-125802290 CACTAGGGACTACTAGAGAGGGG - Intronic
1185912308 X:3993593-3993615 CACTGGGGTCTACTTGAGAGTGG + Intergenic
1185916660 X:4043039-4043061 CACTGGGGACTACTAGAGCAGGG - Intergenic
1185932493 X:4218638-4218660 CACTGGGGACTACTTGAGGGTGG + Intergenic
1186061912 X:5718166-5718188 CACTGGGGACTACTCGAGGGGGG + Intergenic
1186111940 X:6266886-6266908 CACTGAGGACTACTAAAGGGAGG + Intergenic
1187671521 X:21670859-21670881 CACTGGGGACTCCAAAAGAGGGG - Intergenic
1187778169 X:22787456-22787478 CACTGTGGACTACTAGAGGGTGG + Intergenic
1188018079 X:25126918-25126940 CACTGGGGACTACTAGAGGAAGG + Intergenic
1188061001 X:25601968-25601990 CACTGGGGAATACAACAGGGAGG - Intergenic
1188065327 X:25652123-25652145 AACTGGGGACTACTAGACAGGGG - Intergenic
1188429183 X:30086307-30086329 CACTGGGGACTACTAGAGGGTGG + Intergenic
1188580584 X:31707453-31707475 CCCTGGGGACTACTAGAGGGAGG + Intronic
1188641032 X:32504742-32504764 CACTGCGGACTACTAGAGTGGGG + Intronic
1188701450 X:33269421-33269443 CACTGTGGACTACTAGAGTGGGG + Intronic
1188702173 X:33278338-33278360 CTCTGGGGACTACAATCGAGGGG - Intronic
1188726712 X:33593268-33593290 CACTGGGGCCTACTGCAGAGTGG + Intergenic
1188760307 X:34019814-34019836 CACTGTGGATTACTAGAGAGTGG + Intergenic
1189339500 X:40193925-40193947 CACTGGGGACTACTAGCGCGGGG + Intergenic
1189422737 X:40870988-40871010 CACTGGGGACTACTAGAAGGGGG - Intergenic
1189547841 X:42060908-42060930 CACTGGGGACTACTAGAGGGAGG - Intergenic
1189775173 X:44464187-44464209 TACTGGGGACTACTAGAGTGAGG + Intergenic
1189874650 X:45423245-45423267 CACTGGGGTCTACTAGAGGGAGG + Intergenic
1189926760 X:45962854-45962876 CACTGGGGCCTACTTGAGAGTGG + Intergenic
1190409669 X:50123885-50123907 CACTGGGGACTACTAGACAGGGG - Intergenic
1190444668 X:50511963-50511985 CACTGGGGACTGCTTGAGAGGGG - Intergenic
1190585190 X:51932755-51932777 CACTGTGGACTACTAGAGAATGG - Intergenic
1190897621 X:54636531-54636553 CACTGGGGACTACTAGAGGTGGG - Intergenic
1190965076 X:55291884-55291906 CACTGGGGCCTACCAAAGAGTGG - Intergenic
1190972871 X:55369063-55369085 CACTGGGGACTACTAGATGGGGG - Intergenic
1191195409 X:57715949-57715971 CACTGGGGACTATTAGAGGGTGG - Intergenic
1191697463 X:64004631-64004653 CACTGGGGACTACCAGAAAGGGG + Intergenic
1191968504 X:66787652-66787674 CACTGGGGCCTATTAGAGAGTGG + Intergenic
1192881635 X:75290780-75290802 CACTGGGGACTACTAAATGGGGG + Intronic
1192945193 X:75958727-75958749 CACTGAGGCCTACTACTGGGGGG - Intergenic
1193313452 X:80036610-80036632 CACTGGGGACTACTAGAGGAGGG - Intergenic
1193437487 X:81494335-81494357 CACTGGAGACTACTTGAGAGGGG - Intergenic
1193491595 X:82156670-82156692 CACTTGGGACTACTAAAGGGGGG - Intergenic
1193609131 X:83607209-83607231 CACTGGGGACTGCTAAAGGGGGG + Intergenic
