ID: 976139311

View in Genome Browser
Species Human (GRCh38)
Location 4:81973742-81973764
Sequence TGCTTCTCATGTCAGTTCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 158}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976139308_976139311 6 Left 976139308 4:81973713-81973735 CCATGAGATTCTGAAAGAAGGAA 0: 1
1: 0
2: 3
3: 34
4: 395
Right 976139311 4:81973742-81973764 TGCTTCTCATGTCAGTTCTAGGG 0: 1
1: 0
2: 2
3: 16
4: 158
976139306_976139311 25 Left 976139306 4:81973694-81973716 CCTTTATGATCTTTATATTCCAT 0: 1
1: 0
2: 3
3: 53
4: 538
Right 976139311 4:81973742-81973764 TGCTTCTCATGTCAGTTCTAGGG 0: 1
1: 0
2: 2
3: 16
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976139311 Original CRISPR TGCTTCTCATGTCAGTTCTA GGG Intronic
900672603 1:3865145-3865167 TGCTTTTGATGTTAGGTCTAAGG + Intronic
901092346 1:6650303-6650325 TGCTTCTAATCTCAGTGCTTTGG + Intronic
903916571 1:26769063-26769085 TGCTTCTCATGCCAGTTATGTGG - Intronic
905485199 1:38291221-38291243 TGGTTCTGATGTCAGTGCTTTGG - Intergenic
907716152 1:56928075-56928097 TCCTTCTGATGGCTGTTCTATGG + Intergenic
908176797 1:61564058-61564080 TGCTTATAATCTCAGTACTATGG + Intergenic
912658830 1:111510727-111510749 TCCTTCTAATGTGAGTTCTATGG - Intronic
913252509 1:116923717-116923739 TGCTTGTCATCACTGTTCTAGGG + Intronic
920733053 1:208506139-208506161 TGCTTTTGATGTCATATCTAAGG - Intergenic
922855531 1:228772125-228772147 TGGTTCTCCTGTCTGTTCTTAGG + Intergenic
923759976 1:236833247-236833269 TGCTTCTTATGCCTATTCTATGG + Intronic
924033979 1:239917142-239917164 TGGTTTTCATTTCAGTTATATGG + Intergenic
1069412145 10:68164610-68164632 TGTTTTTAATGTCAGTTCAATGG + Intronic
1071426258 10:85556823-85556845 TGATTTTCATTTCAATTCTAAGG - Intergenic
1075832530 10:125423670-125423692 TGCTTCTCCTTTCAAGTCTAAGG + Intergenic
1078767717 11:14315354-14315376 TTCTTCTCATGACAGGTGTAGGG - Intronic
1081735516 11:45400888-45400910 TCCTTCTCATCTCAGTTCTGCGG - Intergenic
1081768185 11:45627414-45627436 TCCTTCGCAAGTCTGTTCTATGG - Intergenic
1085115133 11:73924728-73924750 TGATTCTCATGAGAGATCTAGGG + Intronic
1088768816 11:113012558-113012580 TGCTTCCCTTGACAGCTCTAGGG + Intronic
1090974225 11:131668094-131668116 TTCTTCTCATGTGAGTTGCAAGG - Intronic
1092062963 12:5565770-5565792 TGCTTCTCAAGTCAATGCCAAGG - Intronic
1092832786 12:12461430-12461452 TGCTTGTCATCTCAGTACTTTGG - Intronic
1093104261 12:15066627-15066649 TGCTGATGATGCCAGTTCTAGGG - Intergenic
1094454608 12:30618780-30618802 TGCTTCCCATCTCTTTTCTAAGG - Intergenic
1095946154 12:47754754-47754776 TGCTAGTCATGTCAGTTTCAGGG + Intronic
1098536966 12:71604015-71604037 TGCTTCTGTTTTCAGTTCTGAGG - Intergenic
