ID: 976176706

View in Genome Browser
Species Human (GRCh38)
Location 4:82361784-82361806
Sequence CACCTAAGCATATCATCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 106}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976176703_976176706 19 Left 976176703 4:82361742-82361764 CCCCAAATGTTTTTCAGACAAGA 0: 1
1: 0
2: 2
3: 30
4: 313
Right 976176706 4:82361784-82361806 CACCTAAGCATATCATCAGCTGG 0: 1
1: 0
2: 1
3: 8
4: 106
976176705_976176706 17 Left 976176705 4:82361744-82361766 CCAAATGTTTTTCAGACAAGAAG 0: 1
1: 0
2: 1
3: 26
4: 283
Right 976176706 4:82361784-82361806 CACCTAAGCATATCATCAGCTGG 0: 1
1: 0
2: 1
3: 8
4: 106
976176704_976176706 18 Left 976176704 4:82361743-82361765 CCCAAATGTTTTTCAGACAAGAA 0: 1
1: 0
2: 3
3: 38
4: 482
Right 976176706 4:82361784-82361806 CACCTAAGCATATCATCAGCTGG 0: 1
1: 0
2: 1
3: 8
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976176706 Original CRISPR CACCTAAGCATATCATCAGC TGG Intronic
904572350 1:31476270-31476292 CGCCTAGGCATATTATCATCAGG - Intergenic
908174957 1:61546453-61546475 CACCTAGGCATATTGTCATCAGG - Intergenic
909981232 1:82104044-82104066 CACCTAGGCATATTGTCATCAGG - Intergenic
912612306 1:111060835-111060857 CACCTAGGCATGTAATCATCAGG - Intergenic
915218648 1:154356480-154356502 CACATAAGCATTTCATCACATGG - Intergenic
917057738 1:171002713-171002735 CACCTAAGCACATTGTCATCGGG - Intronic
917635322 1:176930142-176930164 CACCTAAGTATGTCTTCAACAGG - Intronic
918750651 1:188265492-188265514 CACCTAGGCATATTGTCATCAGG - Intergenic
921788430 1:219261807-219261829 CACCTAGGCACATAATCATCAGG - Intergenic
922796504 1:228342203-228342225 CACCCAAGCCTGTCATCAGCTGG + Exonic
1064054824 10:12088493-12088515 CAACTAAGCATATGAGCAGTTGG + Intronic
1067759982 10:49037552-49037574 CCCCTAATGATATCCTCAGCAGG - Intronic
1069939340 10:71943792-71943814 CACCCTGGCATTTCATCAGCCGG + Intergenic
1072381616 10:94878342-94878364 CACCTAGGCACATAATCATCAGG - Intergenic
1072815053 10:98499182-98499204 CACCTAGGCATATTGTCATCAGG + Intronic
1076112220 10:127869633-127869655 CACCAAGGCATATAATCATCAGG - Intergenic
1081877939 11:46423222-46423244 GATCTAAGCAGATCAACAGCTGG - Intronic
1085112504 11:73900356-73900378 CAGCTGACCATATCTTCAGCTGG - Exonic
1089826099 11:121279554-121279576 CACCTAAGCACATTGTCATCAGG - Intergenic
1090756857 11:129799444-129799466 CACCTAAGCACATAATCATCAGG + Intergenic
1095329264 12:40938061-40938083 GGCCTAAGCATATCTTCATCTGG - Intronic
1099630318 12:85134211-85134233 AACCTAAATATACCATCAGCAGG - Intronic
1104151172 12:126084674-126084696 CACCTGACCACAGCATCAGCAGG + Intergenic
1105421562 13:20256942-20256964 TTCCTTAGCATCTCATCAGCAGG + Intergenic
1107825408 13:44324802-44324824 TACCCAAGTATATCATCTGCAGG + Intergenic
1110340773 13:74387711-74387733 CACCTAAGCATATAGTCATCAGG - Intergenic
1110888061 13:80663713-80663735 CACCAAGGCATATAATCATCAGG - Intergenic
1112137720 13:96601124-96601146 CACCGAAGCATATAATCATCAGG - Intronic
1118288065 14:64495523-64495545 CACCTCTTCATATCACCAGCTGG + Intronic
