ID: 976141547

View in Genome Browser
Species Human (GRCh38)
Location 4:81998469-81998491
Sequence GACTCACTCATTCTGCCCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 122}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976141547_976141552 25 Left 976141547 4:81998469-81998491 CCAATGGGCAGAATGAGTGAGTC 0: 1
1: 0
2: 2
3: 7
4: 122
Right 976141552 4:81998517-81998539 ACTTTGCTGGGTATCAAGCCTGG No data
976141547_976141551 13 Left 976141547 4:81998469-81998491 CCAATGGGCAGAATGAGTGAGTC 0: 1
1: 0
2: 2
3: 7
4: 122
Right 976141551 4:81998505-81998527 TGACTAAAAGAAACTTTGCTGGG 0: 1
1: 0
2: 4
3: 17
4: 253
976141547_976141550 12 Left 976141547 4:81998469-81998491 CCAATGGGCAGAATGAGTGAGTC 0: 1
1: 0
2: 2
3: 7
4: 122
Right 976141550 4:81998504-81998526 ATGACTAAAAGAAACTTTGCTGG 0: 1
1: 0
2: 3
3: 24
4: 280
976141547_976141553 26 Left 976141547 4:81998469-81998491 CCAATGGGCAGAATGAGTGAGTC 0: 1
1: 0
2: 2
3: 7
4: 122
Right 976141553 4:81998518-81998540 CTTTGCTGGGTATCAAGCCTGGG 0: 1
1: 0
2: 2
3: 7
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976141547 Original CRISPR GACTCACTCATTCTGCCCAT TGG (reversed) Intronic
900783419 1:4632444-4632466 GACTCACTCATGCTGTGCCTCGG + Intergenic
903396608 1:23006413-23006435 GACTCACTGATTATGCCCTCTGG - Intergenic
909487397 1:76189115-76189137 GTCTTACTCCTTCTTCCCATAGG + Intronic
914909764 1:151775482-151775504 GACTCACTCATTGTGCTGACTGG - Exonic
916075799 1:161199433-161199455 GGCTCCCTCATGCTGCCCTTTGG + Exonic
922596041 1:226813914-226813936 TACTGACTCTTTCTGCCCTTGGG + Intergenic
922902029 1:229144658-229144680 GACTGGCACATTCAGCCCATGGG + Intergenic
1064381229 10:14843448-14843470 GACACACCCAGTCTGGCCATGGG - Intronic
1068042202 10:51839509-51839531 GACTCACTGATTTTGCATATGGG + Intronic
1069482572 10:68797141-68797163 GACTCAAGCATTCTGCTCCTTGG - Intergenic
1070770699 10:79080766-79080788 GACCCACTCCTTCTGCCTAAAGG - Intronic
1072522910 10:96244754-96244776 GTTTCATACATTCTGCCCATTGG - Intronic
1072628489 10:97129733-97129755 CACTCCCTCATCCTGCCCACAGG + Intronic
1073067166 10:100769065-100769087 GACTGACTCATTCTACTCAATGG + Intronic
1074366829 10:112864649-112864671 GACTCATTTCTTCTGCCCAAGGG + Intergenic
1076655784 10:132022494-132022516 GCCTCACTGCTGCTGCCCATGGG - Intergenic
1077775603 11:5268411-5268433 GACACCCTCCTTCTGCACATGGG - Exonic
1078363541 11:10688597-10688619 GCCTCTCTCATTGAGCCCATTGG + Intronic
1084952390 11:72673932-72673954 GACACCCTCATTCTGCTCAGAGG + Intronic
1087765318 11:102145838-102145860 TGCTCACTCATTTTGCTCATTGG + Intronic
1090332424 11:125942354-125942376 GGCTCACTCAGTCTGGCCAGGGG - Intergenic
1091023606 11:132122908-132122930 GACTCACTCATTCATCTAATTGG + Intronic
1092438690 12:8476790-8476812 TACTCACTCATTTTGATCATGGG - Intronic
1094163286 12:27415116-27415138 GACTTACTCATTCTACCTAATGG - Intronic
1097807166 12:63978718-63978740 GACTCAGCCATTCTGCTCCTAGG - Intronic
1099153078 12:79139824-79139846 GACTCACTCATTCTGCTCAGTGG - Intronic
1101856847 12:108450949-108450971 GAATCAATCACTCTGCCCAGAGG + Intergenic
1105682610 13:22744880-22744902 GACTCACACAAACTGCCTATAGG - Intergenic
1106209425 13:27627759-27627781 CACTCACCCATTCTGCACACAGG - Intronic
1107618636 13:42200527-42200549 GACTCACTGTTTATGCCGATGGG + Intronic
1109051597 13:57489574-57489596 AACTCACTCATTCAGGCCACAGG - Intergenic
1110757934 13:79197966-79197988 GACTCAATCATTTTCACCATTGG - Intergenic
1110989042 13:82013352-82013374 GACACAAACATTCAGCCCATTGG - Intergenic
