ID: 976163125

View in Genome Browser
Species Human (GRCh38)
Location 4:82225054-82225076
Sequence CAGATGAAGGAGCAGTGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976163125_976163131 10 Left 976163125 4:82225054-82225076 CCAGACCACTGCTCCTTCATCTG No data
Right 976163131 4:82225087-82225109 GAGAGAGAAGACACAATTCAGGG No data
976163125_976163130 9 Left 976163125 4:82225054-82225076 CCAGACCACTGCTCCTTCATCTG No data
Right 976163130 4:82225086-82225108 GGAGAGAGAAGACACAATTCAGG No data
976163125_976163132 21 Left 976163125 4:82225054-82225076 CCAGACCACTGCTCCTTCATCTG No data
Right 976163132 4:82225098-82225120 CACAATTCAGGGCCCCTGTCAGG No data
976163125_976163133 28 Left 976163125 4:82225054-82225076 CCAGACCACTGCTCCTTCATCTG No data
Right 976163133 4:82225105-82225127 CAGGGCCCCTGTCAGGATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976163125 Original CRISPR CAGATGAAGGAGCAGTGGTC TGG (reversed) Intergenic
No off target data available for this crispr