ID: 976190167

View in Genome Browser
Species Human (GRCh38)
Location 4:82479711-82479733
Sequence CAGCAATCAGCAGTGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976190167_976190171 14 Left 976190167 4:82479711-82479733 CCATCCACCACTGCTGATTGCTG No data
Right 976190171 4:82479748-82479770 GCCGCTGACTTCCACCCCTCCGG 0: 21
1: 71
2: 115
3: 97
4: 145
976190167_976190173 20 Left 976190167 4:82479711-82479733 CCATCCACCACTGCTGATTGCTG No data
Right 976190173 4:82479754-82479776 GACTTCCACCCCTCCGGATCCGG 0: 31
1: 87
2: 117
3: 65
4: 76
976190167_976190174 24 Left 976190167 4:82479711-82479733 CCATCCACCACTGCTGATTGCTG No data
Right 976190174 4:82479758-82479780 TCCACCCCTCCGGATCCGGCAGG 0: 12
1: 72
2: 148
3: 164
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976190167 Original CRISPR CAGCAATCAGCAGTGGTGGA TGG (reversed) Intergenic
No off target data available for this crispr