ID: 976196584

View in Genome Browser
Species Human (GRCh38)
Location 4:82537852-82537874
Sequence TAGAGCCTTCAATAGGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 503
Summary {0: 1, 1: 1, 2: 6, 3: 88, 4: 407}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976196575_976196584 15 Left 976196575 4:82537814-82537836 CCACCAGAAGCTGGAAGAGGTGA 0: 7
1: 34
2: 226
3: 708
4: 1639
Right 976196584 4:82537852-82537874 TAGAGCCTTCAATAGGAGCAGGG 0: 1
1: 1
2: 6
3: 88
4: 407
976196573_976196584 22 Left 976196573 4:82537807-82537829 CCAGGAGCCACCAGAAGCTGGAA 0: 61
1: 238
2: 399
3: 790
4: 1123
Right 976196584 4:82537852-82537874 TAGAGCCTTCAATAGGAGCAGGG 0: 1
1: 1
2: 6
3: 88
4: 407
976196577_976196584 12 Left 976196577 4:82537817-82537839 CCAGAAGCTGGAAGAGGTGAGGA 0: 6
1: 43
2: 212
3: 637
4: 1351
Right 976196584 4:82537852-82537874 TAGAGCCTTCAATAGGAGCAGGG 0: 1
1: 1
2: 6
3: 88
4: 407

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976196584 Original CRISPR TAGAGCCTTCAATAGGAGCA GGG Intronic
900602006 1:3506713-3506735 TACCGCCTTCAGTAGGAGGAAGG - Intronic
901424292 1:9171593-9171615 TAGAGCCTCCAGTGGGAGTATGG + Intergenic
902657661 1:17880490-17880512 TGGAGCCTTCAGAGGGAGCATGG - Intergenic
903405106 1:23089326-23089348 TAGAGCCTGGAATGGGGGCATGG + Intronic
905835509 1:41116961-41116983 TAGCGTCTTCAAAAGGAACATGG + Exonic
908382913 1:63613405-63613427 TAGAGCCTTCAGAGGGAGCATGG - Intronic
908498334 1:64717881-64717903 TAGAGCCTTCAGAAGAAGCATGG - Intergenic
909465136 1:75964886-75964908 TAGAGCCTTCAGAGGAAGCATGG - Intergenic
909542374 1:76805230-76805252 TAGAACCTACATTAGGACCAAGG - Intergenic
909556213 1:76957210-76957232 TGGAGCCTTCAGAGGGAGCATGG - Intronic
910442484 1:87266864-87266886 TGGAGCTTTCTACAGGAGCAGGG + Intergenic
911807743 1:102233374-102233396 TAGAGCTTCCTGTAGGAGCATGG - Intergenic
912855533 1:113165805-113165827 TAGAGCCTTCAGAGAGAGCACGG - Intergenic
913112630 1:115670178-115670200 GAGAGCCCTCAATAGGAACCAGG + Intronic
913210821 1:116580904-116580926 TAGAGCCTTCATGGGGAGCATGG + Intronic
913508514 1:119541245-119541267 TTGAGCCTTCACTAGAAGCCTGG + Intergenic
915503199 1:156334496-156334518 TAGAGACTTCAGAAGGAGCATGG + Intronic
915790653 1:158666563-158666585 TTGATCCTTCAATTGGAGGAAGG - Intronic
916355230 1:163898613-163898635 TACAGCCTACAAAAGGAGGAGGG + Intergenic
916374169 1:164133836-164133858 TAGAGCCTCCAGAGGGAGCATGG + Intergenic
916876265 1:168972936-168972958 CAGAGCCTCCACTAGGAGAAAGG + Intergenic
917475956 1:175369323-175369345 TAGAGCCTTCAGAGGAAGCATGG - Intronic
918599988 1:186346677-186346699 TACAGCCTTCAAAATGAACACGG + Intronic
918634291 1:186756277-186756299 TAGAGACTTTAAAAAGAGCAAGG - Intergenic
919319117 1:196011991-196012013 TAGAGCCTTCAGAAGAAGTATGG - Intergenic
919508311 1:198428195-198428217 TAGAGCCTTCACAGGGAGCATGG + Intergenic
920706738 1:208256740-208256762 TAGAGCTTTCAAAAGAAGCCTGG - Intergenic
921128965 1:212202868-212202890 AAGAGCTTTCAAGAGGAGCCTGG - Intergenic
921567900 1:216742275-216742297 TAGAGCCTTGAAAAAGGGCATGG + Intronic
922004602 1:221516971-221516993 CAGAGCCTTCAGAGGGAGCATGG + Intergenic
922600196 1:226845331-226845353 TAGAGCCTCCAACAAGAGCAAGG + Intergenic
923084994 1:230696514-230696536 TAGAGCCTTCAGGGGGAGCACGG - Intergenic
923912486 1:238463997-238464019 TAGAGCATTCATTAGGCACATGG - Intergenic
924446994 1:244142210-244142232 TGCAGCCTTCAAGAGGAGGAGGG + Intergenic
1062767738 10:78680-78702 TAGTGCCTTCAGAGGGAGCACGG + Intergenic
1064280438 10:13946377-13946399 TAGAGACTTCAGGAGGAGAAGGG + Intronic
1065849775 10:29778078-29778100 TAGAGCCTTCAGAGGGAGCAGGG + Intergenic
1066658252 10:37714078-37714100 GAGAGCCTTCAATGGGTGAATGG - Intergenic
1066665020 10:37774171-37774193 TAGATCTGTCAACAGGAGCATGG + Intergenic
1067042754 10:42963764-42963786 AAGAGCCTTCAATGGGTGAATGG - Intergenic
1067328184 10:45289744-45289766 TAGAGCCTTCAGAGAGAGCATGG - Intergenic
1067443623 10:46327136-46327158 CAGAGCCCTCAAGAGGAGCGAGG + Intronic
1067789078 10:49273896-49273918 TGGAGCCTTCAGAGGGAGCACGG + Intergenic
1068595431 10:58898056-58898078 TAGAGCCTTATAGAGGAGCATGG + Intergenic
1071070688 10:81690021-81690043 TACAGACTTCAAAGGGAGCATGG + Intergenic
1071995931 10:91149469-91149491 GAGAGCCTTGCATAAGAGCAGGG - Intergenic
1072786300 10:98285352-98285374 TAGAGCCTTCAGAGGGAGCTTGG + Intergenic
1074008185 10:109449658-109449680 TAGAGCATTCAGAGGGAGCATGG - Intergenic
1074266802 10:111912483-111912505 TAGAGCCTTCAGAGGGAGTATGG + Intergenic
1074713714 10:116199088-116199110 TAGAGCCTTCAGAGAGAGCATGG + Intronic
