ID: 976184352

View in Genome Browser
Species Human (GRCh38)
Location 4:82430002-82430024
Sequence GCCGCCTCAGTCGCCAGCGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 130}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976184352_976184357 28 Left 976184352 4:82430002-82430024 CCGGCGCTGGCGACTGAGGCGGC 0: 1
1: 0
2: 0
3: 6
4: 130
Right 976184357 4:82430053-82430075 TGTTTTGTCCTCGAGCTGGCAGG 0: 1
1: 0
2: 0
3: 5
4: 91
976184352_976184356 24 Left 976184352 4:82430002-82430024 CCGGCGCTGGCGACTGAGGCGGC 0: 1
1: 0
2: 0
3: 6
4: 130
Right 976184356 4:82430049-82430071 CGCGTGTTTTGTCCTCGAGCTGG 0: 1
1: 0
2: 0
3: 2
4: 15

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976184352 Original CRISPR GCCGCCTCAGTCGCCAGCGC CGG (reversed) Exonic