1100195795 12:92242940-92242962 TGTTACTGTTGTCAGTTCTATGG - Intergenic
1100684001 12:96965675-96965697 TGCTTTTGATGTCATATCTAAGG - Intergenic
1104178460 12:126355015-126355037 TGTTTCTCATGTAGGTTCTAGGG + Intergenic
1104506755 12:129339349-129339371 TTCTTCTCATCTCATTTCTCCGG - Intronic
1104820577 12:131675169-131675191 TGCATTTCATGTAAGTTCTGGGG + Intergenic
1106532082 13:30602609-30602631 TGCTACTCATATAAATTCTAAGG - Intronic
1107456297 13:40558467-40558489 TGGTTCTCATGTGAATTCTGTGG + Exonic
1110627919 13:77672306-77672328 TGCTTCTTTTATCAGTTCTAGGG - Intergenic
1115180256 14:30617170-30617192 TGCTTGTAATCTCAGTTATAAGG + Exonic
1116489626 14:45490821-45490843 TGATACTCATGTCAGTTTTCTGG + Intergenic
1118203653 14:63701242-63701264 TGCCTCTCATCTCAGTACTGTGG - Intronic
1121901895 14:97700461-97700483 GGATTTTCATCTCAGTTCTATGG - Intergenic
1123858532 15:24437973-24437995 TGCTTCACATGTCAAATCAAGGG - Intergenic
1123863171 15:24488398-24488420 TGCTTCACATGTCAAATCAAGGG - Intergenic
1126174809 15:45725837-45725859 TGTTTCTGATTTTAGTTCTAAGG + Intergenic
1126817233 15:52466064-52466086 TGCTCCGCATGTTAGATCTAGGG - Intronic
1126821616 15:52510020-52510042 TGCATCTGATGTCACTGCTATGG + Intronic
1132413514 15:101603913-101603935 TGCTTATCATGTCTGTTGTTTGG + Intergenic
1133300445 16:4779278-4779300 TCCTTGTCCTGTCAGCTCTATGG + Intronic
1135906547 16:26517261-26517283 TGCCTCTAATCTCAGTTCTTTGG - Intergenic
1140280437 16:73549881-73549903 TGCTTCTCATGTAATTTTGATGG - Intergenic
1141829483 16:86501752-86501774 TGGTCCTCATGTCAGCTCTGTGG + Intergenic
1142956957 17:3528979-3529001 AGCATCTCATGCCGGTTCTAGGG + Exonic
1143282185 17:5763164-5763186 GTCTTCTCAGGACAGTTCTAGGG - Intergenic
1144325687 17:14177599-14177621 TGCTTTTTATGTCAGCTCTGGGG + Intronic
1144474561 17:15574487-15574509 TGCTTTTTATGTCAGCTCTGGGG + Intronic
1146762302 17:35489120-35489142 TGATTCTCACGCCAGCTCTAAGG + Intronic
1147491539 17:40871978-40872000 TGCTTCTGTTTTCATTTCTATGG - Intergenic
1148484582 17:47982458-47982480 TGCTTGTTATCTCAGTTCTGGGG + Intergenic
1149357459 17:55856545-55856567 TTCTTCTCATTTCAGTTTTGGGG + Intergenic
1150786370 17:68166234-68166256 GGCTCCTCTTGTCAGCTCTAAGG + Intergenic
1154098255 18:11441322-11441344 TGCTTTTCATGTCACTTGAATGG + Intergenic
1156496262 18:37527245-37527267 CACTTCTCAGGTCAGTTCTATGG - Intronic
1160113916 18:76059129-76059151 TGCTTCTCATGGGGGCTCTAGGG - Intergenic
1160198894 18:76779856-76779878 TGCATCTCCTGACAGTTCTGTGG - Intergenic
1167732107 19:51265873-51265895 TCCCTCTCATGTGAGTACTAGGG + Exonic
926548697 2:14274088-14274110 TGATTCTCAAGTGAGTTCTTTGG + Intergenic
