ID: 976146794

View in Genome Browser
Species Human (GRCh38)
Location 4:82049949-82049971
Sequence CTGGGAGGAGGGAGAATTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976146794_976146800 9 Left 976146794 4:82049949-82049971 CCTACAATTCTCCCTCCTCCCAG No data
Right 976146800 4:82049981-82050003 CACACCGTATAGAGTTACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976146794 Original CRISPR CTGGGAGGAGGGAGAATTGT AGG (reversed) Intergenic
No off target data available for this crispr