ID: 976161223

View in Genome Browser
Species Human (GRCh38)
Location 4:82201496-82201518
Sequence CTGCAGTCCATGGGCAAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976161214_976161223 22 Left 976161214 4:82201451-82201473 CCCTGGAGTCCTGAATAAATATG No data
Right 976161223 4:82201496-82201518 CTGCAGTCCATGGGCAAGTCTGG No data
976161215_976161223 21 Left 976161215 4:82201452-82201474 CCTGGAGTCCTGAATAAATATGA No data
Right 976161223 4:82201496-82201518 CTGCAGTCCATGGGCAAGTCTGG No data
976161217_976161223 13 Left 976161217 4:82201460-82201482 CCTGAATAAATATGAAAGGCAGT No data
Right 976161223 4:82201496-82201518 CTGCAGTCCATGGGCAAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976161223 Original CRISPR CTGCAGTCCATGGGCAAGTC TGG Intergenic
No off target data available for this crispr