ID: 976135405

View in Genome Browser
Species Human (GRCh38)
Location 4:81930842-81930864
Sequence GTTACACAATGCTCTACTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 119}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976135405_976135407 3 Left 976135405 4:81930842-81930864 CCAAAAGTAGAGCATTGTGTAAC 0: 1
1: 0
2: 0
3: 3
4: 119
Right 976135407 4:81930868-81930890 TAATGAATTTACTGTATTTATGG 0: 1
1: 0
2: 3
3: 45
4: 422

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976135405 Original CRISPR GTTACACAATGCTCTACTTT TGG (reversed) Intronic