1074760971 10:116667272-116667294 TAGCGCCTTCAGAAAGAGCATGG + Intronic
1074930788 10:118123689-118123711 TAGAGCCTTCAGAGGGAACATGG + Intergenic
1074939293 10:118218899-118218921 TAGAGCCTTCAGAGGGAGCTCGG + Intergenic
1075318068 10:121467958-121467980 CAGAGCCTTCAGAAGGAGCATGG + Intergenic
1075418046 10:122280060-122280082 CAGAGCCTGCAAAAGGACCAAGG - Intronic
1075622993 10:123941269-123941291 TAGGGCCTTCAAAGGGAACACGG - Intergenic
1075681002 10:124331162-124331184 TAGAGCCTTCAAAGAGAGCAGGG + Intergenic
1075955656 10:126520719-126520741 TAGGGCCTTCAGAGGGAGCACGG - Intronic
1076228217 10:128797982-128798004 TAGAGCCTTCAGAGGGAGCATGG + Intergenic
1076444310 10:130501492-130501514 TAGAGCCTCCAGAGGGAGCATGG - Intergenic
1077586943 11:3461043-3461065 TAGAGCCTTCAGAGGGAGCACGG - Intergenic
1078794568 11:14579243-14579265 TAGAACCTTCAGAAGGATCATGG - Intronic
1079142456 11:17821156-17821178 TAGAGCCTCCAGAGGGAGCATGG + Intronic
1079246027 11:18752962-18752984 TAGAGGCTTAAAGATGAGCATGG - Intronic
1079455950 11:20636448-20636470 GGGAGTCTTCAAGAGGAGCATGG - Intronic
1079756921 11:24275557-24275579 TAGAATCTTCACTGGGAGCATGG - Intergenic
1079887891 11:26011708-26011730 TAGAGACTTCAGAGGGAGCATGG + Intergenic
1080139860 11:28903823-28903845 TAGAGCCTTCAGAAGGAGAATGG - Intergenic
1080206490 11:29735555-29735577 TAGAGCCCTCAGTGAGAGCATGG + Intergenic
1080707996 11:34717046-34717068 TAGAGCCATCAGAAGGAGCGGGG - Intergenic
1081105644 11:39065507-39065529 TAGAGACTTCAAAGGGAGCAAGG + Intergenic
1081109015 11:39108546-39108568 TAGAGACTTTAATGGGAGCATGG - Intergenic
1081311676 11:41582037-41582059 TAGAGCCTTCAGCGGAAGCATGG - Intergenic
1083195056 11:61081169-61081191 TAGAGCCTTTTTTAGGGGCATGG + Intergenic
1083586357 11:63862583-63862605 TAGAGCCCTCAATAGTAGGGAGG - Intronic
1084242942 11:67835075-67835097 TAGAGCCTTCAGAGGGAGCACGG - Intergenic
1084533000 11:69740278-69740300 TGGAGCCTTCAGAAGGAGCAGGG - Intergenic
1084830051 11:71761900-71761922 TAGGGCCTTCATAGGGAGCACGG + Intergenic
1085178124 11:74508416-74508438 TAGAGCCTAAAACAGGAGCGTGG + Intronic
1085452224 11:76641323-76641345 CAGAGCCTTCAGAGGGAGCACGG + Intergenic
1086540120 11:87899078-87899100 TAGAGCCCTCAATAGTGGAATGG + Intergenic
1088070261 11:105775004-105775026 TAGAGCCTCCAGAAGGAGCTTGG - Intronic
1088358609 11:108968518-108968540 TAGAGCCTTCGGAGGGAGCATGG + Intergenic
1089966627 11:122658943-122658965 TAGAGCCTCCAGAGGGAGCACGG - Intronic
1090375634 11:126286863-126286885 TGGAGCCTTCAGAAGGAGCACGG - Intronic
1091131372 11:133149862-133149884 TAGAGCCTGCTTTGGGAGCAGGG + Intronic
1091783509 12:3228846-3228868 TAGAGCCTTCGAAGGGAGCATGG - Intronic
1092041790 12:5391576-5391598 TAGAGCCTTCAGACGGAGCGTGG - Intergenic
1094616840 12:32043563-32043585 TGGAGCCTTCAGAAGGAGCATGG - Intergenic
1095885736 12:47186691-47186713 TACAGCTTTCAGAAGGAGCATGG + Intronic
1096550836 12:52370583-52370605 TGGGGCCTTCAAAAGGTGCAGGG - Intergenic
1097545099 12:60989113-60989135 TAGAGCCTTCAGAGGAAGCATGG - Intergenic
1097695072 12:62767764-62767786 CAGAGCCTTCAGAAGGAGCGTGG - Intronic
1097974560 12:65670765-65670787 TAGAGCCTTCCAAGGGAGCGTGG - Intergenic
1097993044 12:65856685-65856707 TAGAGCCTTCAGGGAGAGCACGG - Exonic
1098204900 12:68098417-68098439 TAGAGCCTTCAGAGAGAGCACGG - Intergenic
1098338901 12:69431655-69431677 TACAGACTTCAGAAGGAGCACGG + Intergenic
1099664304 12:85608136-85608158 TAGAGTCTTCAGAGGGAGCATGG - Intergenic
1099669045 12:85667517-85667539 TAGAGCCTTCAGAGAGAGCATGG + Intergenic
1099869053 12:88322999-88323021 TAGAGCCTTCAGAGAGAGCATGG + Intergenic
1100771849 12:97932102-97932124 TAGAGCCTTCAGTGGGAGCATGG - Intergenic
1101002241 12:100368200-100368222 AAGAGCCTTCAGGAGGAGCTTGG - Intronic
1101315892 12:103628546-103628568 TAGAAGCTTCAAAAGGAGCATGG - Intronic
1101319758 12:103663343-103663365 TAGAGCCTTCAGAGGGAGCATGG - Intronic
1102096555 12:110245988-110246010 TAGAGCCTCCAGAAGGAACACGG - Intergenic
1102568087 12:113810168-113810190 TAGAGCCTTCGGAGGGAGCACGG + Intergenic
1102888962 12:116543327-116543349 TAGAGCCTTCAGAAGGAGCTTGG - Intergenic
1102986487 12:117282540-117282562 TAGAGCCTTCTTTCTGAGCACGG + Intronic
1103041788 12:117701852-117701874 TAGAGCCTTCGGAAGGAGCATGG + Intronic
1103845914 12:123902023-123902045 TAGAGCTTTCAGAGGGAGCATGG - Intronic
1103859075 12:123997433-123997455 TAAAGCCTTCAAAGGGAGCACGG - Intronic
1104288071 12:127443487-127443509 TAGAGCCTTCGGAGGGAGCATGG + Intergenic
1104395080 12:128425657-128425679 TAGAGCCTTCGGAGGGAGCATGG - Intronic
1104493662 12:129216572-129216594 TAGAGCCTCCAGAGGGAGCATGG + Intronic