1113014626 13:105814680-105814702 GGCTCAGTCATTATGCCCTTAGG + Intergenic
1117412699 14:55465503-55465525 GAAGCAATCATTCTTCCCATGGG - Intergenic
1117789179 14:59320938-59320960 GACTCAATAATTCTGCTCCTCGG + Intronic
1118471528 14:66079312-66079334 GACTCACTTATTTTCCTCATCGG - Intergenic
1119368563 14:74117591-74117613 GAATGACTGTTTCTGCCCATGGG + Intronic
1119856093 14:77902052-77902074 GACTCTCTCATTCTTCCCTAAGG + Intronic
1120973250 14:90227082-90227104 GACTCACTCATTCTACTTCTAGG + Intergenic
1122818031 14:104323645-104323667 GCCTCACCCCTCCTGCCCATGGG + Intergenic
1122918493 14:104869716-104869738 GGCTCACCCCTTCTGCCCAGTGG + Intronic
1129206536 15:74040482-74040504 GACTCTCCCATTCTGCCCCCAGG - Intronic
1129425157 15:75457246-75457268 CAGGCCCTCATTCTGCCCATTGG - Intergenic
1131590208 15:93740588-93740610 GACTTAGCCATTCTACCCATGGG - Intergenic
1132259574 15:100410572-100410594 GACTCACTCATTCAGAGCACTGG + Intronic
1132861152 16:2072429-2072451 GTCTCACTCGCTCTGCCCAGAGG - Intronic
1137621673 16:49880467-49880489 GCCTCACTCACTTTGGCCATGGG - Intergenic
1137790071 16:51167508-51167530 GACTCCCTCGTGCTGCCCATTGG + Intergenic
1140536451 16:75714282-75714304 GACTCACCCCTTCTGCCTCTGGG - Intronic
1140632801 16:76873944-76873966 GGCTCTCTCATTCTTCTCATGGG - Intergenic
1144835439 17:18154343-18154365 GGCTCACTGACCCTGCCCATGGG - Intronic
1146563102 17:33888632-33888654 GACTCACTCCTTTGGCCCCTGGG - Intronic
1148660029 17:49322938-49322960 GAATCAATCATTTTGCCGATGGG + Intronic
1153140339 18:1965019-1965041 GACTAAACCATTCTGCCTATTGG - Intergenic
1156421990 18:36964021-36964043 GATTCATTCATTCTGCCTCTGGG - Intronic
1157466393 18:47950091-47950113 GAATCACTCACTATCCCCATTGG + Intergenic
1163148301 19:15397099-15397121 GCCTCACTCAATCTACCCACAGG + Intronic
1163523739 19:17807838-17807860 GCCACCCTCATTCTGGCCATCGG + Exonic
1163981706 19:20906787-20906809 TACTCACTCATTCATCACATTGG + Intergenic
1164964012 19:32464444-32464466 GACTCAGTTATTCTGCATATTGG + Intronic
925927291 2:8679302-8679324 GACTCACTCACTCCGCCTCTAGG - Exonic
928031169 2:27780783-27780805 GACTTACTTATTCAGCCCATGGG + Intronic
932281478 2:70496575-70496597 GACTTACTAATTCTGACCTTGGG + Intronic
934707390 2:96493237-96493259 CTCTCACTGATCCTGCCCATGGG + Intergenic
944303004 2:198145989-198146011 CACTCAGTCATTCAGCCCTTGGG + Intronic
946199354 2:218062768-218062790 GGCTCCCTGATTCTCCCCATGGG + Intronic
946885662 2:224220009-224220031 GACTCATTCATTCATCCCACAGG + Intergenic
1170476388 20:16719024-16719046 GGCTCAAGCATTCTCCCCATCGG - Intergenic
1173731624 20:45332922-45332944 CCCTCACTTATTCTGCCTATGGG + Intronic
1173868160 20:46326056-46326078 GACTCTTTCAGTCTGCCCACTGG + Intergenic
1179382005 21:40908451-40908473 GGCTCTCTCATTCTCCCCAGTGG + Intergenic
1182006584 22:26965221-26965243 TATTCTCTCATCCTGCCCATTGG - Intergenic
1183027908 22:35079962-35079984 GAGTCTCCCATTCTGCCAATGGG + Intronic
1184957780 22:47903186-47903208 GCCTCACAACTTCTGCCCATAGG + Intergenic
949655110 3:6209033-6209055 CACTCACTCATTCTGCCAGTTGG + Intergenic
949898654 3:8791929-8791951 GCCTCCCTCACTCTGCCCCTTGG + Intronic
950528884 3:13540866-13540888 GACTCACTCATGCTGCCTGGGGG + Intergenic
951883852 3:27505081-27505103 AACTTTCTCATTCTGCCCTTTGG - Intergenic
954426794 3:50447606-50447628 GGCTCACTCAGTCCGCCCCTGGG + Intronic
965420086 3:168447346-168447368 GACTCCCTCACTCTGCTCGTTGG - Intergenic
967637519 3:191820753-191820775 GATTCACTCATTCTCCTCTTTGG + Intergenic
