ID: 976189289

View in Genome Browser
Species Human (GRCh38)
Location 4:82473690-82473712
Sequence CAGCAATCAGCAGTGGTAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976189289_976189294 24 Left 976189289 4:82473690-82473712 CCATCTACCACTGCTGATTGCTG No data
Right 976189294 4:82473737-82473759 TCCACCCCTCCGGATCCAGCAGG 0: 17
1: 53
2: 127
3: 140
4: 211
976189289_976189296 25 Left 976189289 4:82473690-82473712 CCATCTACCACTGCTGATTGCTG No data
Right 976189296 4:82473738-82473760 CCACCCCTCCGGATCCAGCAGGG 0: 17
1: 68
2: 120
3: 148
4: 241
976189289_976189292 14 Left 976189289 4:82473690-82473712 CCATCTACCACTGCTGATTGCTG No data
Right 976189292 4:82473727-82473749 ACCACTGACTTCCACCCCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976189289 Original CRISPR CAGCAATCAGCAGTGGTAGA TGG (reversed) Intergenic
No off target data available for this crispr