1104515218 12:129419005-129419027 AAGAGCCTTCCACGGGAGCAGGG + Intronic
1106655653 13:31743617-31743639 GAGAGGCTTGAACAGGAGCAAGG - Intronic
1106908649 13:34438788-34438810 TAGAGCCCTCAGTGGGAGCATGG - Intergenic
1107340167 13:39396946-39396968 TAGAACCTTCAGAGGGAGCATGG + Intronic
1107716134 13:43201364-43201386 TAGAGCCTTCAATAGGCTAATGG + Intergenic
1107790776 13:43999962-43999984 TAGAGCCTTCAGAGCGAGCATGG + Intergenic
1108564277 13:51679755-51679777 TACAGCTTTCAGAAGGAGCATGG - Intronic
1109056566 13:57557006-57557028 TAGAGCCTTCATTATGTACAGGG + Intergenic
1109478492 13:62916557-62916579 TAGAGCCTTCAAAACGAGTATGG + Intergenic
1110330612 13:74268015-74268037 TAGAGTCTTCAGGAGGAACAAGG + Intergenic
1110476196 13:75916790-75916812 TAGAGCCTTCAGAAAGAGAAAGG + Intergenic
1110725907 13:78823362-78823384 TAGAGACTTCCAAGGGAGCATGG - Intergenic
1110925192 13:81142113-81142135 TAGTGCTTTCAAGGGGAGCACGG + Intergenic
1111547455 13:89760599-89760621 TGGGGCATTGAATAGGAGCAAGG - Intergenic
1112117522 13:96372982-96373004 TGGAGCCTTCAGAAGGAGCATGG - Intronic
1112520992 13:100095031-100095053 TAGAGCCTTCAGGCGAAGCATGG - Intronic
1112867803 13:103928172-103928194 TAGAGACTTCATCAGGAGTATGG + Intergenic
1113362085 13:109640853-109640875 TTGAGCCTGCAGTGGGAGCATGG - Intergenic
1115480456 14:33856089-33856111 TAGAGCCTCAAGTGGGAGCATGG + Intergenic
1116150912 14:41141205-41141227 CAGAGCCTTCAGAAGGAGTATGG - Intergenic
1117845987 14:59912494-59912516 GAGAGCCTTCAGAGGGAGCATGG - Intergenic
1119113178 14:71994784-71994806 CAGAGCCTTCAGAGGGAGCATGG + Intronic
1119125573 14:72122632-72122654 TAGATTCTTAAATAAGAGCAGGG + Intronic
1119521849 14:75292298-75292320 CAGAGCCTTCAGCTGGAGCATGG + Intergenic
1119920590 14:78442436-78442458 AAGAGCCTTCAGAGGGAGCATGG + Intronic
1120292918 14:82600149-82600171 TAGAGCCTTCAAAGGCAGCATGG - Intergenic
1120713402 14:87816089-87816111 TAGGGCCTTCAGAAGGAGCTTGG - Intergenic
1121454448 14:94029393-94029415 TAGCGCCTTCAGAGGGAGCATGG - Intronic
1121813949 14:96914839-96914861 TAGAGCCTTCAAAGGGAGTTTGG - Intronic
1121827555 14:97022877-97022899 TAGTGCCTTCAGAGGGAGCATGG - Intergenic
1123788285 15:23694127-23694149 TAAAGCCTTTGGTAGGAGCATGG - Intergenic
1124010227 15:25832198-25832220 TAGAGCTTTCCACAGGAGCACGG + Intronic
1124111677 15:26795857-26795879 GAGAGCCTTCAGAGGGAGCATGG - Intronic
1124429880 15:29597671-29597693 TATATCCTTCAATAGGTGAATGG - Intergenic
1126584401 15:50268713-50268735 TAAATCCTTCATTAGGAGCCAGG + Intergenic
1126672270 15:51127241-51127263 TAGAGTCTTCAGAGGGAGCACGG - Intergenic
1127556891 15:60096309-60096331 TAAAGCCTCCAGAAGGAGCATGG - Intergenic
1127616338 15:60689872-60689894 TAAAGCCTTCAGAGGGAGCAAGG + Intronic
1127681662 15:61303800-61303822 TAGAGCCTGCAGAGGGAGCATGG - Intergenic
1128355156 15:66921184-66921206 TAGAGCCTTCAGAGGGAGCATGG + Intergenic
1129904554 15:79177110-79177132 TAGAGCCTTCAGAGGAAGCATGG + Intergenic
1132095583 15:98982123-98982145 TTGAGCGTTTACTAGGAGCACGG + Intronic
1132456684 16:27819-27841 TAGTGCCTTCAGAGGGAGCATGG + Intergenic
1133189485 16:4122948-4122970 TAGAACCTTCAAAAGAAGCGTGG + Intergenic
1133332573 16:4984367-4984389 TACAGCCTTAAAAAGGAACAAGG - Intronic
1133338140 16:5019908-5019930 TACAGCCTTCAGAAGGAGCAGGG - Intergenic
1133354386 16:5125285-5125307 TAGAGCCTTCAGAGGGAGCACGG - Intergenic
1133517578 16:6524695-6524717 TAGAGCCCTCACAGGGAGCATGG - Intronic
1133569833 16:7030442-7030464 TAGAGCCTTCAGAAGGAACTTGG - Intronic
1133623058 16:7544624-7544646 GAGAGCCTTCAGATGGAGCATGG + Intronic
1133884219 16:9810674-9810696 TAGAGCCTTCAGAGGGAGCAAGG + Intronic
1134328064 16:13225242-13225264 CAGAGCCTTCAGATGGAGCATGG + Intronic
1137238500 16:46634669-46634691 AAAAGCCTTCAATAGGTGAATGG + Intergenic
1137759572 16:50929235-50929257 TAGAGTCTTCAGACGGAGCATGG - Intergenic
1137976291 16:53035087-53035109 TAGAGTCTTCAAAGGAAGCATGG - Intergenic
1138613755 16:58148075-58148097 CAGAGCCTTCAGAGGGAGCATGG - Intergenic
1138646680 16:58430674-58430696 TAGAGCCTTCAGAGGGAGCGTGG - Intergenic
1138909350 16:61377654-61377676 TAGAGCCTTCAGAGAGAGCATGG - Intergenic
1140644813 16:77017963-77017985 TAGAGCCTTCAGAGGGAGCATGG + Intergenic
1140740165 16:77934486-77934508 TAGAGCCTCCAGAAGGAACATGG + Intronic
1141086626 16:81100311-81100333 TAGAGCCCTCAGAGGGAGCATGG + Intergenic
1141621683 16:85239661-85239683 AAGAGCCCTCACTAGGAGCTGGG - Intergenic
1141671462 16:85494210-85494232 TAGAGCCTGCACAGGGAGCACGG - Intergenic
1141674739 16:85511815-85511837 TAGAGCCTCCAGAGGGAGCAGGG + Intergenic