930300985 2:49615352-49615374 TGCTCCTCATACCACTTCTAGGG + Intergenic
930605157 2:53486130-53486152 TGCTTCACCTCTCAGTACTAGGG - Intergenic
930899006 2:56481033-56481055 TTCTTCTCAAGGCAGTTATATGG + Intergenic
931506591 2:62934582-62934604 AGTTCCTCATGTCAGTTCTAAGG + Intronic
932914512 2:75841435-75841457 AGCTTCTCTGGTCATTTCTACGG + Intergenic
934732624 2:96669141-96669163 AGCTTCTCACATCAGCTCTAGGG + Intergenic
935026532 2:99282499-99282521 CACTTCTCTTGTCTGTTCTAGGG + Intronic
936072600 2:109381318-109381340 TGCTTCTCCTGTCACTCATATGG + Intronic
936502837 2:113079833-113079855 CACAACTCATGTCAGTTCTAGGG + Intergenic
939457752 2:142460408-142460430 TGGTTCAAATGTCAGTTCCATGG - Intergenic
939763304 2:146211941-146211963 TTATTCTCATGACAGTACTATGG + Intergenic
942613232 2:177763385-177763407 TGCATCTCGGGTCATTTCTAAGG - Intronic
943485094 2:188469275-188469297 TGCATCTCATCTAAGTTATATGG + Intronic
943594840 2:189844004-189844026 TGGCTCTCATGTCAGTTCTGGGG + Exonic
944195028 2:197043466-197043488 TGCTTGTCATCTCAGTGCTTTGG - Intronic
945975593 2:216268081-216268103 TGCTTCTCATGTCAGTTTTGTGG + Intronic
1173893101 20:46528671-46528693 GGCTCCTTATGTCACTTCTAGGG - Intergenic
1176660721 21:9632842-9632864 TGTTTTTTATGCCAGTTCTAGGG + Intergenic
949737379 3:7189109-7189131 GGCTTCTCCTGTCACTGCTATGG - Intronic
953003877 3:38959550-38959572 TCATTCACATGTCAGTCCTACGG + Intergenic
954132102 3:48566180-48566202 TGCTTGCCCTGTAAGTTCTAGGG + Intronic
954150649 3:48655539-48655561 TGTTTCTCCTGTCTGTTCAAAGG - Intronic
956437394 3:69247197-69247219 TGATTCTCATGACAGTTTTATGG + Intronic
958777362 3:98502359-98502381 TACTTCTCATGTTAATTCTCTGG - Intronic
959040643 3:101419614-101419636 TGCTTCTCATGTCTATTTTCAGG - Intronic
959177124 3:102927352-102927374 TGCTTCTCAGAGAAGTTCTAAGG - Intergenic
960201764 3:114845461-114845483 TGCTTTACATTTAAGTTCTATGG - Intronic
960422074 3:117459215-117459237 TCCTTCTCATGTGTGTTTTAGGG - Intergenic
960464854 3:117985078-117985100 TGCTTTTGGTGTCAGTTTTAAGG - Intergenic
962376164 3:134860478-134860500 TGCTTCTTATGCCAGTGTTAGGG - Intronic
963072207 3:141313476-141313498 AGCTGCTCAGGGCAGTTCTATGG - Intergenic
964446424 3:156764040-156764062 TGCTTCTCATTTCAGATGCATGG + Intergenic
965080608 3:164025965-164025987 TGCTTTTCTTGCCAGTTCTGTGG + Intergenic
966296999 3:178435651-178435673 TGCTTCTCATGTCAGCACTATGG + Intronic
966402781 3:179563606-179563628 CGCTTCCCTAGTCAGTTCTACGG - Intronic
966811147 3:183846046-183846068 TGCTTCCTCTGTCAGTTCCATGG + Intronic
970012450 4:11474334-11474356 TCCTTAACATGTCACTTCTAAGG - Intergenic
970066191 4:12096262-12096284 TGCTTATCATGTAAGTACAAGGG - Intergenic
