ID: 976185661

View in Genome Browser
Species Human (GRCh38)
Location 4:82440462-82440484
Sequence GTTCAAAGAGGTTTCGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 63}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976185661_976185667 18 Left 976185661 4:82440462-82440484 CCAGCAGCGAAACCTCTTTGAAC 0: 1
1: 0
2: 0
3: 6
4: 63
Right 976185667 4:82440503-82440525 GAAAGAAGGCTTACTTTGCAGGG 0: 1
1: 0
2: 1
3: 12
4: 191
976185661_976185664 4 Left 976185661 4:82440462-82440484 CCAGCAGCGAAACCTCTTTGAAC 0: 1
1: 0
2: 0
3: 6
4: 63
Right 976185664 4:82440489-82440511 GTGTCTTCCTCTATGAAAGAAGG 0: 1
1: 0
2: 3
3: 43
4: 423
976185661_976185668 26 Left 976185661 4:82440462-82440484 CCAGCAGCGAAACCTCTTTGAAC 0: 1
1: 0
2: 0
3: 6
4: 63
Right 976185668 4:82440511-82440533 GCTTACTTTGCAGGGATGTTAGG 0: 1
1: 0
2: 1
3: 19
4: 184
976185661_976185666 17 Left 976185661 4:82440462-82440484 CCAGCAGCGAAACCTCTTTGAAC 0: 1
1: 0
2: 0
3: 6
4: 63
Right 976185666 4:82440502-82440524 TGAAAGAAGGCTTACTTTGCAGG 0: 1
1: 0
2: 2
3: 14
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976185661 Original CRISPR GTTCAAAGAGGTTTCGCTGC TGG (reversed) Intronic
900173049 1:1279696-1279718 GTTTAAAAAGGTTTGTCTGCTGG - Intergenic
901527038 1:9830103-9830125 GTACAAAAAGGCTTCACTGCAGG - Intergenic
903656562 1:24952429-24952451 GTTCAATGGTGTTTTGCTGCAGG - Intronic
1063702061 10:8394345-8394367 GGTCCAAGAGGTTGTGCTGCTGG + Intergenic
1064025632 10:11846664-11846686 GTTCAAAGCTGTTTCAGTGCTGG - Intronic
1074009361 10:109460995-109461017 CTTCCAAGAGGTTTCACTGATGG + Intergenic
1074455318 10:113590862-113590884 GTACAAAGAGGCTTTCCTGCGGG - Exonic
1076879286 10:133231956-133231978 GGTCAAAGGGGGTTCTCTGCTGG - Intergenic
1077073362 11:688137-688159 GTTGAAGGAGGTGGCGCTGCCGG - Intronic
1078475293 11:11624004-11624026 GTTCAAAGAATTTTCTCTGGAGG + Intergenic
1085667576 11:78428583-78428605 GTTCCAAGGGGTATCACTGCAGG + Intergenic
1091603715 12:1933557-1933579 GTTCACTGAGGTTTCGGTCCCGG + Intergenic
1094249017 12:28338499-28338521 GTACAAAGATGTTTGGGTGCTGG + Intronic
1101203388 12:102460450-102460472 CTTCAAAGAGGTTTCTTTGTGGG - Intronic
1102469988 12:113154413-113154435 GTTCCAAGAGGTTCCGGAGCTGG + Exonic
1103828512 12:123760792-123760814 GTTCCAAGTCCTTTCGCTGCTGG - Exonic
1104336630 12:127902025-127902047 TTTTAATGAGGTTTCTCTGCAGG - Intergenic
1106665584 13:31847182-31847204 GTTGAAAGAGGTTTTGTTCCAGG + Intergenic
1106856693 13:33861058-33861080 GTTCAAATATGTTTCTCAGCTGG - Intronic
1134040795 16:11066753-11066775 ATTCACAGACGTTTCTCTGCAGG - Intronic
1136488270 16:30587077-30587099 CTTCAAAGTGGTTTCACTGTGGG - Intergenic
1137497084 16:48978852-48978874 GATCAAAGAGGTTTTGTTCCTGG - Intergenic
1140523097 16:75599016-75599038 GTTAAAACAGGATTGGCTGCTGG + Intronic
1140931144 16:79629303-79629325 TTTTAAAGAAGTTTAGCTGCAGG - Intergenic
1148234713 17:45961048-45961070 GTTCACAAAGCTTTAGCTGCAGG + Intronic
1149373998 17:56025340-56025362 CTTCAAATTGGTTTTGCTGCAGG + Intergenic