1142947608 17:3445967-3445989 TAGAGCCTCCAAAAGGAACATGG - Intronic
1144510618 17:15871935-15871957 TTGAGCCTTAAAAAGGAGTAAGG + Intergenic
1145070976 17:19807526-19807548 TAGTGCCTTCAATAGCTACATGG - Intronic
1145096230 17:20030028-20030050 TAGAGCCTTCACAGGGAGCATGG + Intronic
1145122195 17:20269920-20269942 TTGAGCCTTAAAAAGGAGTAAGG + Intronic
1145174776 17:20689657-20689679 TTGAGCCTTAAAAAGGAGTAAGG + Intergenic
1146523500 17:33546010-33546032 AACAGCCTTCAATAGGAACAAGG - Intronic
1147875271 17:43616531-43616553 TAGAGCCTTGGACATGAGCATGG - Intergenic
1149127538 17:53254260-53254282 TAGAGTCTTCTAGAGGAGTATGG - Intergenic
1149205217 17:54236322-54236344 TAGAGCCTTCAACAAGAGACAGG + Intergenic
1149333292 17:55608558-55608580 TAGAAACTTCAGAAGGAGCAGGG - Intergenic
1150604365 17:66678270-66678292 TAGAGCCTCCAGAAGGAACATGG + Intronic
1150751016 17:67862775-67862797 TAGAGCCTGCAGAGGGAGCATGG - Intronic
1150976510 17:70093301-70093323 TAGAGGCTTCAGAAGGAGCAAGG - Intronic
1151243641 17:72777651-72777673 TAGAGCCTTCAGGAGAAGCATGG + Intronic
1151259060 17:72902434-72902456 TTGAGCCTTCAGAGGGAGCATGG + Intronic
1151271822 17:73002803-73002825 TAGAGCCTCCAGAGGGAGCATGG - Intronic
1151397325 17:73832198-73832220 TAGAGCCTTCAGAGAGAGCATGG - Intergenic
1152391630 17:80007210-80007232 CTGAGCCTTCATCAGGAGCAGGG + Intronic
1152900201 17:82936818-82936840 TTGAGCCTTCAGTGGCAGCAGGG - Intronic
1152960573 18:78014-78036 TAGTGCCTTCAGAGGGAGCATGG + Intergenic
1153576936 18:6531961-6531983 CAGAGCCTTCAGAGGGAGCATGG - Intronic
1153955603 18:10093127-10093149 CCAAGCCTTCAACAGGAGCAGGG + Intergenic
1155047718 18:22117573-22117595 TAGAGCTCTCAGTTGGAGCATGG - Intergenic
1155162310 18:23205987-23206009 CAGTGCCTTCAAATGGAGCATGG + Intronic
1155738479 18:29255112-29255134 TAGAGCCTTCAGAGGGAACATGG + Intergenic
1156593843 18:38523145-38523167 TAGAGCCTTCAGTGAGAGCATGG - Intergenic
1156712593 18:39964852-39964874 TAGAGCTTTCAAAAGGAACGTGG - Intergenic
1157410795 18:47461431-47461453 TGGAGCCTTCAGCAAGAGCACGG - Intergenic
1157645242 18:49262301-49262323 TAGAGCCTTCAGAGAGAGCATGG + Intronic
1158077968 18:53553227-53553249 TAGAGCCTGCAGAGGGAGCATGG + Intergenic
1159910640 18:74142505-74142527 TAGAGCCTTCAGAGGGAGCACGG - Intronic
1160035437 18:75297261-75297283 TGGAGCCTTCAAAGGGAGCACGG - Intergenic
1160037960 18:75318954-75318976 TAGAGGCTTCAGAGGGAGCATGG - Intergenic
1160463279 18:79055422-79055444 TAGAGCCTGGGAAAGGAGCATGG - Intergenic
1161884466 19:6983174-6983196 TGGAGCCTTCAGAGGGAGCATGG - Intergenic
1163372736 19:16910932-16910954 TAGAGCCTGCAGAGGGAGCAAGG + Intronic
1164491925 19:28722865-28722887 TAAAGCATGCAATAGGGGCAGGG + Intergenic
1164531132 19:29049079-29049101 TGGAACCTTCAAAGGGAGCATGG - Intergenic
1165303429 19:34987870-34987892 TAGAGCCTTCAGAGGGAACATGG + Intergenic
1166534005 19:43560581-43560603 TAGAGCCTCCAGAAGGAACAGGG + Intronic
1167668060 19:50834137-50834159 TAGAACCCACAATAGGAGCCTGG + Intronic
1167702363 19:51057158-51057180 ATGAGCCTTAAATAGGAGCAGGG - Intronic
924993426 2:336190-336212 TAGAGCCCCCAAAAGAAGCAGGG + Intergenic
925477146 2:4230102-4230124 CAGAGCCTTCATTAAGAGAAGGG - Intergenic
926208169 2:10848713-10848735 TTGAGCCTCCAACAGGAACACGG - Intronic
926228892 2:10987960-10987982 TAGAGCCTTCAGTGAGAGCATGG - Intergenic
926590868 2:14738905-14738927 TAGAGCCTTCAGAGGGAACATGG + Intergenic
927200178 2:20573262-20573284 GAGAGCCTTCAGAGGGAGCATGG + Intronic
930428764 2:51247024-51247046 TAGAGCCTTCAGAGAGAGCATGG - Intergenic
932226923 2:70048761-70048783 TAGAGCCTTCAGAGGGAGCATGG - Intergenic
932312037 2:70750646-70750668 TAGAGCCTTCAGAGGGAGCACGG + Intronic
932507913 2:72254413-72254435 TAGAGCCTTCAGAAGGACAACGG + Intronic
932860972 2:75290917-75290939 TAGAGCCTCCAGAGGGAGCACGG - Intergenic
933439967 2:82299640-82299662 TGGAGCCTTCAGTGGGAGGATGG - Intergenic
933598821 2:84309006-84309028 TAGAGCCTTCCCAGGGAGCATGG + Intergenic
933628645 2:84631729-84631751 AAGAGCCTTCAGAATGAGCATGG + Intronic
934123209 2:88860486-88860508 TAGAGGCTTAAATAGGAGTTTGG - Intergenic
934578541 2:95419092-95419114 TAGAGCCTTCAGAGGGAGCAAGG + Intergenic
934600903 2:95657617-95657639 TAGAGCCTTCAGAGGGAGCAAGG - Intergenic
935502597 2:103859405-103859427 TAGAGCCTTCAGAGGGAGCATGG - Intergenic
936234124 2:110729048-110729070 TAGAGCCTTCAAAAGTAACAAGG + Intergenic
936534277 2:113299768-113299790 TAGAGCCTTCAGAGGGAGCAAGG - Intergenic
936977554 2:118234761-118234783 TAGACCCTTGAACAGGAGGAGGG - Intergenic
937036729 2:118788379-118788401 TAGAGCCTTCAGAGGGAGGATGG - Intergenic