970615308 4:17763300-17763322 GGATTCTAATGTCAATTCTATGG - Intronic
970676477 4:18455943-18455965 TGCTTCTCTGTTCAGTTCTCTGG - Intergenic
976139311 4:81973742-81973764 TGCTTCTCATGTCAGTTCTAGGG + Intronic
976469155 4:85407198-85407220 TGCTTCTACTCTCAGATCTAGGG + Intergenic
976723039 4:88188471-88188493 TGCTTCTAATCTCAGTTCTTTGG - Intronic
977292421 4:95178209-95178231 TAGTTCTCATGCCATTTCTAAGG + Intronic
977357047 4:95959636-95959658 TGTTTCTAAGGTCATTTCTATGG + Intergenic
978006600 4:103625045-103625067 TTCTTCTGAAGTCAGTTCTGAGG - Intronic
978700243 4:111634596-111634618 TTCTTCTCATGTCAGCTCCCAGG - Intergenic
982027039 4:151261255-151261277 TGCTTCTCTTCTCAGGTCTAAGG + Intronic
983545164 4:168955727-168955749 TGCACTTGATGTCAGTTCTAAGG - Intronic
985414641 4:189723573-189723595 TGTTTTTTATGCCAGTTCTAGGG - Intergenic
987503921 5:18746023-18746045 TACTTCTTATCTCATTTCTAGGG - Intergenic
988056084 5:26098900-26098922 TGCCTCACTTGTCAGTTCTGAGG + Intergenic
988232305 5:28495709-28495731 TGTTTCTCATGTCTGCTCCAGGG - Intergenic
989334110 5:40294549-40294571 TGCTTCTCTTGACACTTCTCCGG - Intergenic
989451530 5:41592135-41592157 TGCTGCTCATGTCAGGTCTGTGG - Intergenic
990594310 5:57297803-57297825 TGCTTATCAGGTAAGTTCCAGGG - Intergenic
991411763 5:66352790-66352812 TGACTCTCATGTCATTTCAAGGG + Intergenic
992656563 5:78916220-78916242 AGCTTCCCATGCAAGTTCTAAGG + Intronic
993068018 5:83125323-83125345 TGCTTCTGGTGTCATGTCTAAGG + Intronic
993824848 5:92670431-92670453 TATTTCTCATGGCAGTTGTAAGG - Intergenic
997804041 5:136896314-136896336 CACTTCTCATGTTAGTTTTAGGG + Intergenic
998434950 5:142100244-142100266 TGATTCTGAGGTCACTTCTAAGG - Intergenic
999366291 5:151025862-151025884 TGCTTCTCTTGGCAGCTCTCTGG + Intronic
1001222160 5:169910368-169910390 TGCATCTCAAGACAGTTCGATGG + Intronic
1002139457 5:177130252-177130274 TGATTCTTATCTCAGTCCTAAGG + Intergenic
1002215274 5:177627381-177627403 TGCTTCTCATGAAAATTCAACGG - Intergenic
1002558503 5:180063090-180063112 GACTTCTGATGTCCGTTCTAAGG + Intronic
1003404157 6:5814942-5814964 TGCCTCTGATCTCAGTTCTGTGG - Intergenic
1003528408 6:6917397-6917419 TGCTACTCATTTCACTTCTGTGG - Intergenic
1003922497 6:10846387-10846409 TGCTTCTAATCCCAGTACTATGG - Intronic
1004349630 6:14879792-14879814 ATCTTCTGATCTCAGTTCTAAGG - Intergenic
1004672380 6:17809871-17809893 TGCGTCTTCTGTCATTTCTAAGG - Intronic
1006247847 6:32756163-32756185 TGCTTCTCTTGACAGGTCTGTGG + Exonic
1007177643 6:39907766-39907788 TGCATCTCTTGTGAGTTCTCAGG - Intronic
1009581548 6:65540959-65540981 TGATACTTATGTCAGTTTTATGG - Intronic
1012022519 6:93942774-93942796 TGCTTCTTCTGTCAGTTCTTGGG + Intergenic