1120489739 14:85162176-85162198 CACCTAGGCACATTATCATCAGG + Intergenic
1124646708 15:31441988-31442010 CATGTAAACATATCATCAACAGG - Intergenic
1124703356 15:31936898-31936920 CACCTGAGCTTATCATGAACTGG + Intergenic
1128589003 15:68877778-68877800 CACCTAAGCCTTGCAACAGCAGG - Intronic
1135825766 16:25727229-25727251 CACCTAAGTGTATCAGAAGCTGG + Intronic
1137940310 16:52677365-52677387 CACCAAAGCATTTAAGCAGCTGG + Intergenic
1158253171 18:55513117-55513139 CACCTATGCAAATCTTCACCTGG + Intronic
1161128688 19:2574969-2574991 CCCCTAAGCCTAACAGCAGCTGG - Intronic
1164575678 19:29404122-29404144 CACCCAAGCACCTCCTCAGCAGG + Intergenic
925795541 2:7538443-7538465 CACCTAAGCACATAGTCATCAGG - Intergenic
926560331 2:14409686-14409708 CACCTAGGCACATTATCATCAGG + Intergenic
934111251 2:88745737-88745759 CACCTAGGCATATAGTCATCAGG - Intronic
937561463 2:123230005-123230027 CACCTAAGCACATTGTCATCAGG - Intergenic
938216396 2:129521316-129521338 CACCTAAGCACATAGTCATCAGG - Intergenic
941263721 2:163332175-163332197 AACCTCACCTTATCATCAGCAGG - Intergenic
944647960 2:201798811-201798833 AACCTAAGCATATTATTCGCAGG + Intronic
945387172 2:209216126-209216148 CACCTAGGCATATGGTCATCAGG + Intergenic
946501448 2:220251407-220251429 CACCTAGGCATATTGTCATCAGG + Intergenic
1169480613 20:5976678-5976700 CGCCTCAGCATCTCATCAACAGG + Intronic
1175069233 20:56317757-56317779 CACCTAGGCACATCGTCATCAGG + Intergenic
1179073740 21:38098565-38098587 CACCTTACCATCACATCAGCGGG - Intronic
1179426318 21:41281461-41281483 CAGATAAGAATATCATAAGCAGG + Intronic
951183950 3:19689997-19690019 CACCTAGGCATATTGTCATCAGG + Intergenic
952689700 3:36190925-36190947 CACCTAGGCACATCGTCATCAGG - Intergenic
956772260 3:72536668-72536690 AACCTAAGTATCTCATCAGGAGG - Intergenic
957196378 3:77073568-77073590 AACCTAAGCATTTCATCAAAGGG + Intronic
959159090 3:102702396-102702418 CAACTCAGCATAGCCTCAGCTGG + Intergenic
959388704 3:105745810-105745832 CTCCCAAGCATGCCATCAGCGGG + Intronic
962709571 3:138074239-138074261 CACCTAAGCACATAGTCAACCGG + Intronic
964914862 3:161828312-161828334 AACCTAAGCATAAAATCAGATGG + Intergenic
964916195 3:161845199-161845221 CACCTAAGCATATTGTCATCCGG - Intergenic
965485154 3:169269729-169269751 CACCCAAGTATGTCTTCAGCAGG + Intronic
965745570 3:171921469-171921491 CACCTAGGCATATTGTCATCAGG + Intronic
971050267 4:22854265-22854287 CACCTAAGCACATAGTCATCAGG - Intergenic
971881837 4:32384966-32384988 CACCTGGGCCTATCAGCAGCTGG + Intergenic
975517405 4:75261521-75261543 CGCCTATGCACATCATCATCAGG + Intergenic
975603072 4:76123908-76123930 TTACTAAGCATCTCATCAGCTGG - Intronic
976176706 4:82361784-82361806 CACCTAAGCATATCATCAGCTGG + Intronic
976686177 4:87818223-87818245 CACCTAAGCACATTGTCATCAGG - Intergenic
978580342 4:110225641-110225663 CACTAAAGCATCTCACCAGCAGG - Intergenic
981442380 4:144798062-144798084 CACCTAGGCATATAGTCATCAGG - Intergenic
983700153 4:170581845-170581867 CAACTAAGCAGAAAATCAGCAGG + Intergenic
985355904 4:189118311-189118333 CACCTAGGCACATCGTCATCAGG + Intergenic
995538604 5:113162444-113162466 CACTTAACCACAACATCAGCTGG + Intronic