938621798 2:133063047-133063069 TAGTGCCTTCCATGGGAGCTGGG - Intronic
940933523 2:159465133-159465155 TAGTGCCTTCAGAAGGAACATGG - Intronic
942980848 2:182079738-182079760 TACAGCCTTCAGTGGGAGCATGG - Intronic
943118519 2:183705308-183705330 TAGAGACTTCAAGAGGTGGAAGG + Intergenic
943996618 2:194775079-194775101 TTGAGCGTTCAATAGAAGAAGGG - Intergenic
944573449 2:201068431-201068453 TAGAGCCTTGAATTAGACCAAGG + Intronic
946529638 2:220557913-220557935 TAGAGCATTAAATAAGACCATGG + Intergenic
947281518 2:228460644-228460666 TAGAGTCTTCTAAGGGAGCACGG + Intergenic
947344020 2:229172395-229172417 TGGAGCCGTCAAAAAGAGCATGG - Intronic
947505926 2:230708452-230708474 TCTGGCCTTGAATAGGAGCAAGG - Intergenic
947937217 2:234017877-234017899 TGGTTCCTTCAATAGGAGCCTGG - Exonic
1169238258 20:3950467-3950489 TAGAGCCTTCAGAGGAAGCATGG + Intronic
1172737784 20:37141085-37141107 CAGAGACTTCAATAGCTGCAGGG + Intronic
1172954280 20:38744628-38744650 TGGAGCCTTCAAGAAGAGCATGG + Intergenic
1173003955 20:39125454-39125476 TAGAGCCTCCAGGTGGAGCATGG - Intergenic
1174093071 20:48065088-48065110 CAGAGACTTCAAGAGGAGCTTGG - Intergenic
1174435784 20:50505790-50505812 TGGAGCCTTCAGAGGGAGCACGG + Intergenic
1174578770 20:51556191-51556213 TAGAGCCTTCAGGGAGAGCATGG + Intronic
1174727543 20:52878603-52878625 TAGAGTCTTCAGAGGGAGCATGG - Intergenic
1175132140 20:56797349-56797371 TAGAGCCTCCAGGAGGAACATGG - Intergenic
1175783299 20:61697036-61697058 TAGAGCCTTCGGAGGGAGCATGG + Intronic
1175801134 20:61801619-61801641 TAGGGCCTCCAGTGGGAGCATGG - Intronic
1177571861 21:22897617-22897639 TAAAGCCTTCAAAGGAAGCATGG - Intergenic
1178454074 21:32730495-32730517 TAGAGCCTTTGGAAGGAGCATGG + Intergenic
1178719027 21:34991992-34992014 TAGAGCCTGCACAGGGAGCAAGG + Intronic
1178787612 21:35668114-35668136 TGGAGACTTCAAAAGGAGCATGG - Intronic
1179145804 21:38766375-38766397 TACAGTCTTCAGAAGGAGCAAGG + Intergenic
1179257961 21:39733719-39733741 TAGAGCCGTCAAAGGGAACATGG - Intergenic
1179373453 21:40828322-40828344 TTCAGCTTTCAACAGGAGCAAGG + Intronic
1182053839 22:27334211-27334233 TAGAGCCTTCAGAGGGAGCATGG - Intergenic
1182075288 22:27491270-27491292 TAGAGCCTTCAGACGTAGCACGG - Intergenic
1182665322 22:31954606-31954628 TAGAGCCTTCAGAGGGAGCGTGG - Intronic
1182670750 22:31993788-31993810 TAGAGCCTTCAGAAGCAGTATGG - Intergenic
1182782039 22:32875785-32875807 TGGAGCCTTCAGAAGGAGCATGG + Intronic
1182821766 22:33222706-33222728 TAGAGCCTTCAAGGGGATCATGG + Intronic
951220691 3:20066069-20066091 TACAGCCTTCAAAAGGAGTGTGG - Intronic
951393517 3:22136687-22136709 TATGTCCTTCAATAGGAGTATGG + Intronic
951658229 3:25033208-25033230 TAGAGCTTTCAAAAGAAACAAGG + Intergenic
951790804 3:26481979-26482001 TAGAGCCTTTAGAAGGTGCATGG + Intergenic
953461773 3:43087132-43087154 TAGAGCCTTCAGAGGGAGCATGG + Intronic
954742178 3:52761953-52761975 TGGAGAATTCAAGAGGAGCATGG + Intronic
954990594 3:54837655-54837677 TAGAACCTTCAGAGGGAGCATGG - Intronic
956032144 3:65050107-65050129 TAGAGTCTCCAAAGGGAGCATGG - Intergenic
956116320 3:65922564-65922586 TAGATCCTTCAAAGGAAGCAAGG + Intronic
956916912 3:73881245-73881267 TAGAATCTTCAAAGGGAGCATGG - Intergenic
957192721 3:77030612-77030634 TAGAGCCTTCCTCAAGAGCATGG - Intronic
957429624 3:80085179-80085201 TAAAGCCCTCAAAGGGAGCATGG + Intergenic
958466784 3:94469748-94469770 CAGAGCTTTGAAAAGGAGCATGG - Intergenic
959597684 3:108145903-108145925 TAGAACCTTCAGAAGTAGCATGG + Intergenic
959927784 3:111943982-111944004 AATATCCATCAATAGGAGCATGG + Intronic
960517156 3:118615025-118615047 TAGAGCCTTCAAAGGGAGCATGG + Intergenic
960765670 3:121127408-121127430 TAGAGTCTTCAGAGGGAGCACGG - Intronic
961203395 3:125061975-125061997 TGGAGCCTTCAGAGGGAGCATGG - Intergenic
962654714 3:137531508-137531530 TAGAGGCTTCAAATGGACCATGG - Intergenic
962662835 3:137621758-137621780 TAGATCCTTCAGAGGGAGCATGG - Intergenic
963377965 3:144494283-144494305 TAGAGCCTTCAGAGGAAGCAAGG - Intergenic
964958067 3:162386882-162386904 GAGAGGCTTCAAAAGTAGCATGG - Intergenic
964975021 3:162607430-162607452 TAGAGCCTTCATAGAGAGCATGG - Intergenic
965903196 3:173669379-173669401 TAGTGCATTCAAAGGGAGCATGG - Intronic
966497519 3:180598058-180598080 TATATCCTTCAATAGGATAATGG + Intergenic
967001650 3:185341398-185341420 CAAAGCCTTCAGCAGGAGCATGG + Intronic
967077003 3:186012327-186012349 TAGAGGCTTCAAAGAGAGCATGG + Intergenic
967223842 3:187272730-187272752 TGGAGCCCTCAGAAGGAGCATGG + Intronic
967954835 3:194870106-194870128 TAGAGCCTTCCCAGGGAGCAGGG - Intergenic
969002125 4:3990852-3990874 TAGAGCCTTCAGAGGGAGCACGG - Intergenic
