ID: 976171999

View in Genome Browser
Species Human (GRCh38)
Location 4:82313810-82313832
Sequence CCACCATGTAAGGACCTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976171995_976171999 -8 Left 976171995 4:82313795-82313817 CCTCCAGTTTCGGGTCCACCATG No data
Right 976171999 4:82313810-82313832 CCACCATGTAAGGACCTTGAAGG No data
976171994_976171999 -7 Left 976171994 4:82313794-82313816 CCCTCCAGTTTCGGGTCCACCAT No data
Right 976171999 4:82313810-82313832 CCACCATGTAAGGACCTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976171999 Original CRISPR CCACCATGTAAGGACCTTGA AGG Intergenic
No off target data available for this crispr