ID: 976161741

View in Genome Browser
Species Human (GRCh38)
Location 4:82208660-82208682
Sequence GAGAATTAACTTGCAAAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976161738_976161741 2 Left 976161738 4:82208635-82208657 CCTTGTTATTATTCTCATTTAGA No data
Right 976161741 4:82208660-82208682 GAGAATTAACTTGCAAAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976161741 Original CRISPR GAGAATTAACTTGCAAAGAA GGG Intergenic
No off target data available for this crispr