969269615 4:6090380-6090402 TAGAGCTTTCCAAGGGAGCATGG + Intronic
969751878 4:9117658-9117680 TAGAGCCTTCAGAGGGAGCGCGG + Intergenic
970438789 4:16061759-16061781 TAGAGGCTTCAGAAGGACCATGG - Intronic
970523471 4:16908567-16908589 TAGAGCCTTCAGAGGGGGCATGG + Intergenic
970858500 4:20675372-20675394 TAGAGCCTCCAGATGGAGCATGG + Intergenic
970886628 4:20993858-20993880 TAGATCCTCCAATAGGAACGTGG - Intronic
971247744 4:24945495-24945517 CAGAGCCTTCAAAGGGAGCATGG + Intronic
971278163 4:25217406-25217428 CAGAGCCTTCAGAGGGAGCATGG + Intronic
971477184 4:27083517-27083539 TAGAGACTTCAGAAGGAGGATGG - Intergenic
972990664 4:44819401-44819423 CAGAGCCTTCAGAGGGAGCATGG - Intergenic
974325680 4:60412238-60412260 TACAGGCTTCAGAAGGAGCATGG - Intergenic
974383047 4:61167112-61167134 TGGAGCCTTCAGAGGGAGCATGG + Intergenic
975351628 4:73353509-73353531 TAGAACCTTCAAAGAGAGCATGG + Intergenic
975572572 4:75832815-75832837 TAGAGCCTTCGGAGGGAGCATGG + Intergenic
976196584 4:82537852-82537874 TAGAGCCTTCAATAGGAGCAGGG + Intronic
976339712 4:83933622-83933644 TAGAGCCTTCAGCAAGAGCATGG - Intergenic
976544387 4:86317883-86317905 TAGAGCCTTCAGAGAGAGCATGG - Intronic
977907877 4:102499314-102499336 TAGAGCCTTCAGAGGGATCATGG + Intergenic
977912069 4:102548660-102548682 TAGAGCCTTCAAAGGGGGCACGG - Intronic
978483080 4:109216680-109216702 TAGAGGCTTCAGAGGGAGCATGG + Intronic
978644933 4:110918983-110919005 TAGAGCCTCCAGAAGGAGCGTGG - Intergenic
978769248 4:112436679-112436701 TAGAGCCTTCAGCAGGATGATGG + Intronic
979162638 4:117483101-117483123 TAGAGCTTTCAGAGGGAGCATGG - Intergenic
979441795 4:120758608-120758630 TAGCGCCTTCACAGGGAGCATGG + Intronic
979615589 4:122739135-122739157 TTGATCCTTCAGAAGGAGCATGG + Intronic
979817080 4:125122033-125122055 TATATCCTTCAATAGGTGAATGG + Intergenic
980015286 4:127643298-127643320 TAGAGCTTTGAATAGGAGTTGGG - Intronic
980106853 4:128596110-128596132 CATAGCCTTCCATAGGGGCACGG + Intergenic
981141858 4:141278265-141278287 TAGAGTCTTCAGAAGGAACATGG + Intergenic
981604100 4:146523931-146523953 TAGAGCCTTCAGCGGGAGTATGG - Intergenic
982309666 4:153971798-153971820 TAGAGCATTCACAAAGAGCAGGG - Intergenic
983651716 4:170042589-170042611 TAGTGCCTTCAGCGGGAGCATGG - Intergenic
985772477 5:1821552-1821574 TGGAGCCTTCAGTGGGAGCAGGG - Intergenic
986847803 5:11776040-11776062 TAGAGCCTTCAGAGGGAGCATGG + Intronic
986900643 5:12428583-12428605 TAGAGCCTCCAAAAGGAGAGTGG - Intergenic
988173182 5:27685436-27685458 TAGAGCTTTCAGAGGGAGCATGG - Intergenic
988483308 5:31647464-31647486 TAGAGCTTCCAGAAGGAGCACGG - Intronic
988594114 5:32575323-32575345 TAAAGCTTTCAGGAGGAGCATGG - Intronic
988650387 5:33142419-33142441 TAGAGTCTTCATAAAGAGCATGG + Intergenic
989344659 5:40416457-40416479 TAGAGCCTTCAAAAGGAGCAGGG + Intergenic
989378081 5:40786310-40786332 TAGAGCCTTCAGAAGAAACATGG + Intronic
990151968 5:52828793-52828815 TAGAGGCTTCAGAAGGAGTATGG - Intronic
990168202 5:53018197-53018219 TAAAGTCTCCTATAGGAGCACGG + Intronic
990389001 5:55299553-55299575 TAGAGCCTTCAGAGAGAGCATGG - Intronic
990723015 5:58719638-58719660 TAGAGCCTTCAGTGACAGCATGG - Intronic
991076022 5:62539209-62539231 TAGACCCTTCAGAAAGAGCAAGG - Intronic
991098228 5:62762221-62762243 TAGAGCCTTCAAAGAGAGTATGG + Intergenic
991119947 5:63001073-63001095 CAGAGCCTCCAAAGGGAGCATGG - Intergenic
991256101 5:64616947-64616969 AAGATCCATCAATAGAAGCATGG + Intergenic
991700472 5:69312282-69312304 TAAAGCCTTCAGAGGGAGCACGG + Intronic
991939609 5:71838088-71838110 TAGAGCCTTCAGAGGGAGCATGG - Intergenic
992287035 5:75246665-75246687 TAGAACCTTCAGAAAGAGCATGG - Intergenic
993293996 5:86110472-86110494 TAGAGCCTTCAGGAAGGGCATGG + Intergenic
994560298 5:101361536-101361558 TACTGCCTTCAAATGGAGCATGG - Intergenic
995355067 5:111227888-111227910 TGGAGCCCTGAATAGGATCATGG - Intronic
995418460 5:111935942-111935964 TAGAGCCTTCAGAGAGAGCATGG - Intronic
995469659 5:112487604-112487626 GAGATCCTTCAATAGGTGAATGG - Intergenic
996399022 5:123039746-123039768 TAGAGCCTTCAAAGACAGCATGG + Intergenic
998024354 5:138801874-138801896 TAGAGTTTTAAATAGCAGCAGGG - Intronic
998188720 5:140003560-140003582 TAGAGCCTCCAGAAGGAACACGG + Intronic
999359827 5:150974143-150974165 TAGAGCTTTCAGGGGGAGCATGG - Intergenic
999558254 5:152768837-152768859 TACAGACTAGAATAGGAGCAAGG - Intergenic
999977854 5:156929651-156929673 TAGAGCCTCCAAGGAGAGCATGG + Intronic
1000865024 5:166502810-166502832 TAGAGCCTTCAGAGGTAGCATGG + Intergenic
1002085622 5:176773553-176773575 TAGAGCCTTCAGAGGGTGCATGG + Intergenic
1002254523 5:177949525-177949547 GAGATCTTTGAATAGGAGCAAGG - Intergenic
