ID: 976180141

View in Genome Browser
Species Human (GRCh38)
Location 4:82391089-82391111
Sequence TGCCAAAGGCTGGCCGGGCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976180141_976180148 10 Left 976180141 4:82391089-82391111 CCGCGCCCGGCCAGCCTTTGGCA No data
Right 976180148 4:82391122-82391144 AGAAAAAAACAGGCCTGGTGCGG No data
976180141_976180147 5 Left 976180141 4:82391089-82391111 CCGCGCCCGGCCAGCCTTTGGCA No data
Right 976180147 4:82391117-82391139 TCAAAAGAAAAAAACAGGCCTGG No data
976180141_976180149 13 Left 976180141 4:82391089-82391111 CCGCGCCCGGCCAGCCTTTGGCA No data
Right 976180149 4:82391125-82391147 AAAAAACAGGCCTGGTGCGGTGG No data
976180141_976180146 0 Left 976180141 4:82391089-82391111 CCGCGCCCGGCCAGCCTTTGGCA No data
Right 976180146 4:82391112-82391134 TTTTTTCAAAAGAAAAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976180141 Original CRISPR TGCCAAAGGCTGGCCGGGCG CGG (reversed) Intergenic
No off target data available for this crispr