ID: 976149092

View in Genome Browser
Species Human (GRCh38)
Location 4:82075287-82075309
Sequence AATCCAGGTTGAGTTCCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976149088_976149092 19 Left 976149088 4:82075245-82075267 CCTGCAGCATAATGAGGAAATCT No data
Right 976149092 4:82075287-82075309 AATCCAGGTTGAGTTCCCACTGG No data
976149086_976149092 26 Left 976149086 4:82075238-82075260 CCTAGTACCTGCAGCATAATGAG No data
Right 976149092 4:82075287-82075309 AATCCAGGTTGAGTTCCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976149092 Original CRISPR AATCCAGGTTGAGTTCCCAC TGG Intergenic
No off target data available for this crispr