1002483467 5:179518287-179518309 GAGATCTTTGAATAGGAGCAAGG + Intergenic
1003628544 6:7765786-7765808 TAGAGCCTCCAGAAGGAACACGG - Intronic
1003946888 6:11084215-11084237 TAGAGCCCTCAGAGGGAGCATGG + Intergenic
1004132519 6:12934065-12934087 TAGAGCCTGCAAAAGGACCGTGG - Intronic
1004565525 6:16792599-16792621 TAGAGACTTCACAGGGAGCATGG - Intergenic
1004750088 6:18553772-18553794 TAGAGCCTTTAGAGGGAGCATGG + Intergenic
1004881446 6:20012432-20012454 CAGAGCCTTCAGAGGGAGCATGG + Intergenic
1005573982 6:27175108-27175130 TAGAGCCTCCATGAGGAACATGG - Intergenic
1007924281 6:45638985-45639007 CAATGCCTTCAATGGGAGCAGGG + Intronic
1007972651 6:46068190-46068212 TAGAGCCTTCAGAAGGAGTGTGG + Intronic
1008640644 6:53458845-53458867 TAGAGCATTCAGCAGGAGCATGG + Intergenic
1008642173 6:53475258-53475280 TAGAGCCTTCAGAGGGAGCATGG - Intergenic
1009481981 6:64170445-64170467 TAGAGCCTTCAGAAGGGGTATGG - Intronic
1009533651 6:64852832-64852854 TAGACCCTTCAGAGGGAGCATGG + Intronic
1009801507 6:68543141-68543163 TAAAGCCTTCAGAAAGAGCATGG + Intergenic
1010154927 6:72781297-72781319 TAGAGTCTTCATAGGGAGCATGG + Intronic
1010175788 6:73026478-73026500 TCCAGCTTTAAATAGGAGCAGGG - Intronic
1010339534 6:74732153-74732175 TAGAGCCTTCAGCAGAAGCCTGG + Intergenic
1010461655 6:76120633-76120655 CAAAGCCTTCAAGAGGAGAAAGG + Intergenic
1011936631 6:92786789-92786811 TAGAGCCTTCAGAGAGAGCATGG + Intergenic
1013041497 6:106438439-106438461 TAGAGCCTTCAGAAGGAGCACGG - Intergenic
1013274550 6:108571684-108571706 TAGAGCCTTCCCAGGGAGCATGG + Intronic
1014060398 6:117064940-117064962 TACAGGTTTCAACAGGAGCATGG - Intergenic
1014200000 6:118598658-118598680 TAGACCCTTCAGAGGGAGCATGG + Intronic
1014760308 6:125348920-125348942 TAGAGCCTTCAGAGGGAGCAAGG + Intergenic
1014945687 6:127494680-127494702 TAGAACCTTCTTTTGGAGCAGGG + Intronic
1015308466 6:131736850-131736872 TAGAGCCTTCAAAAAGAACATGG - Intronic
1015332547 6:131997566-131997588 TAGAGCCTTCAGACAGAGCATGG + Intergenic
1015949957 6:138542269-138542291 TGGAGCCTTCAGAGGGAGCACGG + Intronic
1018110885 6:160535953-160535975 TAGATCCTTCAAGAGGATTATGG - Intronic
1018155334 6:160980323-160980345 TAGAGCCTTCAAAGAGAACATGG - Intergenic
1022337378 7:29434439-29434461 TAGAGCCTTCAGAGAGAGCATGG - Intronic
1023298794 7:38745608-38745630 AAGAGCCTTCAATTAAAGCAGGG + Exonic
1023482485 7:40648824-40648846 CAGAGCCTTCAGAGGGAGCACGG + Intronic
1023535993 7:41211594-41211616 TAGAGCCTTCAAAGGGAGCATGG + Intergenic
1026680829 7:72465388-72465410 TAGAGCCTACTATAGGGGCAAGG - Intergenic
1028555149 7:92115527-92115549 TAGAACCTTAAGGAGGAGCACGG + Intronic
1030007419 7:105132830-105132852 TAGAGGTTTTAATAGGAGCGGGG - Exonic
1030990293 7:116291352-116291374 TAGAGCCTGGAATGGGAGCCTGG - Intronic
1031029088 7:116715291-116715313 TAGAGCCTCCAGAGGGAGCATGG - Intronic
1031096834 7:117430252-117430274 TAGAGCCTTCAGAGGAAGCATGG - Intergenic
1031117970 7:117688795-117688817 TAGAGCCTTCAGAGAGAGCATGG - Intronic
1031729962 7:125287992-125288014 TAGAGCCTTCGGAGGGAGCACGG - Intergenic
1033069046 7:138185250-138185272 TAGAGCCTTCAGGGAGAGCATGG - Intergenic
1033235760 7:139636670-139636692 TGGAGCCTTCAGAGGGAGCATGG + Intronic
1033506273 7:142004523-142004545 TAGAGACTCCAAAAGGAGAAAGG + Intronic
1034150592 7:148912126-148912148 TAGAGCCCTCAGAAAGAGCATGG - Intergenic
1034398963 7:150848785-150848807 TTGAGCCTCCAAAGGGAGCATGG + Intronic
1034401270 7:150863183-150863205 TAGAGCCTCCATTAGGAACAAGG + Intergenic
1034542753 7:151769568-151769590 CAGAGCCTTCAGAGGGAGCATGG + Intronic
1034781977 7:153888757-153888779 CAGAACCTTCAAAAGTAGCAAGG - Intronic
1036375086 8:8193088-8193110 TAGAGCCTTCAGAGGGAGCATGG + Intergenic
1036854455 8:12230060-12230082 TAGAGCCTTCAGAGGGAGCACGG - Intergenic
1036875815 8:12472560-12472582 TAGAGCCTTCAGAGGGAGCATGG - Intergenic
1037474127 8:19239558-19239580 TGGAGCCTTCAGAAGGAACATGG - Intergenic
1039176851 8:34818159-34818181 TAGAGCCTTCAGAGGGAGCGTGG + Intergenic
1039800424 8:40949922-40949944 TAGAGCCTTCAAAGGGAGCACGG + Intergenic
1039831197 8:41216487-41216509 TGGAGCCTTCATGGGGAGCAGGG - Intergenic
1040600657 8:48880604-48880626 TAGAGCCCTCAGAAGGAGCAGGG - Intergenic
1040794510 8:51274186-51274208 TAGAGCCTTCAGAGGTAGCATGG - Intergenic
1040891134 8:52317426-52317448 TAGAGCCTTCGGAGGGAGCATGG + Intronic
1041135087 8:54749608-54749630 TAAAGCCTTCAAGAGGAGTTGGG + Intergenic
1041721604 8:60981043-60981065 TAGAGCCTCCAAATGGAGGAGGG + Intergenic
1042154402 8:65826821-65826843 TAAAGCCTTCAAAGGGAGCATGG - Intronic
1042193726 8:66213862-66213884 TTGTGCCTTCCATAAGAGCATGG - Intergenic
