ID: 976184357

View in Genome Browser
Species Human (GRCh38)
Location 4:82430053-82430075
Sequence TGTTTTGTCCTCGAGCTGGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 91}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976184350_976184357 29 Left 976184350 4:82430001-82430023 CCCGGCGCTGGCGACTGAGGCGG 0: 1
1: 0
2: 0
3: 8
4: 154
Right 976184357 4:82430053-82430075 TGTTTTGTCCTCGAGCTGGCAGG 0: 1
1: 0
2: 0
3: 5
4: 91
976184352_976184357 28 Left 976184352 4:82430002-82430024 CCGGCGCTGGCGACTGAGGCGGC 0: 1
1: 0
2: 0
3: 6
4: 130
Right 976184357 4:82430053-82430075 TGTTTTGTCCTCGAGCTGGCAGG 0: 1
1: 0
2: 0
3: 5
4: 91
976184354_976184357 -7 Left 976184354 4:82430037-82430059 CCGCCGCGCGCACGCGTGTTTTG 0: 1
1: 0
2: 0
3: 1
4: 30
Right 976184357 4:82430053-82430075 TGTTTTGTCCTCGAGCTGGCAGG 0: 1
1: 0
2: 0
3: 5
4: 91
976184355_976184357 -10 Left 976184355 4:82430040-82430062 CCGCGCGCACGCGTGTTTTGTCC 0: 1
1: 0
2: 0
3: 0
4: 21
Right 976184357 4:82430053-82430075 TGTTTTGTCCTCGAGCTGGCAGG 0: 1
1: 0
2: 0
3: 5
4: 91
976184353_976184357 -6 Left 976184353 4:82430036-82430058 CCCGCCGCGCGCACGCGTGTTTT 0: 1
1: 0
2: 0
3: 0
4: 13
Right 976184357 4:82430053-82430075 TGTTTTGTCCTCGAGCTGGCAGG 0: 1
1: 0
2: 0
3: 5
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976184357 Original CRISPR TGTTTTGTCCTCGAGCTGGC AGG Exonic