1015172478 6:130269002-130269024 TGCTTTTGATGTCAGGTCTGAGG + Intronic
1016788787 6:148044061-148044083 TACTTCTCATGGCAGTGCTGGGG + Intergenic
1016860891 6:148717664-148717686 TCCCTCTCAAGTCAGTGCTAAGG - Intergenic
1016931758 6:149418068-149418090 TGCTTCTAATACTAGTTCTAGGG - Intergenic
1018484933 6:164231320-164231342 TGCATGTGATGTCAGTTCTGTGG + Intergenic
1018520645 6:164646526-164646548 TGTTTTTCACCTCAGTTCTATGG + Intergenic
1022747945 7:33191511-33191533 GGCCTCTCCTGTCAGTTCTAAGG - Intronic
1022885703 7:34641322-34641344 TGCTTCTGATACCAGTTCCAGGG + Intergenic
1028646670 7:93105609-93105631 TGATACACATGTCAGGTCTATGG + Exonic
1028969721 7:96845142-96845164 TGCTTTTCATGTCATGTTTAAGG - Intergenic
1029639964 7:101814669-101814691 TGCTTTTCAAGTGAGTTCGAGGG - Intergenic
1030453454 7:109743324-109743346 TGCTTCTCACTTCCATTCTATGG + Intergenic
1030579457 7:111335102-111335124 TGCTTCTTATGCCAGTGTTAAGG - Intronic
1038865878 8:31438446-31438468 TGATTCTGAAGTCAGTCCTAGGG - Intergenic
1040559190 8:48508834-48508856 TGCTTCTCCTGTCATTTCACAGG - Intergenic
1040579612 8:48686928-48686950 TGTTTCTCATAACATTTCTATGG + Intergenic
1042522150 8:69724964-69724986 TGGTTCTCCTGTCATTTATATGG + Intronic
1042538829 8:69887142-69887164 TGCTTCTGATTGCATTTCTAAGG - Intergenic
1043176529 8:77028692-77028714 TGCCCACCATGTCAGTTCTAGGG - Intergenic
1043327175 8:79066863-79066885 TGCTTTTCATATAAGCTCTAGGG - Intergenic
1047620231 8:126598857-126598879 AGCTGCAAATGTCAGTTCTATGG + Intergenic
1048638137 8:136322516-136322538 TGCTTCTCACTGCAGTTCTGAGG + Intergenic
1051581100 9:18675341-18675363 TTCTTCTCTTGGCAGATCTAGGG - Intronic
1052436567 9:28437302-28437324 GGCTGCTCGTGTAAGTTCTAGGG - Intronic
1052636359 9:31110866-31110888 TGCTTCTCATTTCAGTTGCAAGG - Intergenic
1059474259 9:114531545-114531567 TGCTTCTAATGACAGTGTTAGGG + Intergenic
1059494087 9:114695130-114695152 TGCTTCTCAGTTCAGTTCTCAGG - Intergenic
1059773396 9:117449322-117449344 AGCTTCTCATGTCATTTGGAAGG - Intergenic
1060506201 9:124200096-124200118 TTCTTCTCATGGCAGGTCTCAGG - Intergenic
1188781099 X:34286355-34286377 TTCCTCTCTTGTCTGTTCTAAGG - Intergenic
1189786072 X:44559826-44559848 TGATTTTCATAGCAGTTCTAGGG - Intergenic
1189811033 X:44780809-44780831 CGATTCTCATGTCAGTTGTCTGG + Intergenic
1199261415 X:145779751-145779773 TGGCTCTCATTTCAGTTCAAAGG + Intergenic
1199752098 X:150829781-150829803 TAGTTCTCATGTCAGTTAGAAGG + Intronic
1201572109 Y:15425634-15425656 TGCTTCTAATGTGTGTTCTTTGG - Intergenic
1202347001 Y:23941668-23941690 TGCTTCTCTTGTACTTTCTAAGG + Intergenic
1202523770 Y:25728422-25728444 TGCTTCTCTTGTACTTTCTAAGG - Intergenic