ID: 976203264

View in Genome Browser
Species Human (GRCh38)
Location 4:82600176-82600198
Sequence CCTCTGTCATCCTAACTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976203260_976203264 -2 Left 976203260 4:82600155-82600177 CCTGCATTCTTCCGTCTTTTCCC No data
Right 976203264 4:82600176-82600198 CCTCTGTCATCCTAACTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976203264 Original CRISPR CCTCTGTCATCCTAACTTGT TGG Intergenic
No off target data available for this crispr