ID: 976184356

View in Genome Browser
Species Human (GRCh38)
Location 4:82430049-82430071
Sequence CGCGTGTTTTGTCCTCGAGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 18
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 15}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976184352_976184356 24 Left 976184352 4:82430002-82430024 CCGGCGCTGGCGACTGAGGCGGC 0: 1
1: 0
2: 0
3: 6
4: 130
Right 976184356 4:82430049-82430071 CGCGTGTTTTGTCCTCGAGCTGG 0: 1
1: 0
2: 0
3: 2
4: 15
976184350_976184356 25 Left 976184350 4:82430001-82430023 CCCGGCGCTGGCGACTGAGGCGG 0: 1
1: 0
2: 0
3: 8
4: 154
Right 976184356 4:82430049-82430071 CGCGTGTTTTGTCCTCGAGCTGG 0: 1
1: 0
2: 0
3: 2
4: 15
976184353_976184356 -10 Left 976184353 4:82430036-82430058 CCCGCCGCGCGCACGCGTGTTTT 0: 1
1: 0
2: 0
3: 0
4: 13
Right 976184356 4:82430049-82430071 CGCGTGTTTTGTCCTCGAGCTGG 0: 1
1: 0
2: 0
3: 2
4: 15

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976184356 Original CRISPR CGCGTGTTTTGTCCTCGAGC TGG Exonic