1152946736 17:83201996-83202018 CCTCAAAGAGGTTTTCCTGCTGG + Intergenic
1153976836 18:10275985-10276007 GTACAAAGACATTTCGCTGATGG - Intergenic
1158584845 18:58723160-58723182 CTTCAAAGTGGTTTCACTGTTGG + Exonic
928914282 2:36455161-36455183 GTTCAGAGAGCTGTGGCTGCAGG + Intronic
928950406 2:36808581-36808603 GTTCAAGCAGGTCTTGCTGCAGG - Exonic
929765326 2:44839323-44839345 GTTCAATGATTTTTCACTGCAGG - Intergenic
930469132 2:51791629-51791651 GTTCAATGTGGTGTCCCTGCAGG - Intergenic
935396460 2:102614749-102614771 GTACAAAGAGGCTTAGTTGCAGG + Intergenic
935517109 2:104053538-104053560 GTTCACAGAGGTTTGGCAGTGGG + Intergenic
1169241791 20:3987802-3987824 ATTTAAAGAGTTTTCACTGCAGG + Intronic
1170139367 20:13110518-13110540 TTTCAAAGGCGTTTCGCAGCTGG + Intronic
1170836409 20:19888527-19888549 ATTCAAAGTGGTTCAGCTGCAGG - Intronic
1177794508 21:25759500-25759522 GTTGAAAGTGCTTTCTCTGCTGG + Intronic
1181024292 22:20118982-20119004 ATACAAAGAGGTTACACTGCTGG - Intronic
949572770 3:5309502-5309524 GTTCAAAGATGTTTCCCTCGAGG - Intergenic
960520806 3:118653129-118653151 GTTCAAAAATGTTACGCTGCAGG + Intergenic
961167258 3:124772047-124772069 GCTCAAAAAGGTTCTGCTGCTGG + Intronic
961578699 3:127860076-127860098 TTTCAAACAGGCTTCCCTGCCGG - Intergenic
965535765 3:169822434-169822456 CTTCAAACTGGTTTCGCTTCAGG - Exonic
975394634 4:73860859-73860881 TTTCAAAGAGGTTGCTCTACTGG - Intergenic
976185661 4:82440462-82440484 GTTCAAAGAGGTTTCGCTGCTGG - Intronic
977004758 4:91551419-91551441 CTTCAATGAGGTTTTGCAGCAGG - Intronic
991727827 5:69553757-69553779 GCTCACAGAGGTTTGGCTTCCGG - Exonic
991867130 5:71074117-71074139 GCTCACAGAGGTTTGGCTTCCGG + Intergenic
994218580 5:97167542-97167564 GTTCAAGGAGGAGTCCCTGCTGG - Exonic
1001278902 5:170371811-170371833 ATCCAAAGAGGTGTTGCTGCAGG + Intronic
1003094093 6:3129053-3129075 GTTTAAGAAGGTTTCTCTGCTGG + Exonic
1009520364 6:64674662-64674684 GTTTTAAGAGGTTTCTATGCAGG - Intronic
1018973094 6:168542483-168542505 GTTCTCAGCGGTTTCCCTGCAGG - Intronic
1021994752 7:26168926-26168948 GGTCAAAGAGGTTTAGCAACTGG + Intronic
1023747246 7:43332772-43332794 GCTCAAAGAAGTTTAGCTGCTGG - Intronic
1024226902 7:47332320-47332342 GTGCAAGGATGTTTCCCTGCTGG - Intronic
1030041045 7:105450163-105450185 GTATAAAGAGGTTTCTCTGCTGG - Intronic
1030383421 7:108839927-108839949 GTTCAAAGAGTTTTTGAGGCTGG - Intergenic
1031779876 7:125947637-125947659 GGTCAAAGAGGTTGCACTGCAGG + Intergenic
1049942451 9:560528-560550 CTTCAAAGACATTTCGCTCCTGG - Intronic
1057843933 9:98507366-98507388 GTTCAAAGATGCTCTGCTGCTGG + Intronic
1058785205 9:108380294-108380316 GGTAAAAGATGTTTCACTGCAGG - Intergenic
1060846420 9:126841094-126841116 GTTCAAGTAGGGTTAGCTGCTGG + Intergenic
1060846521 9:126841978-126842000 GTTCAAGTAGGGTTAGCTGCTGG - Intergenic
1061485965 9:130920674-130920696 GTTTAAGGAGGTTTGGCGGCAGG - Intronic
1188930441 X:36103277-36103299 TTTCAATCAGGTTTCGCTGTGGG + Intronic
1195968179 X:110448240-110448262 GTTCAAAGAGGTTCAGGTGCAGG - Intronic
1199456230 X:148032316-148032338 GTTCAAGGATGTTTCACTGCTGG + Intergenic