995699075 5:114913582-114913604 CACCTAAGCACATAGTCATCAGG + Intergenic
996197949 5:120632911-120632933 CACCTAGGCATATAGTCATCAGG + Intronic
1001733614 5:173980262-173980284 CACCTAGGCACATAATCATCAGG - Intronic
1004096693 6:12561904-12561926 CACCTAAGCACATAGTCATCAGG + Intergenic
1006574342 6:35033313-35033335 GAACTAAGCAAATCCTCAGCTGG + Intronic
1009867056 6:69410413-69410435 CACCTAGGCATATAGTCATCAGG + Intergenic
1011833870 6:91405733-91405755 CACTTAAGCACATCGTCATCAGG + Intergenic
1011893151 6:92192864-92192886 CACCTAAGCACATCATCATCAGG - Intergenic
1012718212 6:102703295-102703317 CAACTAAGTACATCAACAGCTGG - Intergenic
1012808676 6:103929434-103929456 AGACTAAGCATATCATAAGCTGG - Intergenic
1013300348 6:108799269-108799291 CTCCTAAGCAGATCAGCTGCAGG - Intergenic
1014924125 6:127250605-127250627 TTTCTAAGCATATCATTAGCTGG + Intergenic
1015362207 6:132353623-132353645 CACCTAGGCACATCATCATCAGG - Intronic
1021314051 7:19124267-19124289 CTCTTAAGCACAGCATCAGCAGG - Intergenic
1021464845 7:20930564-20930586 CACCTTAGCATAGCTTCATCCGG + Intergenic
1025080854 7:55981268-55981290 AACCTAAGCTTCTGATCAGCAGG + Intronic
1027395773 7:77752301-77752323 GACCTAAGCATGTCAGCTGCAGG + Intronic
1028529497 7:91823402-91823424 CACCTAGGCACATAATCATCAGG - Intronic
1031740141 7:125419039-125419061 CACCTAGGCACTTCATCATCAGG + Intergenic
1039415312 8:37388803-37388825 CATCTCATTATATCATCAGCAGG - Intergenic
1041150950 8:54933762-54933784 CACTTAATCTTATCATGAGCAGG - Intergenic
1041227927 8:55718385-55718407 CACCTAGGCATATTTTCATCAGG + Intronic
1047525700 8:125632388-125632410 CACAGAAGCAGATCATCAACTGG + Intergenic
1051743374 9:20272882-20272904 CACCTAAGGATATCACCACTGGG - Intergenic
1054938959 9:70719042-70719064 CACCTAGGCACATCGTCATCAGG + Intronic
1054940650 9:70737035-70737057 CACCTAGGCACATCGTCATCAGG + Intronic
1055186984 9:73469439-73469461 CACCTAGGCACATAATCATCAGG - Intergenic
1055846681 9:80573257-80573279 CACCTAAGCACATAGTCATCAGG + Intergenic
1057643039 9:96845881-96845903 CACCAAAGCATATAGTCATCAGG + Intronic
1057956224 9:99410170-99410192 CACCTAGGTATATCAGCAGCTGG + Intergenic
1185677043 X:1857552-1857574 CACCTCCTCATATCATCACCTGG + Intergenic
1187773456 X:22729302-22729324 CACCTAGGCATATTTTCATCAGG - Intergenic
1189241986 X:39532387-39532409 CAGCTAAGCCTAGCATCAGTGGG + Intergenic
1191779726 X:64852763-64852785 CACCTAGGCATATTGTCACCAGG - Intergenic
1193549186 X:82869718-82869740 CACCAAAACATATAATCATCAGG - Intergenic
1194278360 X:91914926-91914948 CACCTAAGCATGTAGTCATCAGG + Intronic
1194401264 X:93440113-93440135 CACGTGAGCATTTCACCAGCAGG + Intergenic
1196477917 X:116110778-116110800 CATCTAGGCACATCATCATCAGG - Intergenic
1196977625 X:121177734-121177756 CACCTAGGCACATAATCATCAGG - Intergenic
1197574216 X:128189255-128189277 CACCTAGGCACATTATCATCAGG + Intergenic
1197589063 X:128385434-128385456 CACCTAGGCATATTATCATCAGG + Intergenic
1202385470 Y:24322290-24322312 CAGCAAAGCATACCATGAGCAGG + Intergenic
1202485316 Y:25347838-25347860 CAGCAAAGCATACCATGAGCAGG - Intergenic