1044063553 8:87669743-87669765 CAGAGCCTTCAGAGGGAGCATGG - Intergenic
1044785611 8:95789192-95789214 TAGAGGCTTCAAAGGGAGCATGG + Intergenic
1045604577 8:103757916-103757938 TAGAGCCTTCTGAAGGATCATGG + Intronic
1045858962 8:106794339-106794361 TAGAGCCATCAGAGGGAGCATGG - Intergenic
1046010429 8:108539724-108539746 TAGACCCTTCAGGAAGAGCATGG + Intergenic
1046311920 8:112448584-112448606 TACAGCCTTCAGAGGGAGCATGG + Intronic
1046951596 8:120024711-120024733 TAGAGCCATCAGAGGGAGCATGG + Intronic
1047221738 8:122924198-122924220 TAGAGGCTTCAGAGGGAGCACGG - Intronic
1047388016 8:124427385-124427407 TAGAGCCTTCAGAGGGAGCATGG - Intergenic
1047438706 8:124857462-124857484 TTGTGCCTTCACCAGGAGCAGGG + Intergenic
1048018044 8:130514833-130514855 TAGAGCCTTCAGAGGGAGCATGG - Intergenic
1048048361 8:130794150-130794172 TAGAGCCTTCAGAGGGAGCAGGG + Intronic
1048193549 8:132312107-132312129 AAGAGCCTTCAGAAGGAGCGTGG + Intronic
1048253148 8:132883923-132883945 TAGAGCTTTCAGAGGGAGCACGG - Intronic
1048512612 8:135076355-135076377 TAGAGCCTTCAGAGGGAGCATGG - Intergenic
1048599342 8:135902462-135902484 TAGAGTCCTCAGAAGGAGCACGG - Intergenic
1049416003 8:142495539-142495561 TAGAGCCTTTGGAAGGAGCATGG - Intronic
1049974927 9:852516-852538 AACAGCATTCTATAGGAGCACGG - Intronic
1050173333 9:2844877-2844899 TAGAGCCTTCAAAAGGTGCAGGG - Intergenic
1050277451 9:4014617-4014639 TAGAGCCATCAATGTAAGCATGG + Intronic
1051686623 9:19664857-19664879 TAGAGCCTTCAGAGTGAGCATGG + Intronic
1052620342 9:30900180-30900202 TAGAGCCTCCAAAGGGAGCCTGG - Intergenic
1053527205 9:38842185-38842207 TGGAGCCTTCAGGGGGAGCATGG + Intergenic
1054199428 9:62066616-62066638 TGGAGCCTTCAGGGGGAGCATGG + Intergenic
1054638927 9:67521741-67521763 TGGAGCCTTCAGGGGGAGCATGG - Intergenic
1055337922 9:75251777-75251799 AAGAGCCTCCTATAGGAGTATGG + Intergenic
1056028969 9:82531069-82531091 TAGACCCTTCAGAGGGAGCATGG - Intergenic
1056107514 9:83361920-83361942 TAGAGCCTTCGGAGGGAGCATGG + Intronic
1056508601 9:87281273-87281295 CAGAGCCTTCAGAAGGACCAAGG + Intergenic
1057055621 9:91958385-91958407 TAGAGCCTTCAGAGGGAGCATGG + Intergenic
1058203855 9:102077302-102077324 CAGAGCCTTCAAAGGAAGCATGG - Intergenic
1060001819 9:119965696-119965718 TAGAGCCCTCAGGAGGAGAATGG + Intergenic
1060033817 9:120237798-120237820 CAGAGCCTTCAGAGGGAGCATGG - Intergenic
1062737521 9:138145691-138145713 TAGTGCCTTCAGAGGGAGCATGG - Intergenic
1185653506 X:1666380-1666402 TAGAGCCTCCAGAGGGAGCACGG - Intergenic
1185831257 X:3305209-3305231 TAGAGCCTCCAGAGGGAGCATGG - Intergenic
1186423930 X:9448728-9448750 TAGAGCCTTCAGAGGGAACATGG + Intergenic
1187288881 X:17932828-17932850 TAGAGCCTTCAGAAGGCACATGG - Intergenic
1188029928 X:25252935-25252957 TAGAGCCTTCAGAGGGAACACGG + Intergenic
1188255116 X:27952605-27952627 TAGAGCCTTCGGAGGGAGCATGG + Intergenic
1188990680 X:36816050-36816072 TAGAGACCTCAATATGAGCTTGG + Intergenic
1189577408 X:42369079-42369101 TAGAGCCTCCAAAGGGATCATGG + Intergenic
1190461830 X:50684384-50684406 TAGAGCCTTCAGAGAGAGCATGG + Intronic
1190746443 X:53325759-53325781 TAGAGCCTTCAGAGGGAGCATGG + Intergenic
1191786185 X:64919253-64919275 TGGAGTCTTTAAGAGGAGCAAGG - Intronic
1192269346 X:69564287-69564309 TAGAGCCTCCAGAGGGAGCAGGG - Intergenic
1193545223 X:82818426-82818448 TTGAGCACTCAATAGGACCAGGG + Intergenic
1194305867 X:92247562-92247584 TAGAGCTTTCAGAGGGAGCACGG - Intronic
1194569577 X:95537708-95537730 TATAGCAATCACTAGGAGCATGG - Intergenic
1194979757 X:100428309-100428331 TAGAGTCTTCAGAGGGAGCATGG - Intergenic
1195028837 X:100906768-100906790 TAGAACCTCCAAAAGGAACATGG - Intergenic
1195588199 X:106591295-106591317 TAGAGCCTTCAGAGAGAGCATGG - Intergenic
1196898756 X:120362706-120362728 TAGAATCCCCAATAGGAGCAGGG + Intronic
1196963848 X:121033700-121033722 TAGAGCCTTTAGAAGGAGCATGG + Intergenic
1197410794 X:126113982-126114004 GAAAACCTTCAATAAGAGCAGGG + Intergenic
1198029889 X:132744718-132744740 GAGAGCCCTCAGTAGGAGGAGGG - Intronic
1198306074 X:135384225-135384247 TAGAACCTTCAGAGGGAGCATGG + Intergenic
1198402015 X:136277740-136277762 TAGAGCCATTAAGAGGAACAGGG - Intergenic
1198666761 X:139032692-139032714 TTGATCCTTCAGTAGAAGCAAGG + Intronic
1200082485 X:153585069-153585091 TGGAGCCTTCAGAGGGAGCATGG - Intergenic
1200326644 X:155247526-155247548 TACAGCCTTCAGAGGGAGCATGG - Intergenic
1200399678 X:156011904-156011926 TAGTGCCTTCAGAGGGAGCATGG - Intergenic
1201245313 Y:11997458-11997480 TAGAGCCTCCATAGGGAGCATGG + Intergenic
1201889430 Y:18925717-18925739 TAGAGCCTTCCACTGGAGCATGG - Intergenic