ID: 976203267

View in Genome Browser
Species Human (GRCh38)
Location 4:82600188-82600210
Sequence TAACTTGTTGGCTTTCCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976203260_976203267 10 Left 976203260 4:82600155-82600177 CCTGCATTCTTCCGTCTTTTCCC No data
Right 976203267 4:82600188-82600210 TAACTTGTTGGCTTTCCCCTGGG No data
976203262_976203267 -10 Left 976203262 4:82600175-82600197 CCCTCTGTCATCCTAACTTGTTG No data
Right 976203267 4:82600188-82600210 TAACTTGTTGGCTTTCCCCTGGG No data
976203261_976203267 -1 Left 976203261 4:82600166-82600188 CCGTCTTTTCCCTCTGTCATCCT No data
Right 976203267 4:82600188-82600210 TAACTTGTTGGCTTTCCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976203267 Original CRISPR TAACTTGTTGGCTTTCCCCT GGG Intergenic
No off target data available for this crispr