1193631240 X:83890623-83890645 CATTGGGGACTACTTGAGAGTGG - Intergenic
1193746661 X:85290117-85290139 CACTGGGGACTACTGAAGGGTGG - Intronic
1193776420 X:85648324-85648346 CACTGGGGACTACTAGAGGGAGG + Intergenic
1193780082 X:85690816-85690838 CCCTGGGGACTACTAGTGGGAGG - Intergenic
1193840888 X:86406373-86406395 CAGTGGGGACTACTAGAGTGGGG + Intronic
1194279010 X:91923876-91923898 CACTGGAGACTACTAGAGTGGGG + Intronic
1194364194 X:92994526-92994548 CACTGGGGACTACCAGAGAAGGG + Intergenic
1194753694 X:97712511-97712533 CACTGGGGACTACTAGAAATAGG + Intergenic
1194942785 X:100032441-100032463 CACTGGGGCCTACCACAGGGTGG + Intergenic
1195058854 X:101174648-101174670 CACTGGGGACTACTAGAGGGGGG + Intergenic
1195575606 X:106446652-106446674 CACTGGGGACTACTGGAGGGGGG + Intergenic
1195909377 X:109874479-109874501 CACTGGGGACTACTTGAGGGTGG - Intergenic
1195930745 X:110072999-110073021 CAATGGGGACTACAAGAGAGGGG - Intronic
1195960942 X:110385824-110385846 CACTGGAGACTACTAGACAGGGG - Intronic
1196039742 X:111189080-111189102 CACTGGGGACTACTAGAGTGAGG - Intronic
1196040435 X:111197084-111197106 CACTGGGGCCTACTTGAGAGTGG - Intronic
1196976576 X:121164193-121164215 CACTGTGGACTACTGGAGAGTGG - Intergenic
1197045061 X:121986436-121986458 CACTGGGGCCTACTTGAGAGGGG + Intergenic
1197145939 X:123172390-123172412 CACTGGGGTCTACTAGAGAGGGG + Intergenic
1197336179 X:125211715-125211737 CACTGGGGACTCCAAAAGAGGGG - Intergenic
1197444792 X:126538748-126538770 CACTGGGGACTACTTGAGAGGGG - Intergenic
1197521614 X:127505494-127505516 CACTGGGGTCTACTAGAGTGGGG - Intergenic
1197576449 X:128218071-128218093 CACTGTGGACTACTAGAGGGAGG + Intergenic
1198106346 X:133465280-133465302 CACTGGGGACTGCTAGAGAGAGG - Intergenic
1198107039 X:133471643-133471665 CACTGGGGTCTACTTGAGAGTGG - Intergenic
1198200299 X:134409815-134409837 AACTGGGGACTACTAGAGGGAGG - Intronic
1198655733 X:138911447-138911469 CACTGGGGCCTACCAGAGAGTGG + Intronic
1198718051 X:139583584-139583606 CACTGGGGACTACTAGAGGGAGG + Intronic
1198787960 X:140312057-140312079 CACTGGGGACTACTAGAAGGGGG + Intergenic
1199216013 X:145261133-145261155 CACTGGAGACTACTAGAGTGGGG - Intergenic
1199414684 X:147567758-147567780 TACTGGGGACTACTAGAGGGGGG - Intergenic
1199449870 X:147967265-147967287 CACTGGGGACTACTGGCGGTGGG + Intergenic
1199560333 X:149155937-149155959 CACTGGGGACTACAAGAGAGGGG - Intergenic
1200672428 Y:6110791-6110813 CACTGGGGACTACTAGAGAAGGG + Intergenic
1201484168 Y:14474616-14474638 CACTGGGGACTACTAGAGGGAGG - Intergenic
1202300717 Y:23410948-23410970 CACTGGGGTCTACTTCAGGGTGG + Intergenic
1202570094 Y:26259650-26259672 CACTGGGGTCTACTTCAGGGTGG - Intergenic