969513255 4:7631697-7631719 GACTGACTCATTCAGTCCATAGG - Intronic
972632780 4:40856792-40856814 GCCTCACTCCTTCTTCCCACCGG + Intronic
972763753 4:42132310-42132332 GACTCACTCTCTCTTCCCTTGGG - Intronic
972934735 4:44119486-44119508 GACTCACTCCCTTTGCTCATTGG - Intergenic
974727414 4:65813967-65813989 GACTCATGAATTCTGGCCATGGG - Intergenic
975068794 4:70105441-70105463 TAGTAACTCATTCTCCCCATTGG - Intergenic
975481476 4:74885409-74885431 GACTCCTTCACTCTGCCCATTGG - Intergenic
975937281 4:79597456-79597478 GAGTCACTCATTTTCCCCTTGGG + Intergenic
976141547 4:81998469-81998491 GACTCACTCATTCTGCCCATTGG - Intronic
978064629 4:104381223-104381245 GACCCAAACATTTTGCCCATAGG - Intergenic
978811736 4:112856889-112856911 GACCCCCTAATTCTGCTCATTGG - Intronic
981901730 4:149873320-149873342 GACCCAGTCATTCCACCCATAGG - Intergenic
985426766 4:189839208-189839230 GACTCACTGCTTCTGTCCATTGG - Intergenic
987688423 5:21235133-21235155 GACTCAATCATTCTGTCTTTAGG - Intergenic
987884380 5:23794664-23794686 GACTTACTAAATCTGCTCATGGG - Intergenic
990347320 5:54883670-54883692 GAATCATTCATTCTGCTCGTAGG + Intergenic
996112196 5:119579105-119579127 AACTCACTCACTCTGCCCCCTGG - Intronic
998117709 5:139550705-139550727 GAGTTACTCATTCCTCCCATGGG - Intronic
1000146026 5:158454267-158454289 ACTTCACTCATTTTGCCCATTGG + Intergenic
1002349472 5:178573459-178573481 GAGTCACTCAGTGTGCCAATGGG - Intronic
1003085974 6:3061923-3061945 GACTCACCAATTCTACCCACTGG + Intergenic
1007749220 6:44061993-44062015 GACTCACTGATTCTGCTTCTGGG + Intergenic
1012397804 6:98820001-98820023 GACTCCTGCATTCTGGCCATGGG - Intergenic
1013644775 6:112125678-112125700 GATTCAGTAATTCTGCCCCTGGG + Intronic
1014097731 6:117478886-117478908 GACTCCCTCACCCTGCCCACTGG + Intronic
1014291983 6:119569629-119569651 GACCCACTAATTCTTCCCTTAGG + Intergenic
1018093210 6:160363101-160363123 GACCCTCTCTTTCTGCCCCTCGG - Intronic
1019385287 7:752080-752102 GACGCTCTCGTTCTGCTCATCGG - Intronic
1023991449 7:45131184-45131206 GACACGCTCATCCTGCCCACTGG + Intergenic
1028522122 7:91742928-91742950 GAATCACTCATTCCAGCCATTGG - Intronic
1031638391 7:124130644-124130666 CACTCTCTCACTCTACCCATTGG - Intergenic
1033708066 7:143907569-143907591 CACTCACTCATTCTGCCAAAGGG - Intergenic
1036709114 8:11067037-11067059 GCCTCACTCATCCTGCCCTCAGG - Intronic
1038911776 8:31972743-31972765 GACTCACTCATTCATACCAACGG + Intronic
1047422706 8:124720312-124720334 GACTGCCACATTCGGCCCATGGG + Intronic
1049069817 8:140347626-140347648 GACCCCCTCACTCTGCTCATTGG + Intronic
1054953856 9:70885422-70885444 GACTAACTCATTCTTCCCTAAGG - Intronic
1055068290 9:72141059-72141081 GAATCACTCATTCTCCCCCATGG - Intronic
1056255806 9:84798342-84798364 GACACACACATTCAGACCATAGG + Intronic
1059388170 9:113981417-113981439 TGCTCACTCATTGTGCACATTGG + Intronic
1059749505 9:117234708-117234730 GACTCTTTCATTCTGCACAAGGG + Intronic
1189302563 X:39962765-39962787 GACACAAACATTCAGCCCATAGG + Intergenic
1189639801 X:43056026-43056048 GACTTCCTCATTCTTCTCATTGG - Intergenic
1191783690 X:64894898-64894920 GACACACTCATTCTGCCATCTGG - Intergenic
1193410548 X:81157649-81157671 GACTAGGTCATTCTGTCCATAGG - Intronic
1193646638 X:84078419-84078441 GACTCAATCATTCTGCTCATAGG + Intronic
1195084604 X:101402370-101402392 GACCCCCTCAATCTGCTCATTGG + Intronic
1197531633 X:127635421-127635443 GACTCCCTCACTGTGCTCATTGG + Intergenic
1198152747 X:133927010-133927032 GACTGGCTCTTTCTGCACATTGG + Intronic
1199307094 X:146279574-146279596 GACTTACTCATTCCACCCTTTGG - Intergenic